CN107384897B - Alkaline protease, gene and application thereof - Google Patents

Abstract

The invention belongs to the field of bioengineering, and particularly relates to alkaline protease and a gene and application thereof. The amino acid sequence of the alkaline protease is shown in SEQ ID NO. 1. The basic sequence of the alkaline protease gene is shown in SEQ ID NO. 2. The invention also provides a recombinant vector containing the alkaline protease gene and a recombinant strain containing the alkaline protease gene. The invention constructs a recombinant plasmid containing an alkaline protease gene by using a genetic engineering technology, and realizes the high-efficiency expression of the alkaline protease in the bacillus amyloliquefaciens. The constructed alkaline protease recombinant strain has higher application value and higher alkaline protease production capacity, and the enzyme activity is improved by about 55 percent compared with that of wild bacteria under the same fermentation condition.

Description

Alkaline protease, gene and application thereof

Technical Field

The invention relates to the field of bioengineering, in particular to alkaline protease and a gene and application thereof.

Background

The alkaline protease is also called as serine protease, belongs to the class of proteases, has the optimum pH of 9-11, and is relatively stable at the pH of 5-10. The alkaline protease is mainly used in the washing industry and has wide application in the fields of food, medical treatment, brewing, silk, leather making and the like.

Alkaline proteases were first found in the pancreas of pigs. In 1913, Rohm first used trypsin for washing soaking agents. Jaag et al, dr in switzerland, discovered alkaline proteases of microbial origin, making it possible to use the proteases extensively in the detergent industry in 1945. At present, protease is the largest enzyme in industrial enzymes, accounting for about 60% of the total annual sales worldwide, and alkaline protease accounts for about 25%. Therefore, alkaline proteases have significant commercial value and potential for development.

Compared with foreign countries, although the enzyme preparation industry in China is rapidly developed, a certain gap still exists. At present, the market demand of alkaline protease is larger, but the production level of the existing alkaline protease production strain needs to be improved, and a high-efficiency expression strain of alkaline protease needs to be developed.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides alkaline protease, genes, engineering bacteria (recombinant strains) and a preparation method thereof.

The invention also aims to provide the application of the alkaline protease and the genetically engineered bacteria.

The invention separates a new alkaline protease from Bacillus licheniformis CRVAB300(Bacillus licheniformis).

The invention provides an alkaline protease, the amino acid sequence of which is shown as SEQ ID NO. 1:

the alkaline protease of the present invention has good thermal stability and pH stability. The optimum temperature is 40 ℃, and the relative enzyme activity is more than 80% between 35 ℃ and 60 ℃. Keeping the temperature for 1h at 40-50 ℃, keeping the residual enzyme activity above 70%, and keeping the residual enzyme activity at 60% even after keeping the temperature for 2h at 50 ℃; the optimal pH value of the recombinant alkaline protease is 10.5, and the relative enzyme activity between the pH value of 9-11 reaches more than 80%. The enzyme can tolerate 1h within the pH range of 7-11, and the residual enzyme activity reaches more than 90%.

The present invention provides a gene encoding the above alkaline protease. Specifically, the base sequence of the gene is shown as SEQ ID NO. 2:

the coding gene of the alkaline protease is separated and cloned by a PCR method, and the DNA complete sequence analysis result shows that the coding gene of the alkaline protease has the full length of 1137 bp. The sequence alignment of the coding gene of the alkaline protease shows that the similarity of the coding gene of the alkaline protease and the alkaline protease gene with GENBANK ACCESSION Number HM147766.1 reaches 91 percent.

The present invention also provides a recombinant vector comprising the above alkaline protease gene, preferably plasmid pwB980 comprising the alkaline protease gene of claim 2 or 3. The recombinant plasmid pwB980 further comprises a kan resistance gene, a P43 promoter sequence, an SPsacB signal peptide sequence and a Bacillus subtilis terminator sequence; the alkaline protease gene of the invention is positioned between the SPsacB signal peptide sequence of the recombinant plasmid pwB980 and the terminator sequence of the bacillus subtilis.

The invention also provides a recombinant strain containing the alkaline protease gene, and preferably the recombinant strain is Bacillus amyloliquefaciens K1.

The invention also provides a method for preparing the alkaline protease, which comprises the following steps:

1) transforming a host cell with the recombinant vector containing the alkaline protease coding gene to obtain a recombinant strain;

2) culturing the recombinant strain for fermentation, and inducing the expression of the recombinant alkaline protease;

3) recovering and purifying the expressed alkaline protease.

