CN118085049A

CN118085049A - Rice regulatory grain type protein, coding gene and application thereof

Info

Publication number: CN118085049A
Application number: CN202410326988.4A
Authority: CN
Inventors: 周勇; 王寅雯; 梁国华; 李相伯; 缪军; 谭文琛; 龚志云
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2024-03-21
Filing date: 2024-03-21
Publication date: 2024-05-28

Abstract

The invention relates to the technical field of genetic engineering, in particular to rice regulation grain protein, a coding gene and application thereof, and compared with wild rice, the rice grain length is obviously increased, the rice grain width is obviously reduced, and the grain length-width ratio is obviously increased after OsWRKY28 is knocked out by using a CRISPR/Cas9 technology. The gene and the genetic engineering means provided by the invention have important roles in researching the regulation mechanism of rice grain types, and have great application value in rice breeding.

Description

Rice regulatory grain type protein, coding gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to rice regulatory grain type protein, and a coding gene and application thereof.

Background

Rice is one of the main grain crops in the world, and more than half of the world population takes rice as main food. China is used for planting rice and consuming China, and the yield of the rice is related to the grain safety of China. The rice yield is composed of the number of ears per plant, the number of grains per ear, thousand grain weight and other factors, and the grain type is an important determining factor of the grain weight of the rice. Grain type affects not only yield but also rice quality, especially appearance quality. Therefore, the important genetic information can be provided for increasing the yield of rice and improving the appearance quality of rice by excavating the gene for regulating and controlling the grain type and clarifying the molecular mechanism for regulating and controlling the grain type.

The grain type of the rice comprises grain length, grain width, grain thickness, aspect ratio and the like. Generally, large kernels increase the grain weight of rice, and less chalky elongated kernels can increase the appearance quality of rice. Many grain-related genes have been mined and identified for several years, such as GS3, GW2, GS9, GW5, GW8, etc. The main problem of grain breeding today is that few genes can be generated in elongated grain or large grain form by gene editing, and many genes are not directly applied to rice breeding. Therefore, more novel granulocyte genes are mined, the regulation and control network among different granulocyte genes is researched, the comprehensive understanding of the molecular mechanism of granulocyte regulation and control is facilitated, and new thought and genetic information are provided for granulocyte breeding.

WRKY transcription factors are a specific class of transcription factors in plants. In rice, WRKY transcription factors play an important role in regulating biotic and abiotic stress, morphogenesis of a nutrient organ, seed germination and the like, but researches on regulating rice grain types are still reported.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, provide rice regulation grain type protein, and a coding gene and application thereof, and specifically adopts a CRISPR/Cas9 method to knock out an OsWRKY28 gene, improve rice, increase the length-width ratio of grains and cultivate slender grain type rice.

The technical scheme for solving the technical problems is as follows:

An OsWRKY28 protein for regulating rice grain type, wherein the amino acid sequence of the rice OsWRKY28 protein is shown as SEQ ID NO. 2.

The invention also provides an OsWRKY28 gene for regulating rice grain type, the gene codes the OsWRKY28 protein for regulating rice grain type, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.

The invention also provides an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line of the gene.

The invention also provides application of the protein or the gene in regulation of rice grain types.

Further, the application includes: constructing an OsWRKY28 gene CRISPR/Cas9 knockout vector, and then transfecting rice callus by the knockout vector to obtain an OsWRKY28 mutant and a corresponding transgenic rice plant.

Further, the CRISPR/Cas9 knockout vector is pC1300-Ubi-Cas9-OsWRKY28.

Further, the construction of the pC1300-Ubi-Cas9-OsWRKY28 knockout vector and the acquisition of the OsWRKY28 mutant and the corresponding transgenic rice plant comprise the following steps:

S1, selecting a target site sequence for knocking out an OsWRKY28 gene; the target sequence is shown as SEQ ID NO. 3. The nucleotide sequence shown in SEQ ID NO.4 is used as the nucleotide sequence of the upstream primer, and the nucleotide sequence shown in SEQ ID NO.5 is used as the nucleotide sequence of the downstream primer.

S2, selecting SK-gRNA, and performing enzyme digestion on the SK-gRNA by using restriction enzyme Aar I to form a carrier with a sticky end; and (3) carrying out denaturation annealing on the upstream primer and the downstream primer in the step (S1) to form fragments with sticky ends, and connecting the carrier with the fragments to obtain an intermediate carrier.

S3, selecting pC1300-Ubi-Cas9, performing enzyme digestion by using restriction enzymes KpnI and BamHI, performing enzyme digestion on the intermediate vector obtained in the step S2 by using restriction enzymes KpnI and BglII, recovering about 550bp fragments, and connecting the obtained fragments with the digested pC1300-Ubi-Cas9 to obtain the pC1300-Ubi-Cas9-OsWRKY28 knockout vector

S4, transforming competent cells of agrobacterium tumefaciens GV3101 by using the pC1300-Ubi-Cas9-OsWRKY28 knockout vector obtained in the step S3, and transferring the competent cells into callus of rice to regenerate to obtain transgenic rice plants.

