CN111286513B - Mutant of rhizobium japonicum SMH12 and application thereof - Google Patents
Mutant of rhizobium japonicum SMH12 and application thereof Download PDFInfo
- Publication number
- CN111286513B CN111286513B CN202010171507.9A CN202010171507A CN111286513B CN 111286513 B CN111286513 B CN 111286513B CN 202010171507 A CN202010171507 A CN 202010171507A CN 111286513 B CN111286513 B CN 111286513B
- Authority
- CN
- China
- Prior art keywords
- nopp
- mutant
- rhizobium
- smh12
- pcm351
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/743—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Agrobacterium; Rhizobium; Bradyrhizobium
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/20—Reduction of greenhouse gas [GHG] emissions in agriculture, e.g. CO2
- Y02P60/21—Dinitrogen oxide [N2O], e.g. using aquaponics, hydroponics or efficiency measures
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Virology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a mutant of soybean rhizobium fast growing SMH12 and application thereof, wherein a nopP gene deletion mutant is constructed by using a creloxP system double-exchange displacement method. The mutant is obtained by taking the genome DNA of fast-growing rhizobium SMH12 as a template, respectively amplifying nopP homologous exchange upper arms and lower arms by using a nopP-up-F/R primer pair and a nopP-down-F/R primer pair, carrying out double enzyme digestion on the product, connecting the product with a digested pCM351 vector in two steps, and obtaining plasmid transformation. Thereby constructing and obtaining the rhizobium target gene mutant. After the nopP gene is mutated or deleted, the defense reaction of leguminous plants is inhibited or relieved, thereby promoting root rhizobium infection and nitrogen fixation. The improved rhizobia can improve the growth and nitrogen fixation capacity of leguminous crops, reduce the application of nitrogen fertilizer in agricultural production and generate huge economic and ecological benefits.
Description
Technical Field
The invention belongs to the technical field of agricultural microbial agents, and particularly relates to a mutant of soybean fast rhizobium SMH12 and application thereof.
Background
The factors influencing the effectiveness of the rhizobium inoculant are various, and mainly comprise three aspects of host leguminous plants, rhizobium and environment. From the perspective of the fungal-plant interaction, symbiotic nitrogen fixation of legume-rhizobia is associated with variability in host plant species. The flavonoid secreted by different leguminous plants has different types and structures; the genetics and genotypes of different leguminous plants also differ, which all affect the effectiveness of the application of the inoculated rhizobia agents. This phenomenon is also known as symbiotic match of rhizobia to leguminous plants. The nodulation and nitrogen fixation characteristics of the same rhizobia on different soybean varieties or the same soybean variety are greatly different. The nitrogen fixation effect of the rhizobium inoculant can be better exerted only by the combination of good matching of rhizobium and leguminous plants.
If the rhizobia with broad-spectrum matching performance can be screened or obtained by a gene improvement method, the rhizobia is easier to popularize and use. China is a country of origin of soybeans, indigenous rhizobia are abundant in soil, and the rhizobia are strong in competitiveness but mostly ineffective or low in efficiency. In addition, in the last decade, soybean varieties have been updated in China, but the updating speed of rhizobium strains is relatively delayed. Therefore, the existing rhizobium inoculation is poor in matching with the main cultivated soybean variety. Meanwhile, some genotypic soybean varieties show a nodulation limitation phenomenon on rhizobium inoculant. The research reports that the factors for regulating the nodulation capacity of rhizobia comprise nodulation factors, exopolysaccharides and the like. The manner and variety of effector proteins produced by bacteria is numerous, with effector proteins produced by the triple-type secretion system (T3SS) being more studied in pathogen-host interactions. The NopP protein secreted by the rhizobial triple-type secretion system (T3SS) is unique in the rhizobial family, and no homologous genes exist in pathogenic bacteria. The function of the NopP protein in fast-growing rhizobia, mesorhizobium, is unknown. In combination with the recent findings of the applicant, the applicant reasoned that host leguminous plants inhibit rhizobia infestation by sensing the specific rhizobia T3SS effector protein NopP and by defense reactions.