Preferably, the host cell is bacillus amyloliquefaciens, and the bacillus amyloliquefaciens is transformed by the recombinant expression plasmid to obtain a recombinant strain.

The fermentation medium is a liquid medium and mainly comprises the following components: 20-40 g/L of corn flour, 20-40 g/L of bean cake powder, 30-50 g/L of bran, 0.2-0.5 g/L of monopotassium phosphate, 3-5 g/L of disodium hydrogen phosphate and the balance of water.

The fermentation temperature is 29.5-35 ℃, and preferably 30 ℃.

The invention also provides the application of the alkaline protease. Preferably, the alkaline protease in feed, food, medicine and other industrial fields application, especially in the field of protein degradation application.

The alkaline protease of the present invention has good thermal stability and pH stability. The optimum temperature is 40 ℃, and the relative enzyme activity is more than 80% between 35 ℃ and 60 ℃. Keeping the temperature for 1h at 40-50 ℃, keeping the residual enzyme activity above 70%, and keeping the residual enzyme activity at 60% even after keeping the temperature for 2h at 50 ℃; the optimal pH value of the recombinant alkaline protease is 10.5, and the relative enzyme activity between the pH value of 9-11 reaches more than 80%. The residual enzyme activity of the enzyme reaches more than 90 percent within the pH range of 7-11. Can be applied to the industrial fields of feed, food, medicine and the like.

The invention constructs a recombinant plasmid containing an alkaline protease gene by using a genetic engineering technology, and realizes the high-efficiency expression of the alkaline protease in the bacillus amyloliquefaciens. The constructed alkaline protease recombinant strain has higher application value and higher alkaline protease production capacity, and the enzyme activity is improved by about 55 percent compared with that of wild bacteria under the same fermentation condition.

Drawings

FIG. 1 is a PCR amplification electrophoretogram of alkaline protease gene of example 1 of the present invention, wherein: 1. is alkaline protease gene fragment, 2 is DNA molecular weight standard;

FIG. 2 is a schematic structural diagram of a recombinant plasmid pwb980-apr according to the present invention;

FIG. 3 shows the optimum temperature of the recombinant alkaline protease of the present invention;

FIG. 4 shows the thermostability of the recombinant alkaline protease of the present invention;

FIG. 5 shows the optimum pH of the recombinant alkaline protease of the present invention;

FIG. 6 shows the pH stability of the recombinant alkaline protease of the present invention.

Detailed Description

Test materials and reagents

1. Bacterial strain and carrier

Expression vector pwb980 was purchased from Invitrogen; bacillus subtilis strain 168 was purchased from China center for Industrial culture Collection of microorganisms (CICC). Bacillus amyloliquefaciens K1 was isolated from soil.

2. Enzymes and other biochemical reagents

Enzymes and other biochemical reagents: the endonuclease was purchased from TaKaRa, and the ligase was purchased from Invitrogen. p-nitrophenyl-a-L-arabinofuranoside (pNPAf) was purchased from Sigma, and others were made available from general Biochemical Agents.

Description of the drawings: the molecular biological experiments, which are not specifically described in the following examples, were performed according to the methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruker, or according to the kit and product instructions.

EXAMPLE 1 obtaining of alkaline protease Gene

Bacillus licheniformis CRVAB300 was isolated from soil samples collected near water reservoirs. The soil sample is dissolved in sterile water, and after enrichment culture, a proper dilution gradient is taken to be coated on a flat plate containing 1% of skimmed milk, and the soil sample is obtained by screening according to the size of a transparent ring on the flat plate.

Extracting the genomic DNA of the Bacillus licheniformis CRVAB300(Bacillus licheniformis):

(1) taking 0.5-2 mL of culture bacteria liquid, centrifuging at 10000rpm for 30s, sucking supernatant as much as possible, and collecting thalli;

(2) adding 200 mu L of buffer RB into an EP tube for resuspension, centrifuging at 10000rpm for 30s, and discarding the supernatant;

(3) for gram-positive bacteria: adding 120 mu L of lysozyme, reversing and uniformly mixing, and carrying out water bath at 37 ℃ for 30-60 min;

(4) centrifuging at 12000rpm for 2min, discarding the supernatant, and then shaking or blowing the cells to resuspend in 180 μ L buffer solution RB;

(5) adding 20 mu L of RNase A (25mg/mL) solution, shaking and uniformly mixing, and standing at room temperature for 5-10 min;