Further, the regulation of the rice grain type is to increase the length of rice grains, reduce the width and thickness of the rice grains and increase the aspect ratio of the grains.

Furthermore, the CRISPR/Cas9 technology is utilized to knock out the rice gene OsWRKY28, and the target OsWRKY28-gRNA knocked out is shown as SEQ ID NO. 3.

Further, the sequences of the amplification primers are shown as SEQ ID NO.4 and SEQ ID NO. 5.

Further, the sequences of the identification primers are shown as SEQ ID NO.6 and SEQ ID NO. 7.

The application comprises: selecting a proper target point, constructing a pC1300-Ubi-Cas9-OsWRKY28 knockout vector, then converting the recombinant plasmid vector into agrobacterium, obtaining an OsWRKY28 knockout mutant through agrobacterium-mediated rice callus transformation technology, and carrying out kernel shape investigation.

The method for preparing the rice gene OsWRKY28 knockout mutant comprises the following steps: the CRISPR/Cas9 technology is utilized to knock out the rice gene OsWRKY28, and the designed knocking-out target OsWRKY28-gRNA sequence is shown as SEQ ID NO. 3. The amplification primer used was the nucleotide sequence shown in SEQ ID NO.4 as the nucleotide sequence of the upstream primer and the nucleotide sequence shown in SEQ ID NO.5 as the nucleotide sequence of the downstream primer.

The invention also provides application of the pC1300-Ubi-Cas9-OsWRKY28 knockout vector in rice grain regulation.

The invention also provides a method for cultivating slender rice, which comprises the step of knocking out the rice OsWRKY28 gene for regulating and controlling the rice grain type in rice, wherein the obtained transgenic rice is slender compared with the target rice.

Further, the transgenic rice comprises a nucleotide sequence shown as SEQ ID NO.8, SEQ ID NO.9 or SEQ ID NO. 10.

Advantageous effects

The invention discloses a regulated rice grain type gene OsWRKY28 and application thereof, wherein after the OsWRKY28 is knocked out by using a CRISPR/Cas9 technology, compared with wild rice, the aspect ratio of rice grains of a knocked-out strain OsWRKY-1, osWRKY28-2 and OsWRKY-3 is obviously increased by 11.97%,12.22% and 21.10%, respectively, and slender grain type rice grains are produced. The gene and the genetic engineering means provided by the invention have important roles in researching the regulation mechanism of rice grain types, and have great application value in rice breeding.

Drawings

The invention relates to a rice grain type regulating gene OsWRKY28, application and beneficial effects thereof, which are described below with reference to the accompanying drawings and specific embodiments.

FIG. 1 is a schematic diagram of the mutation type and sequencing result of OsWRKY28 under the genetic background of Wu Zhuang japonica No. 8 provided by the embodiment of the invention;

FIG. 2 is a graph showing comparison of rice grain lengths of wild type (Wuyunjing No. 8) and mutant strains oswrky-1, oswrky-2, oswrky28-3

FIG. 3 is a graph showing a comparison of rice grain widths of wild type (Wuyunjing No. 8) and mutant lines oswrky-1, oswrky-2, oswrky28-3

FIG. 4 is a statistical comparison of rice grain types for wild type (Wu Zhuang No. 8) and mutant lines oswrky-1, oswrky-2, oswrky28-3, and a-d are statistical comparisons of grain length, grain width, grain thickness, and grain aspect ratio of wild type Wu Zhuang No. 8 and oswrky-1, oswrky28-2, oswrky28-3 mutants, respectively.

Detailed Description

Embodiments of the present invention will be described in detail with reference to examples. It should be understood that the examples described in this specification are for the purpose of illustrating the invention only and are not intended to limit the invention. All other embodiments, which can be made by one of ordinary skill in the art without undue burden on the person of ordinary skill in the art based on the embodiments of the present invention, are within the scope of the present invention.

Embodiment one: construction of OsWRKY28 Gene editing vector

Step 1, CRISPR/Cas9 target design

The optimization of editing targets was performed using CRISPR PRIMER DESIGNER online software package developed by Liu Yaoguang laboratories (http:// skl. Scau. Edu. Cn /), and a pair of target primers was designed. The sequence of the target OsWRKY28-gRNA is shown as SEQ ID NO. 3. The sequence of the upstream primer OsWRKY28-sg-F is shown as SEQ ID NO.4, and the sequence of the downstream primer OsWRKY28-sg-R is shown as SEQ ID NO.5, and the specific sequence is as follows:

OsWRKY28-gRNA：5’-GGCTCCGGCGGCGCCGATTAAGG-3’；

OsWRKY28-sg-F：5’-ggca GGCTCCGGCGGCGCCGATTAAGG-3’；

OsWRKY28-sg-R：5’-aaac CCTTAATCGGCGCCGCCGGAGCC-3’；

step 2, adding 10 mu l of each of the upstream and downstream primers with the concentration of 100 mu M into the mixture, uniformly mixing, denaturing at 100 ℃ for 5min, naturally cooling to room temperature, and completing annealing to form fragments with sticky ends.