Through retrieval, no rhizobium inoculant for improving nodulation and nitrogen fixation capacity of leguminous crops based on mutation or knockout of a specific effector protein is reported.
Disclosure of Invention
The invention aims to provide a method for constructing a mutant based on the deletion of a rhizobium specific effector protein gene, and inhibiting (preventing) the immune defense reaction of leguminous plants, so as to expand and improve the symbiotic nodulation nitrogen fixation capacity of the leguminous plants.
The invention is realized by the following technical scheme:
a mutant of Rhizobium japonicum SMH12, which is constructed by the following steps:
1) respectively amplifying the upper arm and the lower arm of nopP homologous exchange by taking the genomic DNA of the soybean fast rhizobium SMH12 as a template;
2) connecting the product with the digested pCM351 vector in two steps after double enzyme digestion to obtain a plasmid pCM351: nopP-up-down;
3) the plasmid pCM351 shows that nopP-up-down is introduced into fast growing rhizobium japonicum SMH12 and transformed to obtain the mutant.
Further, the amplification primers in the step (1) are nopP-up-F/R and nopP-down-F/R,
wherein:
nopP-up-F：GGTACCATCATCTGGCAATCGGTT；
nopP-up-R：CATATGACGAGCTATCAATTCGACC；
nopP-down-F：GGGCCCGACTTACGAAGATGACTTCATG；
nopP-down-R：ACCGGTCATCTACTTATGAGCTCCAGC。
further, the step (2) is specifically that the homologous upper arm amplification product is connected to a vector pCM351 after being subjected to double enzyme digestion by Kpn I and NdeI to obtain pCM351: nopP-up, and the homologous lower arm amplification product is connected to the pCM351 after being subjected to double enzyme digestion by Apa I and Age I to obtain a plasmid pCM351: nopP-up-down.
Further, the crossover fragment on the recombinant plasmid in the step (3) is subjected to homologous recombination with the upstream and downstream fragments of nopP in the rhizobium genome, integrated on the chromosome, and then the gene is replaced.
Further, screening transformants by a primer pair nopP-MAP-R/Gm-F or nopP-MAP-F/Gm-R, carrying out PCR to verify mutants,
wherein:
nopP-Map-F：AGTCGGGACGCAATGGAT；
nopP-Map-R：ACTCCACTTCCAATCACTCCG；
Gm-F：ATGTTACGCAGCAGCAACG；
Gm-R：TTAGGTGGCGGTACTTGGG。
in another aspect of the invention, the application of the mutant of the rhizobium japonicum SMH12 in preparing the inoculant for leguminous crops is provided.
The invention has the beneficial effects that:
the invention aims at effector protein NopP secreted by a rhizobium T3SS system, constructs a gene deletion mutant, inhibits the interaction recognition of host leguminous plant R protein on NopP, reduces the defense reaction of leguminous plants, and removes the nodulation limitation of some leguminous plant varieties on rhizobium. Therefore, the prepared rhizobium inoculant has better nodulation and nitrogen fixation capacity. The mutant provided by the invention obviously improves the matching property of rhizobia and main-planted soybeans, enhances the nodulation and nitrogen fixation effect of the rhizobia, and is a good leguminous crop inoculant.