(6) adding 800 μ L of binding solution CB, adding 100 μ L of isopropanol, immediately whirling, oscillating, and mixing completely, wherein flocculent precipitate may appear;

(7) adding the mixture (including possible precipitate) in the last step into an adsorption column AC, putting the adsorption column into a collecting pipe, centrifuging at 13000rpm for 30-60 s, and discarding waste liquid;

(8) adding 500 μ L inhibitor removing solution IR, centrifuging at 12000rpm for 30s, and discarding waste liquid;

(9) adding 700 mul of rinsing liquid WB at 12000rpm, centrifuging for 30s, and discarding waste liquid;

(10) adding 500 mul of rinsing liquid WB at 12000rpm, centrifuging for 30s, and discarding waste liquid;

(11) putting the adsorption column AC back into an empty collection pipe, centrifuging at 13000rpm for 2min, and removing the rinsing liquid as much as possible so as to prevent residual ethanol in the rinsing liquid from inhibiting downstream reaction;

(12) taking out the adsorption column AC, putting the adsorption column AC into a clean centrifugal tube, adding 100 mu L of elution buffer EB into the middle part of the adsorption film, standing at room temperature for 3-5 min, and centrifuging at 12000rpm for 1 min. Adding the obtained solution into a centrifugal adsorption column again, standing at room temperature for 2min, and centrifuging at 12000rpm for 1 min;

(13) the resulting DNA was stored at-20 ℃.

The above genomic DNA was used as a template to amplify the alkaline protease gene by PCR. The amplification primers are as follows: an upstream primer: 5' -

GCTGGCAGGAGGCGCAACTCAAGCTTTTGCCATGATGAGGAAAAAGAGTTTTTGG-3'; a downstream primer: 5' -

GTTTTTCTTGGAATTGTGCTGAAGCTAGCTTATTGAGCGGCAGCTTCGAC-3’。

PCR amplification is carried out to obtain DNA fragments with the size of about 1200bp, and the fragments are recovered and then connected with a Peasy-T3 vector for sequencing. A1137 bp gene fragment (SEQ ID NO.1) is obtained by gene sequencing, and the similarity of the gene fragment and an alkaline protease gene with the GENBANK ACCESSION Number HM147766.1 is found to reach 91 percent after sequence comparison.

EXAMPLE 2 construction of alkaline protease expression vector pwb980-apr

The vector fragment was amplified by PCR using the Bacillus subtilis expression plasmid pwb980 as a template. The amplification primers are as follows: an upstream primer: 5'-GCTAGCTTCAGCACAATTCCAAGAAAAAC-3', respectively; the downstream primer is: 5'-GGCAAAAGCTTGAGTTGCGCCTCCTGCCAG-3' are provided. Carrying out PCR amplification to obtain a vector DNA fragment with the size of about 3738bp, recovering the fragment, carrying out polymer fusion PCR (You C, Zhang XZ, Zhang YH (2012) Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. apple Environ Microbiol78: 1593-1595) on the recovered fragment and the alkaline protease gene fragment, transforming a Bacillus subtilis B.subtilis 168 competent cell with the fusion product, coating the competent cell on an LB plate containing kanamycin (25 mu g/mL), selecting a positive transformant, extracting plasmid sequencing verification, and determining that a recombinant plasmid pwb980-apr is successfully obtained.

Example 3 transformation of Bacillus amyloliquefaciens K1 with the expression vector pwb980-apr

The preparation method of the bacillus amyloliquefaciens K1 competent cell comprises the following steps:

(1) bacillus amyloliquefaciens K1 was inoculated into 5mL of LB medium and cultured overnight.

(2) 2.5mL of the overnight culture was inoculated into 40mL (LB +0.5M sorbitol), cultured at 37 ℃ with shaking at 200rpm until OD₆₀₀Is between 0.6 and 0.8.

(3) And (3) carrying out ice-water bath on the bacterial liquid for 10min, then centrifuging the bacterial liquid for 5min at 4 ℃ by 5000g, and collecting thalli.

(4) The cells were resuspended in 50mL of pre-chilled electroporation medium (0.5M sorbitol, 0.5M mannitol, 10% glucose), 5000g, centrifuged at 4 ℃ for 5min, the supernatant removed and rinsed 4 times.

(5) The washed cells were resuspended in 1mL of the electroporation medium and dispensed into EP tubes, each containing 60. mu.L of the cells.

The conversion conditions were as follows:

(1) 50ng of plasmid DNA (1-8. mu.L) was added to 60. mu.L of competent cells, incubated on ice for 2min, added to a pre-cooled electric rotor (1mm), and shocked. Setting electric conversion parameters: 2.0kv, 1mm, 1 time of electric shock.