Step 3, the intermediate vector SK-gRNA is digested with restriction enzyme AraI overnight at 37 ℃, and the system is shown in the following table:

And 4, connecting the annealed fragments to an intermediate vector SKm-gRNA after AarI enzyme digestion by using T4 ligase, and obtaining a connecting product OsWRKY28-SK-gRNA at 22 ℃ for 30 min. The system is shown in the following table:

SK-gRNA	1.5ul
		Fragments	7ul
T4 buffer	1ul
		T4 ligase	0.5ul

Step 5, the connection product is transformed into escherichia coli, and the specific process is as follows:

(1) Adding all the connection products in the step 4 into the DH5 alpha competence of the escherichia coli, flicking the bottom of the tube by using fingers, completely mixing the connection products with the DH5 alpha competence of the escherichia coli, and standing on ice for 5min;

(2) Heat shock is carried out at 42 ℃ for 45s, and the mixture is quickly transferred to ice for 2min;

(3) Adding 500 μl of LB liquid medium, and incubating at 37deg.C and 220rpm for 20min;

(4) The above E.coli was spread on solid LB medium containing 50. Mu.g/ml of ampicillin resistance and cultured overnight.

Step 6, obtaining positive clones, wherein the process is as follows:

The single clone on the LB medium is picked up and put into about 4ml of LB liquid medium (50 mug/ml of ampicillin), incubated for about 12 hours at 37 ℃ and 220rpm, and then plasmid extraction is carried out, and the plasmid extraction method is referenced by a Vazyme plasmid extraction kit. And sequencing by using a universal primer M13R or T7, and using the accurate OsWRKY28-SK-gRNA plasmid of the sequencing result after comparison for constructing a final vector.

Step 7, enzyme digestion of the intermediate carrier and the final carrier, wherein the process is as follows

The OsWRKY28-SK-gRNA is digested and purified by restriction enzymes KpnI and BglII, and the final vector pC1300-Ubi-Cas9 is digested and purified by restriction enzymes KpnI and BamHI, and the purification method is referred to as a purification kit body of Vazyme. The cleavage system is shown in the following table:

pC1300-Ubi-Cas9	5ul
		KpnI	0.5ul
BamHI	0.5ul
		10x green buffer	2ul
ddH₂O	12ul

Step 8, obtaining the final carrier

The purified fragment OsWRKY28-SK-gRNA and vector pC1300-Ubi-Cas9 are connected by using T4 ligase. The system is the same as above. E.coli competent DH5 alpha is transformed, positive clones are selected to extract plasmids, and then pC1300-Ubi-Cas9-OsWRKY28 knockout vector is obtained after sequencing detection.

Embodiment two: the agrobacterium EHA105 is transformed as follows:

(1) The EHA105 competence was taken out of the-80℃ultra-low temperature refrigerator and placed on ice for thawing.

(2) 0.5-2 Μg of pC1300-Ubi-Cas9-OsWRKY28 plasmid was added to 50ul of EHA105 competence. The transformation was performed in the order of 5min on ice, 5min in liquid nitrogen, 5min in a 37℃water bath, and 2min on ice.

(3) Mu.l of LB liquid medium without antibiotics was added and incubated for 3h at 28℃on a thermostated shaker at 220 rpm.

(7) The bacterial liquid after incubation was smeared on LB solid medium containing kanamycin (50. Mu.g/m l), and cultured in a constant temperature incubator at 28 ℃.

(8) After the colony grows out, selecting a monoclonal, carrying out colony PCR identification, and screening out positive clones.

(9) Positive clones were picked up into 5ml LB liquid medium with corresponding antibiotics and rifampicin added, cultured at 28℃and 220rpm for about 16-18h, and the bacterial solution was stored in a-80℃refrigerator with 50% glycerol at a volume ratio of 1:1.

Embodiment III: acquisition of OsWRKY28 mutant

The rice used in this example was the rice variety japonica rice, wuyunjing No. 8 (approval number: su's character review No. 314), purchased from the institute of agricultural science.

(1) The stored Agrobacterium was removed from the-80℃refrigerator and added to 5ml of LB medium containing kanamycin (50. Mu.g/ml) and rifampicin (50. Mu.g/ml) at a ratio of 1:100, and cultured overnight at 28℃at 220 rpm.

(2) The bacterial liquid after overnight culture was subjected to expansion culture with 50ml of a liquid medium containing kanamycin (50. Mu.g/ml) and rifampicin (50. Mu.g/ml) so that the OD value thereof was about 0.8 to 1.0.

(3) The martial transport japonica No. 8 callus with good growth state is added into the liquid culture medium after the expansion culture, and 50ul of AS (acetosyringone) with the concentration of 20 mug/ml is added for 45 minutes of infection.