Drawings
FIG. 1 is a schematic diagram of the principle of constructing a deletion mutant of a target gene and identifying the deletion mutant by a creloxP system;
FIG. 2 shows the construction and identification of a mutant strain of Rhizobium japonicum SMH 12. delta. nopP; wherein A is homologous upper arm and lower arm, B is PCR verification, and C is SMH12 (delta nopP) mutant;
FIG. 3 is a symbiotic nitrogen-fixing phenotype of a mutant strain of Rhizobium japonicum SMH 12. delta. nopP with Jidou 17 and Zhonghuang 13;
FIG. 4 is a comparison of the activity of the soybean rhizobium SMH12 delta nopP rhizobium azotase, the number of nodules, the weight of nodules and the fresh weight on the ground;
FIG. 5 is the symbiotic nitrogen-fixing phenotype of the Rhizobium japonicum HH 103. delta. nopP mutant with Jidou 17;
FIG. 6 is a comparative measurement of the nitrogenase activity of soybean fast-growing rhizobium HH 103. delta. nopP nodule, the number of nodules, the weight of nodules and the fresh weight on the ground; wherein A is azotase activity, B is the number of nodules, C is the weight of the nodules, and D is the fresh weight on the ground;
FIG. 7 shows the symbiotic nitrogen-fixing phenotype of Rhizobium japonicum 7653R delta nopP mutant and Astragalus sinicus; wherein A is the overall growth condition comparative observation of the overground part of the astragalus sinicus, B is the growth condition comparative observation of the overground and underground parts of the astragalus sinicus individual plant, C is the nodule phenotype observation of inoculated wild rhizobium 7653R, and D is the nodule phenotype observation of inoculated delta nopP mutant;
FIG. 8 is a quantitative analysis of symbiotic nitrogen-fixing phenotype of Rhizobium astragalis 7653R delta nopP mutant and Astragalus sinicus; wherein A is the number of nodules, B is the fresh weight of the overground part, and C is the activity of the nodule nitrogenase;
FIG. 9 is the identification of the Rhizobium astragalii nopP deletion mutant.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to specific embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 Rhizobium japonicum SMH 12. delta. nopP mutant
A nopP gene deletion mutant was constructed by the creloxP system double crossover substitution method (FIG. 1). Using SMH12 total genomic DNA as a template, 692bp and 691bp homologous upper and lower arms were amplified respectively (FIG. 2A), the homologous upper arm was connected to the vector pCM351 via Kpn I and Nde I, and the homologous lower arm was connected to the vector pCM351 via Apa I and Age I. The constructed recombinant plasmid is introduced into soybean fast growing rhizobium SMH12, the exchange fragment on the recombinant plasmid and the upstream and downstream fragments of nopP in rhizobium genome are subjected to homologous recombination and integrated onto chromosome, and then the gene is replaced. PCR verification with primer Gm-F of vector pCM351 and screening primer nopP-MAP-R of the target gene corresponding to the enzyme cutting site showed that the amplification was 1625bp (FIG. 2B), and the fragment size was consistent with the expectation. Meanwhile, the wild-type SMH12 total DNA template is used as a negative control, and no band is amplified. Further, pCM158 was introduced into SMH12(Δ nopP:: Gm), and the deletion of Gm resulted in a complete deletion mutant Δ nopP, which was verified by PCR to indicate that the SMH12(Δ nopP) mutant was constructed correctly (FIG. 2C).
Example 2 symbiotic nitrogen fixation phenotype study
In order to identify the influence of the SMH12 (delta nopP) mutant on the symbiotic nitrogen fixation capacity, nopP overexpression OE-nopP and complementary CM-nopP were also constructed, and the symbiotic phenotype of each strain with Jidou 17 and Zhonghuang 13 was examined.
The results show that the overground parts of different strains inoculated with Jidou 17 and Zhonghuang 13 have different growth vigors, the growth vigor of Jidou 17 inoculated with the mutant is high, leaves are green, and the over-expression inoculated strain is weaker in growth vigor and yellows compared with a wild type. The phenotype of the plants inoculated with the complementing strain was intermediate between that of the wild type and that of the mutant, and was partly restored to the wild type phenotype (FIG. 3A). Similarly, both the mid-yellow 13 inoculated mutant and the aerial plants inoculated with the overexpression had higher growth vigor than the wild type and the leaves were green, and the phenotype of the plants inoculated with the complementing strain was intermediate between that of the wild type and the mutant, and was partially restored to the wild type phenotype (FIG. 3B).