(2) After the electric shock, 1mL of recovery medium (LB +0.5M sorbitol +0.38M mannitol) was added immediately

(3) Shaking and culturing for 3h at 37 ℃ by a shaking table, coating the culture on an LB plate, culturing for 24-36 h at 37 ℃, and selecting a positive transformant to obtain the recombinant bacillus amyloliquefaciens K1/pwb 980-apr.

Example 4 method for obtaining alkaline protease from recombinant Bacillus amyloliquefaciens K1/pwb980-apr

The recombinant Bacillus amyloliquefaciens K1/pwb980-apr obtained in example 3 and Bacillus licheniformis CRVAB300 (wild type) were streaked and activated. The activation medium was LB plate. Picking a single colony to a 250mL shake flask filled with 25mL LB, carrying out shake culture at 37 ℃ and 220rpm for 8-10 hours, and taking the culture as a seed solution.

Inoculating the seed solution into a 500mL shake flask containing 50mL fermentation medium according to the inoculation amount of 10% (V/V), performing shake culture at 30 ℃ and 220rpm, and fermenting for 76 h.

The fermentation medium comprises the following components: 35g/L of corn flour, 35g/L of bean cake powder, 30g/L of bran, 0.3g/L of monopotassium phosphate, 4g/L of disodium hydrogen phosphate and the balance of water.

Taking the shake flask fermentation liquor, centrifuging at 12000rpm for 10min to remove precipitate, and measuring enzyme activity in the supernatant. Definition of enzyme activity unit: under certain temperature and corresponding pH conditions (pH 10.5), the casein is hydrolyzed within 1min to generate an enzyme amount which is equivalent to 1 mu g of phenolic amino acid (expressed by tyrosine equivalent), namely 1 enzyme activity unit, and is expressed by U (national standard of the people's republic of China, GB/T28715-.

The result shows that the enzyme activity of the recombinant bacillus amyloliquefaciens K1/pwb980-apr reaches 21000U/mL after fermentation for 72 hours, the enzyme activity of the wild strain is 13500U/mL, and the enzyme activity of the recombinant bacillus amyloliquefaciens K1/pwb980-apr is improved by nearly 55 percent compared with that of the wild strain.

Example 5 analysis of enzymatic Properties of recombinant alkaline protease

(1) Influence of temperature on the enzymatic Activity of the alkaline protease of the invention

Measurement of optimum temperature: the enzyme activity was measured at different temperatures at pH10.5, with the highest enzyme activity being 100%. The results show (figure 3), the optimal temperature of the recombinant alkaline protease is 40 ℃, and the relative enzyme activity is more than 80% between 35 ℃ and 60 ℃.

Measurement of thermal stability: the recombinant alkaline protease is respectively kept at different temperatures for 2h, the residual enzyme activity is measured at the pH of 10.5 every 20min, and the enzyme activity without heat preservation is determined to be 100%. The result shows (figure 4) that the recombinant alkaline protease is kept at 40-50 ℃ for 1h, the residual enzyme activity is over 70 percent, and even after being kept at 50 ℃ for 2h, 60 percent of residual enzyme activity still exists, which indicates that the enzyme has better thermal stability.

(2) Influence of pH on the enzymatic Activity of the alkaline protease of the present invention

Measurement of optimum pH: the enzyme activity is measured under different pH values at 40 ℃, and the highest enzyme activity is determined as 100%. The result shows (figure 5), the optimum pH value of the recombinant alkaline protease is 10.5, and the relative enzyme activity between the pH value of 9-11 reaches more than 80%.

Measurement of pH stability: and (3) preserving the recombinase at 40 ℃ for 1h under different pH conditions, and determining the residual enzyme activity of the recombinase, wherein the enzyme activity which is not preserved under corresponding pH is determined to be 100%. The result shows that (figure 6), the residual enzyme activity of the recombinant alkaline protease reaches more than 90% within the pH range of 7-11, which indicates that the enzyme has good pH tolerance.

The present invention may be embodied in many different forms and modifications may be effected therein by one skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

<110> Beijing Kogyo Bo Biotech Co., Ltd

<120> alkaline protease, gene and application thereof

<160>2

<210>1

<211>378

<212>PRT

<213> Bacillus licheniformis CRVAB300(Bacillus licheniformis)

<400>1

MMRKKSFWLG MLTAFMLVFT MAFSDSASRQ PAKNVEKDYI VGFKSGVKTA SVKKDICPES 60

GGKVDKQFRI INAAKAKLDK EALKEAKNDP DVAYVEEDYV AHALAQQVPY GIPLIKADKL 120

TYPSFKGANV KGAVLATGIP PYPIQCEANR FTGLVAGEAY NTDGNGHGTH VAGTVAALDN 180

TTGVLGVAPS VSLYAVKVLN SSGSGSYSGI VSGIEWATTN GMDVINMSKC LGSGSTAMKT 240

LRLNRFAKGV VVVAAAGNSG SSGNTNTIGY PAKYHSVIAV GAVDSNSGFA SFSSVGAELP 300

VMAPGAGVYS TPYRKHGTSR NGTSMASPHV AGAATLILSK HPNLPASQVR QWLSSTATYL 360

GSSFYYGKGL INVEAAAQ 378

<210>2

<211>1137

<212>DNA

<213> Bacillus licheniformis CRVAB300(Bacillus licheniformis)

<400>2

atgatgagga aaaagagttt ttggcttggg atgctgacggccttcatgct cgtgttcacg 60

atggcattca gcgattccgc ttctcgacaa ccggcgaaaa atgttgaaaa ggattatatt 120

gtcggattta agtcaggagt gaaaaccgca tctgtcaaaa aggacatctg ccccgagagc 180

ggcggaaaag tggacaagca gtttagaatc atcaacgcgg caaaagcgaa gctagacaaa 240

gaagcgctta aggaagccaa aaatgatccg gatgtcgctt atgtggaaga ggattatgtg 300

gcccatgcct tggcgcaaca agttccttac ggcattcctc tcattaaagc ggacaaattg 360

acatacccca gctttaaggg agcgaatgta aaaggagccg tcctggctac aggaatcccg 420

ccatacccca tacagtgcga agccaatcgt tttacggggc tagtggctgg cgaagcttat 480

aacaccgacg gcaacggaca cggcacacat gttgccggta cagtagctgc gcttgacaat 540

acaacgggtg tattaggcgt tgcgccaagc gtatccttgt acgcggttaa agtactgaat 600

tcaagcggaa gcggatcata cagcggcatt gtaagcggaa tcgagtgggc gacaacaaac 660

ggcatggatg ttatcaatat gagcaaatgc ctagggtcag gctcgacagc gatgaaaacc 720

ttgcgcctta accggtttgc caaaggggtt gtcgttgtag ctgcagcagg gaacagcgga 780

tcttcaggaa acacgaatac aattggctat cctgcgaaat accattctgt catcgctgta 840

ggtgcggtag actctaacag cggcttcgct tcattttcca gtgtgggagc agagcttcct 900

gtcatggctc ctggcgcagg cgtatacagc actccgtacc gtaagcatgg tacttcacga 960

aacggaacgt caatggcttc tcctcatgta gcgggagcag caactttgat cttgtcaaaa 1020

catccgaacc ttccagcttc acaagtccgc caatggctct ccagcacggc gacttatttg 1080

ggaagctcct tctactatgg gaaaggtctg atcaatgtcg aagctgccgc tcaataa 1137

Claims (10)

1. An alkaline protease, wherein the amino acid sequence of the alkaline protease is shown as SEQ ID NO. 1.

2. An alkaline protease gene encoding the alkaline protease of claim 1.

3. The alkaline protease gene according to claim 2, wherein the base sequence of the alkaline protease gene is shown as SEQ ID No. 2.

4. A recombinant vector comprising the alkaline protease gene of claim 2 or 3.

5. The recombinant vector according to claim 4, wherein the recombinant vector is the recombinant plasmid pwB980 comprising the alkaline protease gene of claim 2 or 3.

6. A recombinant strain comprising the alkaline protease gene of claim 2 or 3.

7. The recombinant strain of claim 6, wherein the recombinant strain is a recombinant Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) comprising the alkaline protease gene of claim 2 or 3.

8. A method for producing an alkaline protease, comprising the steps of:

1) transforming a host cell with the recombinant vector of claim 4 or 5 to obtain a recombinant strain;

2) culturing the recombinant strain to ferment and inducing the expression of the alkaline protease;

3) recovering and purifying the expressed alkaline protease.

9. Use of the alkaline protease of claim 1 for degrading proteins in the fields of feed, food and pharmaceutical industry.

10. Use of the recombinant strain according to claim 6 for the degradation of proteins in the fields of feed, food and pharmaceutical industry.

Images