(4) Drying the infected callus by using sterile paper, inoculating the callus on a co-culture medium, and culturing the callus in dark at 28 ℃ for 2-3 days.

(5) The calli on the medium were transferred to a screening medium containing 200. Mu.g/ml penicillin and 50. Mu.g/ml hygromycin. Transferring the strain to a sterile artificial climate culture room for culturing for about 15 days.

(6) Transferring the callus on the screening culture medium to a pre-differentiation culture medium, and culturing in a sterile culture room for about 7-10 days.

(7) The pre-differentiated cultured calli were transferred to differentiation medium. Culturing in a sterile culture room at 28deg.C for about 30 days to obtain T ₀ -generation transgenic seedling.

Embodiment four: identification of OsWRKY28 homozygous mutant plants

Step 1, extracting transgenic rice plant leaf DNA

(1) Cutting appropriate amount of rice leaves, and placing into a 2.0ml centrifuge tube together with steel balls. Cooling in liquid nitrogen for 5min, and grinding to powder with a tissue grinder.

(2) 500 Μl CTAB was added and the oven gas bath was done at 65deg.C for 60min with shaking every 15 min.

(3) Adding 500 μl of chloroform, mixing, standing at room temperature for 5min, centrifuging at room temperature for 8min at 12000 rpm.

(4) Transferring the supernatant to a new 1.5ml centrifuge tube, adding equal volume of pre-cooled isopropanol, mixing well, and placing in a refrigerator at-20 ℃ for 1h.

(5) 12000Rpm, and centrifuging at room temperature for 10min.

(6) The supernatant was discarded, washed twice with 70% ethanol, and dried in a ventilated place.

(7) The dried product was dissolved in 100. Mu.l of deionized water for identification.

Step 2, sequence detection of target sequence of transgenic plant

The DNA of the transgenic rice plant is used as a template, amplification is carried out by using identification primers oswrky-F and oswrky-R according to the specification of 2 XTaq Master Mix (P112-03-AA) of Vazyme company, and the PCR product is sent to the department of Prinsepia for sequencing. The corresponding sequences of the primers oswrky-F and oswrky-R are shown as SEQ ID NO.6 and SEQ ID NO.7 respectively, and the specific sequences are as follows:

oswrky28-F:5’-GAGCCAGTCAGTCCCCTCT-3’；

oswrky28-R:5'-CGAAGCATCTCGGTCAGC-3’。

Through sequence alignment screening, 3 homozygous mutants oswrky-1, oswrky28-2 and oswrky-3 were obtained. The sequence nucleotide is shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, and 1A base, GA base and GCGCCGATTA base are deleted at the target point respectively.

Fifth embodiment: identification of OsWRKY28 homozygous mutant grantype

Mature kernels of rice oswrky-1, oswrky28-2 and oswrky-3 mutants and wild type (Wu Yun japonica 8) as control materials were harvested and the kernel shapes of the wild type and the three mutants were aligned, respectively. FIG. 2 is a grain length comparison of wild type and mutant, and FIG. 3 is a grain width comparison of wild type and mutant. Fig. 4a shows the grain length statistics of the wild type and the mutant, fig. 4b shows the grain width statistics of the wild type and the mutant, and fig. 4c shows the grain thickness statistics of the wild type and the mutant. FIG. 4d is a grain aspect ratio statistic for wild type and mutant. The results show that: compared with wild type, the grain length of the materials with the functions of oswrky-1, oswrky28-2 and oswrky-3 is obviously improved by 2.77 percent, 6.07 percent and 1.95 percent, the grain width is obviously reduced by 8.20 percent, 5.47 percent and 15.76 percent, the grain thickness is obviously reduced by 5.47 percent, 6.51 percent and 11.49 percent, the length-width ratio is obviously increased by 11.97 percent, 12.22 percent and 21.10 percent, and the grain is slender.

The invention obtains three homozygous mutants OsWRKY-1, oswry28-2 and OsWRKY-3 by editing the OsWRKY28 gene of rice in the Wuzhuang japonica No. 8 rice variety. The grain length, grain width, grain thickness and length-width ratio of the wild type and the mutant are examined, and the result shows that the grain length and length-width ratio of the obtained mutant are increased, the grain width and grain thickness are reduced, and the OsWRKY28 gene is proved to be involved in regulating and controlling the rice grain type, namely the OsWRKY28 gene is a rice grain type related gene, and provides excellent genetic germplasm resources for breeding of the rice grain type.

The foregoing is merely illustrative of the technical solution of the present invention and is not intended to limit the scope of the present invention, and it should be noted that it will be apparent to those skilled in the art that modifications and variations can be made without departing from the spirit and scope of the technical solution of the present invention.

SEQ ID NO.1

ATGGCTAAGATGCTTCCTCCTCCGAGCCAGTCAGTCCCCTCTCGCCCACCTTCTTGGCTATATATTCCTCCTCGTCGTCGCCATGGCACCTTCACTAGCTCATGCGCATTTCGGCTCTCGCCTTCTTCGCCTTCTTCTCCTCCTCCTCCTGTTCTTGATTTTCAGTATATTCAATTCATGGATTCGTGGATTGAGCAGACTTCCCTGAGCTTGGACCTCAACGTCGGCCTGCCGTCGACGGCGAGGAGATCATCGGCTCCGGCGGCGCCGATTAAGGTTCTCGTGGAGGAGAACTTCTTGTCCTTCAAGAAGGATCACGAGGTGCGTGGAGAGATTGACAGCTGCGACGACATCGATGAGAATTTGATTGGGAATATTGAAAAAAAGTTTGATTAATTAGTTGTTCGATCTTGTGTCCATCGATCCAGGTTGAGGCGCTGGAGGCGGAGCTCCGGCGAGCGAGCGAGGAGAACAAGAAGCTGACCGAGATGCTTCGGGCGGTGGTGGCCAAGTACACCGAGCTGCAGGGACAGGTCAACGACATGATGTCGGCGGCGGCGGCGGCGGCGGTCAACGCCGGGAACCACCAGTCGTCGACGTCGGAGGGCGGCTCGGTGTCGCCATCGAGGAAGCGGATCCGTAGCGTCGACAGCCTCGACGACGCCGCCCACCACCGCAAGCCATCCCCTCCGTTCGTCGCCGCCGCCGCAGCCGCGGCCTACGCCTCCCCCGACCAGATGGAGTGCACGTCGGCGGCCGCCGCCGCCGCCGCGAAGCGCGTCGTCCGCGAGGACTGCAAGCCCAAGGTCTCCAAGCGCTTCGTCCACGCCGACCCCTCCGACCTCAGCCTCGTAAGCAACGAAACAATTAGATTAATCCATTGATGAGGTCTCCTCGTAATTAACCAACAATTGGTTTTGTAAAACCTTCAGGTGGTGAAGGATGGGTATCAATGGCGGAAGTACGGGCAGAAGGTGACGAAGGACAACCCGTGCCCGCGAGCCTACTTCAGGTGCTCGTTCGCGCCGGCGTGCCCGGTGAAGAAGAAGGTGCAGCGCAGCGCCGACGACAACACCGTCCTCGTCGCCACGTACGAGGGCGAGCACAACCACGCCCAGCCGCCGCACCACGACGCCGGCAGCAAGACCGCCGCCGCCGCCAAGCACTCACAGCACCAGCCGCCACCGAGCGCCGCCGCCGCCGTCGTCCGGCAGCAGCAAGAGCAGGCGGCGGCGGCCGGGCCGTCGACGGAGGTGGCGGCGAGGAAGAACCTGGCCGAGCAGATGGCGGCGACGCTGACGAGGGACCCCGGGTTCAAGGCGGCGCTCGTCACGGCGCTCTCCGGCCGGATCCTCGAGCTCTCGCCGACCAAGAACTGATCCATCGTTAGAACGCCGATGAACTTTGCTCGATTTAGCTGAGATCGATCGATCAATTTACACGGTAAAATTTTAGAGTTGATCGATTTGCATGGCTTTGATCGGAGTTAGGCTAGAGAGAGAGAGGATTAACTGTGTATATTTAGTGATTGATTTTAATTAGCTCGCTCTACACGTGCCAAGGTGGCAGTTTAAGCAAAACGTACGATAATTCGTTGCAATTTGTAATTCAGCTAGAAGATTAGTGTATTCATGGAGATCTATTCAGAGTCTCCCAGATATATATATAGAGAGAGAGATAGTAGCATTGATGTTATCGCATGTTGTTGCGATTGAACGAAAAATTAAGAAGCTAGCACATGCAAATACTTAAATTGGAAGAGGAGACTCTAGATATGAATG

SEQ ID NO.2

MSDQPPPYTPLPLLSSFPPNPYPDQTPDPASTPTLVLPNPAFPNKRKRTGFRRKLPSGSPAAPVAVAASPSAQPPPRASAADDIIVINREPTAEAVTALTAGFPADSLTDEEIEAGVVSDVGGIEQVNYILIRNHLLTRWRETFNSWLAKESFATLIPPHCDHLLNAAYSFLVSHGHINFGVAPAIKERIPKEPTRHNTVIVVGAGLAGLAAARQLVAFGFKVVVLEGRKRCGGRVYTKKMEGGGRSAAGDLGGSVLTGTFGNPLGIVAKQLGLPMHKIRDKCPLYRPDGSPVDPEVDKKVEGTFNKLLDKSSLLRASMGDVAMDVSLGAALETLRQTDGDLSTDQEMNLFNWHLANLEYANAGLLSKLSLAFWDQDDPYDMGGDHCFLPGGNGRLVQALAENVPIVYERTVHTIRYGGDGVQVVVNGGQVYEGDMALCTVPLGVLKNGGVKFVPELPQRKLDSIKRLGFGLLNKVAMLFPHVFWSTDLDTFGHLTEDPSHRGEFFLFYSYATVAGGPLLMALVAGEAAHNFETTPPTDAVSSVLKILRGIYEPQGIEVPDPLQSVCTRWGTDSFSLGSYSHVAVGASGDDYDILAESVGDGRLFFAGEATTRRYPATMHGAFISGLREAANITLHANARAAKSKVEKGPSTNTQACAALLMDLFRQPDLEFGSFSVIFGGQASDPKSPAILKVELGGPRKKGATEGGKADQHHSNKLLFQQLQSHFNQQQQLYVYTLLSRQQAMELREVRGGDEMRLHYLCEKLGVKLVGRKGLGPGADAVIASIKAERNSSRTKTRPSKLKIGIPKSKS*

SEQ ID NO.3

GGCTCCGGCGGCGCCGATTAAGG

SEQ ID NO.4

ggcaGGCTCCGGCGGCGCCGATTAAGG

SEQ ID NO.5

aaacCCTTAATCGGCGCCGCCGGAGCC

SEQ ID NO.6

GAGCCAGTCAGTCCCCTCT

SEQ ID NO.7

CGAAGCATCTCGGTCAGC

SEQ ID NO.8

ATGGCTAAGATGCTTCCTCCTCCGAGCCAGTCAGTCCCCTCTCGCCCACCTTCTTGGCTATATATTCCTCCTCGTCGTCGCCATGGCACCTTCACTAGCTCATGCGCATTTCGGCTCTCGCCTTCTTCGCCTTCTTCTCCTCCTCCTCCTGTTCTTGATTTTCAGTATATTCAATTCATGGATTCGTGGATTGAGCAGACTTCCCTGAGCTTGGACCTCAACGTCGGCCTGCCGTCGACGGCGAGGAGATCATCGGCTCCGGCGGCGCCGTTAAGGTTCTCGTGGAGGAGAACTTCTTGTCCTTCAAGAAGGATCACGAGGTGCGTGGAGAGATTGACAGCTGCGACGACATCGATGAGAATTTGATTGGGAATATTGAAAAAAAGTTTGATTAATTAGTTGTTCGATCTTGTGTCCATCGATCCAGGTTGAGGCGCTGGAGGCGGAGCTCCGGCGAGCGAGCGAGGAGAACAAGAAGCTGACCGAGATGCTTCGGGCGGTGGTGGCCAAGTACACCGAGCTGCAGGGACAGGTCAACGACATGATGTCGGCGGCGGCGGCGGCGGCGGTCAACGCCGGGAACCACCAGTCGTCGACGTCGGAGGGCGGCTCGGTGTCGCCATCGAGGAAGCGGATCCGTAGCGTCGACAGCCTCGACGACGCCGCCCACCACCGCAAGCCATCCCCTCCGTTCGTCGCCGCCGCCGCAGCCGCGGCCTACGCCTCCCCCGACCAGATGGAGTGCACGTCGGCGGCCGCCGCCGCCGCCGCGAAGCGCGTCGTCCGCGAGGACTGCAAGCCCAAGGTCTCCAAGCGCTTCGTCCACGCCGACCCCTCCGACCTCAGCCTCGTAAGCAACGAAACAATTAGATTAATCCATTGATGAGGTCTCCTCGTAATTAACCAACAATTGGTTTTGTAAAACCTTCAGGTGGTGAAGGATGGGTATCAATGGCGGAAGTACGGGCAGAAGGTGACGAAGGACAACCCGTGCCCGCGAGCCTACTTCAGGTGCTCGTTCGCGCCGGCGTGCCCGGTGAAGAAGAAGGTGCAGCGCAGCGCCGACGACAACACCGTCCTCGTCGCCACGTACGAGGGCGAGCACAACCACGCCCAGCCGCCGCACCACGACGCCGGCAGCAAGACCGCCGCCGCCGCCAAGCACTCACAGCACCAGCCGCCACCGAGCGCCGCCGCCGCCGTCGTCCGGCAGCAGCAAGAGCAGGCGGCGGCGGCCGGGCCGTCGACGGAGGTGGCGGCGAGGAAGAACCTGGCCGAGCAGATGGCGGCGACGCTGACGAGGGACCCCGGGTTCAAGGCGGCGCTCGTCACGGCGCTCTCCGGCCGGATCCTCGAGCTCTCGCCGACCAAGAACTGATCCATCGTTAGAACGCCGATGAACTTTGCTCGATTTAGCTGAGATCGATCGATCAATTTACACGGTAAAATTTTAGAGTTGATCGATTTGCATGGCTTTGATCGGAGTTAGGCTAGAGAGAGAGAGGATTAACTGTGTATATTTAGTGATTGATTTTAATTAGCTCGCTCTACACGTGCCAAGGTGGCAGTTTAAGCAAAACGTACGATAATTCGTTGCAATTTGTAATTCAGCTAGAAGATTAGTGTATTCATGGAGATCTATTCAGAGTCTCCCAGATATATATATAGAGAGAGAGATAGTAGCATTGATGTTATCGCATGTTGTTGCGATTGAACGAAAAATTAAGAAGCTAGCACATGCAAATACTTAAATTGGAAGAGGAGACTCTAGATATGAATG

SEQ ID NO.9

ATGGCTAAGATGCTTCCTCCTCCGAGCCAGTCAGTCCCCTCTCGCCCACCTTCTTGGCTATATATTCCTCCTCGTCGTCGCCATGGCACCTTCACTAGCTCATGCGCATTTCGGCTCTCGCCTTCTTCGCCTTCTTCTCCTCCTCCTCCTGTTCTTGATTTTCAGTATATTCAATTCATGGATTCGTGGATTGAGCAGACTTCCCTGAGCTTGGACCTCAACGTCGGCCTGCCGTCGACGGCGAGGAGATCATCGGCTCCGGCGGCGCCTTAAGGTTCTCGTGGAGGAGAACTTCTTGTCCTTCAAGAAGGATCACGAGGTGCGTGGAGAGATTGACAGCTGCGACGACATCGATGAGAATTTGATTGGGAATATTGAAAAAAAGTTTGATTAATTAGTTGTTCGATCTTGTGTCCATCGATCCAGGTTGAGGCGCTGGAGGCGGAGCTCCGGCGAGCGAGCGAGGAGAACAAGAAGCTGACCGAGATGCTTCGGGCGGTGGTGGCCAAGTACACCGAGCTGCAGGGACAGGTCAACGACATGATGTCGGCGGCGGCGGCGGCGGCGGTCAACGCCGGGAACCACCAGTCGTCGACGTCGGAGGGCGGCTCGGTGTCGCCATCGAGGAAGCGGATCCGTAGCGTCGACAGCCTCGACGACGCCGCCCACCACCGCAAGCCATCCCCTCCGTTCGTCGCCGCCGCCGCAGCCGCGGCCTACGCCTCCCCCGACCAGATGGAGTGCACGTCGGCGGCCGCCGCCGCCGCCGCGAAGCGCGTCGTCCGCGAGGACTGCAAGCCCAAGGTCTCCAAGCGCTTCGTCCACGCCGACCCCTCCGACCTCAGCCTCGTAAGCAACGAAACAATTAGATTAATCCATTGATGAGGTCTCCTCGTAATTAACCAACAATTGGTTTTGTAAAACCTTCAGGTGGTGAAGGATGGGTATCAATGGCGGAAGTACGGGCAGAAGGTGACGAAGGACAACCCGTGCCCGCGAGCCTACTTCAGGTGCTCGTTCGCGCCGGCGTGCCCGGTGAAGAAGAAGGTGCAGCGCAGCGCCGACGACAACACCGTCCTCGTCGCCACGTACGAGGGCGAGCACAACCACGCCCAGCCGCCGCACCACGACGCCGGCAGCAAGACCGCCGCCGCCGCCAAGCACTCACAGCACCAGCCGCCACCGAGCGCCGCCGCCGCCGTCGTCCGGCAGCAGCAAGAGCAGGCGGCGGCGGCCGGGCCGTCGACGGAGGTGGCGGCGAGGAAGAACCTGGCCGAGCAGATGGCGGCGACGCTGACGAGGGACCCCGGGTTCAAGGCGGCGCTCGTCACGGCGCTCTCCGGCCGGATCCTCGAGCTCTCGCCGACCAAGAACTGATCCATCGTTAGAACGCCGATGAACTTTGCTCGATTTAGCTGAGATCGATCGATCAATTTACACGGTAAAATTTTAGAGTTGATCGATTTGCATGGCTTTGATCGGAGTTAGGCTAGAGAGAGAGAGGATTAACTGTGTATATTTAGTGATTGATTTTAATTAGCTCGCTCTACACGTGCCAAGGTGGCAGTTTAAGCAAAACGTACGATAATTCGTTGCAATTTGTAATTCAGCTAGAAGATTAGTGTATTCATGGAGATCTATTCAGAGTCTCCCAGATATATATATAGAGAGAGAGATAGTAGCATTGATGTTATCGCATGTTGTTGCGATTGAACGAAAAATTAAGAAGCTAGCACATGCAAATACTTAAATTGGAAGAGGAGACTCTAGATATGAATG

SEQ ID NO.10

ATGGCTAAGATGCTTCCTCCTCCGAGCCAGTCAGTCCCCTCTCGCCCACCTTCTTGGCTATATATTCCTCCTCGTCGTCGCCATGGCACCTTCACTAGCTCATGCGCATTTCGGCTCTCGCCTTCTTCGCCTTCTTCTCCTCCTCCTCCTGTTCTTGATTTTCAGTATATTCAATTCATGGATTCGTGGATTGAGCAGACTTCCCTGAGCTTGGACCTCAACGTCGGCCTGCCGTCGACGGCGAGGAGATCATCGGCTCCGGCGAGGTTCTCGTGGAGGAGAACTTCTTGTCCTTCAAGAAGGATCACGAGGTGCGTGGAGAGATTGACAGCTGCGACGACATCGATGAGAATTTGATTGGGAATATTGAAAAAAAGTTTGATTAATTAGTTGTTCGATCTTGTGTCCATCGATCCAGGTTGAGGCGCTGGAGGCGGAGCTCCGGCGAGCGAGCGAGGAGAACAAGAAGCTGACCGAGATGCTTCGGGCGGTGGTGGCCAAGTACACCGAGCTGCAGGGACAGGTCAACGACATGATGTCGGCGGCGGCGGCGGCGGCGGTCAACGCCGGGAACCACCAGTCGTCGACGTCGGAGGGCGGCTCGGTGTCGCCATCGAGGAAGCGGATCCGTAGCGTCGACAGCCTCGACGACGCCGCCCACCACCGCAAGCCATCCCCTCCGTTCGTCGCCGCCGCCGCAGCCGCGGCCTACGCCTCCCCCGACCAGATGGAGTGCACGTCGGCGGCCGCCGCCGCCGCCGCGAAGCGCGTCGTCCGCGAGGACTGCAAGCCCAAGGTCTCCAAGCGCTTCGTCCACGCCGACCCCTCCGACCTCAGCCTCGTAAGCAACGAAACAATTAGATTAATCCATTGATGAGGTCTCCTCGTAATTAACCAACAATTGGTTTTGTAAAACCTTCAGGTGGTGAAGGATGGGTATCAATGGCGGAAGTACGGGCAGAAGGTGACGAAGGACAACCCGTGCCCGCGAGCCTACTTCAGGTGCTCGTTCGCGCCGGCGTGCCCGGTGAAGAAGAAGGTGCAGCGCAGCGCCGACGACAACACCGTCCTCGTCGCCACGTACGAGGGCGAGCACAACCACGCCCAGCCGCCGCACCACGACGCCGGCAGCAAGACCGCCGCCGCCGCCAAGCACTCACAGCACCAGCCGCCACCGAGCGCCGCCGCCGCCGTCGTCCGGCAGCAGCAAGAGCAGGCGGCGGCGGCCGGGCCGTCGACGGAGGTGGCGGCGAGGAAGAACCTGGCCGAGCAGATGGCGGCGACGCTGACGAGGGACCCCGGGTTCAAGGCGGCGCTCGTCACGGCGCTCTCCGGCCGGATCCTCGAGCTCTCGCCGACCAAGAACTGATCCATCGTTAGAACGCCGATGAACTTTGCTC

GATTTAGCTGAGATCGATCGATCAATTTACACGGTAAAATTTTAGAGTTGAT

CGATTTGCATGGCTTTGATCGGAGTTAGGCTAGAGAGAGAGAGGATTAACT

GTGTATATTTAGTGATTGATTTTAATTAGCTCGCTCTACACGTGCCAAGGTG

GCAGTTTAAGCAAAACGTACGATAATTCGTTGCAATTTGTAATTCAGCTAG

AAGATTAGTGTATTCATGGAGATCTATTCAGAGTCTCCCAGATATATATATAG

AGAGAGAGATAGTAGCATTGATGTTATCGCATGTTGTTGCGATTGAACGAA

AAATTAAGAAGCTAGCACATGCAAATACTTAAATTGGAAGAGGAGACTCTA

GATATGAATG。

Claims

1. The OsWRKY28 protein for regulating rice grain type is characterized in that the amino acid sequence of the rice OsWRKY28 protein is shown as SEQ ID NO. 2.

2. The OsWRKY28 gene for regulating rice grain type is characterized in that the gene codes the OsWRKY28 protein for regulating rice grain type according to claim 1, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.

3. An expression cassette, recombinant vector, recombinant microorganism or transgenic cell line comprising the gene of claim 2.

4. Use of the protein of claim 1 or the gene of claim 2 for regulating rice grain type.

5. The use according to claim 4, wherein the regulation of rice grain type is increasing rice grain length, decreasing rice grain width and thickness, and increasing grain aspect ratio.

6. The application of claim 4, wherein the rice gene OsWRKY28 is knocked out by using CRISPR/Cas9 technology, and the knocked-out target OsWRKY28-gRNA sequence is shown as SEQ ID NO. 3.

7. The method according to claim 6, wherein the amplification primers have the sequences shown in SEQ ID NO.4 and SEQ ID NO. 5.

8. The use according to claim 6, wherein the identification primer sequences are shown in SEQ ID NO.6 and SEQ ID NO. 7.

9. A method for cultivating slender rice, characterized in that the rice OsWRKY28 gene for regulating and controlling rice grain type of claim 2 is knocked out in rice, and the obtained transgenic rice has slender rice grain type compared with the target rice.

10. A method of growing long and slender rice according to claim 9, characterized in that the transgenic rice comprises the nucleotide sequence shown as SEQ ID No.8, SEQ ID No.9 or SEQ ID No. 10.