Example 3 quantitative analysis of symbiotic nitrogen fixation phenotype
Further carrying out statistical analysis on plant root nodule azotase activity, the number of nodules, the weight of nodules and the fresh weight of overground parts, wherein the result shows that the azotase activity of the Jidou 17 inoculated mutant plant is 24.3 mu mol/g/h, the symbiotic azotase activity of the wild plant is 11.1 mu mol/g/h, the azotase activity of the mutant strain is obviously improved compared with that of the wild plant (P is less than 0.05), and the number of nodules is also obviously higher than that of the wild plant. The activity of the plant rhizobium enzyme inoculated with the over-expression strain, the number of the tumor, the tumor weight and the fresh weight average of the overground part are obviously lower than that of the wild type. The root nodule azotase activity of the mesohuang 13 plant inoculated with the mutant is obviously improved compared with that of a wild type, the root nodule azotase activity of the plant inoculated with the over-expression strain is 8.6 mu mol/g/h, the root nodule azotase activity of the wild type plant is 23.3 mu mol/g/h, and the over-expression azotase activity is obviously reduced compared with that of the wild type (p is less than 0.01). The number of tumors, tumor weight and fresh weight of overground parts of the inoculated mutant and the over-expression are not obviously different from the wild type.
In conclusion, the nopP mutation improves the symbiotic matching of rhizobium SMH12 with Jidou 17 and Zhonghuang 13, and the rhizobium azotase activity is improved to promote the growth and development of plants (figure 4).
Example 4 Rhizobium japonicum HH 103. delta. nopP mutant improves symbiotic nitrogen fixation ability of soybean 059 and Jidou 17
The soybean rhizobium HH103 Δ nopP mutant was constructed in the same manner as in example 1, and its symbiotic nitrogen-fixing phenotype was examined. The results show that the mutant HH103nopPmut inoculated to the 059 soybean line significantly increased fresh weight, number of nodules, fresh weight of nodules, and nitrogenase activity of nodules compared to the wild type HH103 inoculated plant (table 1). When the mutant rhizobium HH103(Δ nopP) was inoculated to Jidou 17, the soybean plants grew high above ground, had green leaves and developed underground roots, as compared to HH103, which is the wild-type strain (FIG. 5). The nitrogen-fixing enzyme activity, the root nodule quantity, the root nodule weight and the fresh weight of the overground part of the root nodule of the soybean plant inoculated with the mutant rhizobium are all obviously higher than that of a wild type plant (figure 6).
TABLE 1 measurement of symbiotic phenotype of soybean 059 inoculated with test strains
Example 5 Rhizobium astragalis 7653R delta nopP mutant for improving symbiotic nitrogen fixation capacity of Astragalus sinicus
The same method as in example 1 was used to construct the Rhizobium astragalii 7653R. delta. nopP mutant and examine the symbiotic nitrogen-fixing phenotype. The results showed that 30dpi symbiotic plants, compared to the plants inoculated with the wild type 7653R strain, showed vigorous growth of plants inoculated with the Rhizobium mutant, with pink nodules (FIG. 7). The number of nodules, fresh weight of aerial parts, and activity of nodule nitrogenase of plants inoculated with mutant rhizobia were all significantly increased (fig. 8). The gene shows that the mutant of the NopP gene of the rhizobium astragalii promotes the symbiotic nodulation and nitrogen fixation capacity with the astragalus sinicus. The thalli-like bodies in the nodules formed by inoculating the wild type rhizobia and the mutant rhizobia are separated, and the identification result shows that the inoculated astragalus rhizobia is a target gene nopP deletion mutant through the detection of corresponding PCR primers (figure 9).
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Sequence listing
<110> Huachuangjia agro-technology (Wuhan) Co Ltd
<120> mutant of rhizobium japonicum SMH12 and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggtaccatca tctggcaatc ggtt 24
<210> 2
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
catatgacga gctatcaatt cgacc 25
<210> 3
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gggcccgact tacgaagatg acttcatg 28
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
accggtcatc tacttatgag ctccagc 27
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
actccacttc caatcactcc g 21
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
atgttacgca gcagcaacg 19
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ttaggtggcg gtacttggg 19
Claims (5)
1. A mutant of Rhizobium japonicum SMH12, which is constructed by the following steps:
1) respectively amplifying nopP homologous exchange upper arms and lower arms by using genomic DNA of soybean fast rhizobium SMH12 as a template and using primers nopP-up-F/R and nopP-down-F/R; wherein:
nopP-up-F：ggtaccATCATCTGGCAATCGGTT；
nopP-up-R：catatgACGAGCTATCAATTCGACC；
nopP-down-F：gggcccGACTTACGAAGATGACTTCATG；
nopP-down-R：accggtCATCTACTTATGAGCTCCAGC；
2) connecting the product with the digested pCM351 vector in two steps after double enzyme digestion to obtain a plasmid pCM351: nopP-up-down;
3) the plasmid pCM351 shows that nopP-up-down is introduced into fast growing rhizobium japonicum SMH12 and transformed to obtain the mutant.
2. The mutant of Rhizobium japonicum SMH12 according to claim 1, wherein step (2) comprises digesting the homologous upper arm amplification product with KpnI and NdeI, connecting to vector pCM351 to obtain pCM351:: nopP-up, digesting the homologous lower arm amplification product with Apa I and Age I, connecting to pCM351:: nopP-up to obtain plasmid pCM351:: nopP-up-down.
3. The mutant of Rhizobium japonicum SMH12 as set forth in claim 1, wherein the crossover fragment on the recombinant plasmid in step (3) is homologously recombined with the upstream and downstream fragments of nopP in the Rhizobium genome, and integrated into the chromosome, thereby replacing the gene.
4. The mutant of rhizobium japonicum SMH12 according to claim 1, wherein the mutant is verified by PCR by screening transformants for nopP-MAP-R/Gm-F or nopP-MAP-F/Gm-R by primers; wherein:
nopP-Map-F：AGTCGGGACGCAATGGAT；
nopP-Map-R：ACTCCACTTCCAATCACTCCG；
Gm-F：ATGTTACGCAGCAGCAACG；
Gm-R：TTAGGTGGCGGTACTTGGG。
5. use of the mutant of Rhizobium japonicum SMH12 of claim 1 to increase nitrogen fixation in legume crops.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010171507.9A CN111286513B (en) | 2020-03-12 | 2020-03-12 | Mutant of rhizobium japonicum SMH12 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010171507.9A CN111286513B (en) | 2020-03-12 | 2020-03-12 | Mutant of rhizobium japonicum SMH12 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111286513A CN111286513A (en) | 2020-06-16 |
| CN111286513B true CN111286513B (en) | 2021-01-12 |
Family
ID=71020289
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010171507.9A Active CN111286513B (en) | 2020-03-12 | 2020-03-12 | Mutant of rhizobium japonicum SMH12 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111286513B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111826325A (en) * | 2020-08-05 | 2020-10-27 | 华创佳农生物科技(武汉)有限公司 | Application of multi-walled carbon nanotube in rhizobium inoculant and preparation method thereof |
| CN112501179B (en) * | 2020-11-12 | 2022-05-24 | 福建农林大学 | Method for regulating soybean nodulation and close planting by GmPIN1 gene mutation and application thereof |
| CN112626080B (en) * | 2020-12-23 | 2022-07-01 | 河南大学 | R gene for controlling soybean-rhizobium matching property, protein and application thereof |
| CN115161251B (en) * | 2022-05-18 | 2023-09-19 | 东北农业大学 | Polygene mutant of rhizobium HH103 and application thereof |
| CN114921393B (en) * | 2022-05-18 | 2023-08-11 | 东北农业大学 | Double-gene mutant of rhizobium and application thereof |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5432079A (en) * | 1988-03-11 | 1995-07-11 | Mycogen Plant Science, Inc. | Method for selecting mutants of legume-nodulating bacteria enhanced in competition |
| JP2007306852A (en) * | 2006-05-18 | 2007-11-29 | Kagoshima Univ | Mutant of leguminous plant having enhanced symbiotic nitrogen fixation ability of leguminous plant and rhizobium, its seed and method for producing the same |
| CN105647841A (en) * | 2014-09-04 | 2016-06-08 | 苏静 | Construction method and application of pseudomonas aeruginosa mutant strain |
| CN106977590B (en) * | 2017-04-19 | 2021-03-16 | 西安亚博生物技术有限公司 | Mutant bean rhizobium avidin protein and application thereof |
| CN107446873B (en) * | 2017-08-31 | 2021-02-19 | 中国科学院烟台海岸带研究所 | Rhizobium nodosum capable of promoting wheat growth and construction and application thereof |
| CN110452864B (en) * | 2019-08-08 | 2021-01-08 | 华创佳农生物科技(武汉)有限公司 | Method for improving nodulation competition capability of rhizobium USDA110 |
-
2020
- 2020-03-12 CN CN202010171507.9A patent/CN111286513B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111286513A (en) | 2020-06-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111286513B (en) | Mutant of rhizobium japonicum SMH12 and application thereof | |
| de Carvalho et al. | Sugarcane genetic controls involved in the association with beneficial endophytic nitrogen fixing bacteria | |
| CN110819635B (en) | Application of HAN homologous gene of leguminous plant in regulating and controlling number of root nodules of leguminous plant | |
| CN104498374A (en) | Verticillium dahlia delta VdKu70 defective mutant strain and application thereof | |
| CN111925974B (en) | Artificial combined nitrogen fixation system with ammonium bleeding and nitrogen high-affinity module coupling | |
| CN112195186A (en) | Application of SlBBX20 gene in regulation and control of tomato gray mold resistance | |
| CN110468150B (en) | Application of RGS1 gene as negative regulatory factor in improving tomato bacterial leaf spot resistance in low-irradiation environment | |
| CN113881799B (en) | Functional molecular marker for screening/detecting tobacco root black rot main effect resistance locus and application thereof | |
| CN113512558B (en) | Method for improving resistance of tomatoes to bacterial wilt | |
| CN116675750A (en) | Stem rot resistant protein, biological material, and cultivation method and application thereof | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers | |
| CN102367452B (en) | Method for cultivating disease-resistant PgPGIP1 transgenic wheat | |
| CN110452293A (en) | A kind of rice insect pest modulin and its encoding gene and application | |
| CN112063534B (en) | Hypsizigus marmoreus strain | |
| CN118452316B (en) | Application of high-protein alfalfa serving as soybean meal substitute in feed | |
| CN117126879B (en) | Application of tomato SlSUVH1 gene in regulation and control of plant virus resistance and transgenic plant cultivation method | |
| CN115896140B (en) | Beta-1,6-glucanase gene, detection primer and application | |
| Pule‐Meulenberg et al. | Nodule Functioning and Symbiotic Efficiency of Cowpea and Soybean Varieties in Africa | |
| CN118048389A (en) | Application of rice gene co-knockout in reducing cadmium accumulation of rice | |
| CN118085049A (en) | Rice regulatory grain type protein, coding gene and application thereof | |
| CN118389544A (en) | Rice gene OsCAD B and application thereof | |
| CN117467591A (en) | Sinorhizobium freundii with improved nodulation capability and construction method thereof | |
| CN118086242A (en) | Rice methyltransferase SET36 and application of coding gene thereof in disease-resistant breeding | |
| CN117467689A (en) | Method for promoting symbiotic nodulation of rhizobium sojae and soybean by gene insertion | |
| CN118598961A (en) | Application of Silg protein in regulating and controlling included angle of cereal cotyledon |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |