CN111269934A - Method for improving phosphorus utilization rate of wheat by using gene editing - Google Patents

Abstract

The invention discloses a method for improving the phosphorus utilization rate of wheat by using gene editing. According to the invention, through the design of the specific guide single-chain sgRNA, an expression vector capable of realizing in vivo editing of LPR2 gene is constructed, and the LPR2 gene of wheat can be knocked out, so that silencing of LPR2 gene at genome level is realized, the phosphorus utilization rate of wheat is improved, and transgenic wheat is cultivated.

Description

Method for improving phosphorus utilization rate of wheat by using gene editing

Technical Field

The invention relates to a method for improving the phosphorus utilization rate of wheat by using gene editing, and relates to the field of gene editing.

Background

Phosphorus is one of the major elements necessary for plant growth and development. It is a main component of nucleic acid, nucleoprotein, phospholipid, adenosine triphosphate, etc. of plants, and also plays an important role in energy metabolism, photosynthesis, respiration, regulation of enzyme activity, redox reaction, signal transduction, carbon metabolism, etc. The lack of phosphorus can affect the formation of nucleoprotein, inhibit cell division and proliferation, reduce protein synthesis, block the transportation of sugar, finally cause the branch of the plant to be less, the stem and the root to be slender, the plant to be short and small, the flower and fruit to be easy to fall off and reduce the yield, etc. The growth and output capacity of plants are obviously dependent on the effectiveness of inorganic phosphorus (Pi), but the content of effective phosphorus in most soil is very low and is only 1-10 mu mol/L. Although the organic phosphorus in the soil can reach 80 percent, the organic phosphorus cannot be absorbed by plants, and the organic phosphorus must be converted into inorganic phosphorus before being absorbed and utilized (Schachtman et al, 1998; Holford, 1997). In agricultural production, phosphate fertilizer is commonly added to ensure normal growth and development of crops, and the global easy-to-harvest phosphate rock resource faces a crisis that has been eliminated in this century (Gilbert, 2009; Vance et al, 2003).

Wheat is an important food crop in China, and how to cultivate a low-fertilizer high-yield environment-friendly wheat variety is a great challenge for wheat breeders. Plants have developed mechanisms to cope with the severe deficiency of available phosphorus in the agricultural natural ecosystem over a long period of evolution. Therefore, the gene for fully exploiting the phosphorus with high efficiency in the wheat has important guiding significance for improving the molecular breeding with low phosphorus, high efficiency, environmental friendliness and sustainable yield increase.

Under Low phosphorus stress, the growth of the main Root of arabidopsis thaliana is inhibited, and in an arabidopsis thaliana mutant with LPR1(Low phosphorate Root1) losing function, the growth of the main Root is normal. LPR1 encodes multicopper oxidases (multicopper oxidases) and controls the growth of the main roots by regulating the expression levels of scr (scarecrow) and SHR (Short-root), which slow down growth and increase the number and length of lateral roots under low phosphorus stress (svistonoff et al, 2007). Homologous genes of these genes can be found in rice, maize, wheat, sword bean and white lupin, suggesting that root architecture changes in plants that respond to low phosphorus stress may have similar regulatory pathways.

Disclosure of Invention

The invention overcomes the defects of the prior art and provides a method for improving the phosphorus utilization rate of wheat by using gene editing. The method constructs an expression vector pBUE411-LPR2 with the function of knocking out LPR2 gene, and reduces the expression level of LPR2 gene through gene transformation process.

A method for improving phosphorus utilization rate of wheat by using gene editing comprises the following steps: the function of the wheat LPR2 gene is reduced or lost, and the expression and/or activity of the protein coded by the wheat LPR2 gene is inhibited, so that the phosphorus utilization rate of the wheat is improved.

Furthermore, the method for reducing or losing the function of the wheat LPR2 gene in the method is to construct a pBUE411-LPR2 binary vector with the function of knocking out LPR2 gene.

The pBUE411-LPR2 binary vector with the function of knocking out LPR2 gene comprises an expression cassette A and an expression cassette B; the expression cassette A specifically comprises the following elements from upstream to downstream in sequence: the TaU3 promoter A from wheat, the sgRNA of the LPR2 gene and the terminator A; the expression cassette B specifically comprises the following elements from upstream to downstream in sequence: the promoter B, the maize Cas9 coding sequence, the terminator B.

Further, the sgRNA sequence of the LPR2 gene is shown as a sequence SEQ 10; the maize Cas9 coding sequence is shown in SEQ 13; the sequence of the promoter A is shown as SEQ 3; the promoter B sequence is shown as SEQ 4; the terminator A sequence is shown as SEQ 5; the terminator B sequence is shown as SEQ 6.

Further, the sequence of the expression cassette A is specifically shown as SEQ 7; the sequence of the expression cassette B is specifically shown as SEQ 8; the expression cassette A is located at the upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.

Further, the pBUE411-LPR2 binary vector also contains a resistance marker gene, such as a bar gene; the nucleotide sequence of the pBUE411-LPR2 binary vector is shown in SEQ 9.

Further, the construction method of the pBUE411-LPR2 binary vector comprises the following steps:

s11 designs sgRNA targeting LPR2 gene, the oligonucleotides of sgRNA are corresponding to LPR2-gR1-TaU3-F and LPR2-gR1-TaU3-R, namely the sequence of LPR2-gR1-TaU3-F is shown in SEQ1, and the sequence of LPR2-gR1-TaU3-R is shown in SEQ 2;

s12 phosphorylates and anneals 2 oligos of the synthesized sgRNA to form double chains;

s13, utilizing restriction enzyme BsaI to cut the pBUE411 vector, and recovering vector fragments containing the promoter A, the terminator A, the promoter B and the terminator B;

s14 the recovered pBUE411 carrier fragment and double-stranded sgRNA with sticky ends are connected by T4 ligase to obtain the final pBUE411-LPR2 binary carrier.

The transformant containing the pBUE411-LPR2 binary vector also belongs to the protection scope of the invention.

The pBUE411-LPR2 binary vector is applied to improving the utilization rate of wheat phosphorus.

The pBUE411-LPR2 binary vector is applied to cultivation of transgenic wheat; compared with the wheat before transgenosis, the phosphorus utilization rate of the transgenic wheat is improved.

The invention also protects the following DNA fragment I:

the DNA fragment I consists of guide sgRNA of LPR2 gene, and the sequence of the DNA fragment I can be specifically shown as sequence SEQ 10.

Has the advantages that:

according to the invention, through the design of the specific guide single-chain sgRNA, an expression vector capable of realizing in-vivo editing of LPR2 gene is constructed, and the wheat LPR2 gene can be knocked out. The LPR2 gene is located on 4A, 4B and 4D of chromosome IV in wheat and is named TaLPR2-4A, TaLPR2-4B and TaLPR2-4D respectively. The genome sequence is 1972, 1957 and 1940 bases in the whole length of 4A, 4B and 4D, and the three homologous genes are composed of 3 exons and 2 introns. TaLPR2-4A, TaLPR2-4B and TaLPR2-4D contain 1761, 1761 and 1746 base open reading frames, respectively, encoding a segment of polypeptide chain containing 587, 587 and 582 amino acid residues, respectively. Based on this genetic information, we cloned the TalPR2-4A gene in Fielder using homologous cloning and submitted it to NCBI under GenBank accession number MK 676068. The similarity of the coding regions among the three homologous genes is very high, and the characteristic provides a theoretical basis for synchronously silencing the TaLPR2 gene of the three sites by using a gene editing technology.

In practical application, the gene conversion process can realize the silencing of LPR2 gene at genome level, and is a powerful tool for improving the utilization rate of phosphorus in wheat by using genetic engineering technology.

Drawings

FIG. 1 the coding region of the LPR2 gene.

FIG. 2 restriction electrophoresis of the vector BsaI pBUE 411.

FIG. 3 shows the sequencing result of the CRISPR/Cas9 recombinant vector pBUE411-LPR2 targeting LPR2 gene.

FIG. 4Bar test strip test transgenic wheat plants.

FIG. 5 deduced amino acid sequence of wild type wheat LPR2 gene.

FIG. 6 deduced amino acid sequence of mutant wheat LPR2 gene.

FIG. 7 alignment chart of CDS sequences of LPR2 gene of wild type and mutant type.

FIG. 8 alignment of deduced amino acid sequences of wild-type and mutant LPR2 genes.

Detailed Description

The experimental procedures used in the following examples, unless otherwise specified, were all purchased from conventional biochemical stores, the quantitative tests in the following examples, were set up in triplicate, the results were averaged, the high fidelity enzyme required for PCR amplification, the T4 ligase required for DNA fragment ligation, the gel recovery kit required for enzyme fragment recovery, and the plasmid extraction kit were purchased from Dalianbao Bio Inc., the plasmid extraction kit was purchased from Tiangen, the inorganic salts required for medium formulation were purchased from the national drug group, the vitamins and antibiotics, and hormones were purchased from Sigma, the plant CRISPR/Cas9 gene editing vector is pBUE411, contains the wheat U3 promoter TaU3 to initiate sgRNA, the Cas9p simulates the gramineous plant gene as having a high GC content at the 5' end, which is a codon optimized for the plant designed and synthesized, and the strain E.coli 5 α.

Reagents such as T4 ligase and DNA Marker DL2000 are purchased from Takara, Fastpfu, 2 Taq Mix, DH5 α are purchased from Beijing Quanjin, restriction enzyme BsaI-HF is purchased from NEB, and the used primers are synthesized by Qingdao Kagaku Xixi Biotechnology Limited and have the following sequences:

TABLE 1 primers used in this study

The wheat variety Jw1 is a new germplasm with good tissue culture capability self-bred by crops of agricultural academy of Shandong province, and can be obtained by the public from the crop research institute of agricultural academy of Shandong province.

Plasmid pBUE411(17430bp) was supplied by the Sunzhou project group of Chinese university of agriculture; the public is available from the university of agriculture in China.

Experimental example 1 construction of expression vector

1. Design of sgrnas targeting LPR2

The sequence of LPR2 gene was amplified in wheat variety Fielder, the amplified sequence is shown in FIG. 1, the underlined sequence is sgRNA sequence targeting LPR2 gene, the three-digit sequence after the underlined is labeled PAM sequence, and is 100% similar to the gene sequence of wheat in NCBI database. The gene has total length of 1761 basic groups, 1 suitable targeting site is searched for in a coding region of LPR2 gene through a website CRISPRDIRect (http:// crispr. dbcls. jp /), a 20bp sequence fragment is found in front of a PAM structure and is set as a target sequence, and a sgRNA sequence is selected as CGGAGCCGACGACGTGGAAG.

Annealing of sgRNA and formation of double strands

The 2 oligos of sgRNA of LPR2 gene were synthesized by Hippocastanaceae Biotechnology Inc., where the oligonucleotides of sgRNA corresponded to LPR2-gR1-TaU3-F and LPR2-gR1-TaU3-R (Table 1), and the underlined base portions in the primers matched to the sequences in pBUE411 vector. Respectively phosphorylating 2 oligos of the sgRNA, and directly annealing to form double chains, wherein the system is as follows: LPR2-gR1-TaU3-F (10. mu.M): 4 μ L, LPR2-gR1-TaU3-R (10 uM): 4 μ L,10 XT 4 PNKbuffer:1.5 μ L, PNK:1 μ L, ATP:1 μ L, ddH₂O make up to 15. mu.L. The program was run in a PCR instrument under the following conditions: 30min at 37 ℃; 95 ℃ for 5 min; ramp to 25 ℃ at5 ℃/min (0.08 ℃/s). Or boiling in boiling water for 5min, and naturally cooling to room temperature.

Linearization of the pBUE411 vector

The pBUE411 carrier is cut by the endonuclease of BsaI for 3h as shown in the figure 2, and 1 is that the pBUE411 is cut by the BsaI; 2 is DL2000 Marker; 3 is a Marker of 1kb, linear vector fragments are recovered after electrophoresis, and vector fragments containing the promoter A, the terminator A, the promoter B and the terminator B are recovered; .

Ligation of the pBUE411 vector with sgRNA

The linking reaction system is：5×ligation Buffer 2μL，annealed oligo duplex 4μL，pBUE411/BsaI 2ul(100ng)，T4 ligase1μL，ddH₂O to 10. mu.L, and ligation was performed at 25 ℃ for 30 min.

5. Verification of transformation

The ligation product is transformed into escherichia coli, the recombinant plasmid is transformed into DH5 α competent cells, then the cells are cultured on an LB (Kan) plate until clones grow out, a single clone is selected for carrying out bacteria liquid PCR identification and sequencing, the primers are pBUE411-F and pBUE411-R, sequencing results (shown in figure 3) detect target sequences of sgRNA, meanwhile TaU3 promoter sequences are detected at the upstream of the target sequences, the sequencing results show that the sgRNA expression cassette is successfully constructed and successfully assembled into a pBUE411 binary expression vector, and the construction success of a CRISPR/Cas9 gene editing vector of TaLPR2 is proved.

Experimental example 2 transformation of Gene editing vector into common wheat

1. Preparing a culture medium: see Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol.1223DOI10.007/978-1-4939-

2. And (3) agrobacterium transformation: taking wheat ears pollinated for about 15 days, taking grains and stripping embryos. The agrobacterium suspension is shaken one day before the test, cultured at 160r and 28 ℃ for 24 hours, after the ear is prepared, 1ml of the agrobacterium suspension is prepared, and 1.4ul of acetosyringone (0.1M) is added into a 1.5ml centrifuge tube and mixed evenly. Adding prepared bacterial liquid for infection for 5 minutes, placing on a co-culture medium, and performing dark culture at 23 ℃ for 3 days. After co-culture, the cells were placed on a resting medium for dark culture for 5 days at 25 ℃. The calli were transferred to selection medium 1. The petri dish was sealed with a sealing film and cultured in a 25.5 degree incubator for 2 weeks in the dark. The calli were cut and transferred to selection medium 2.

The petri dish was sealed with a sealing film and cultured in a 25.5 degree incubator for 2 weeks in the dark. After 2 weeks of callus excision screening, resistant calli were transferred to regeneration medium. The resistant calli generally have green buds or dots, or have beautiful beige globular structures.

Pasty and brown callus did not transfer. The proliferated calli can be cut into smaller calli again. The patches from the same callus should be re-laid on the same line. Note the direction of the calli, e.g., green bud and green dot up.

The culture dish is sealed and put into a 25-degree incubator for 2 weeks under illumination (16 h). After 2 weeks of regeneration, healthy growing plantlets were transferred to new resistant regeneration pods. When the seedlings grow to a certain size, sampling detection can be carried out.

3. Mutant detection of transgenic seedlings

3.1T 0 generation transgenic line positive identification and mutant screening

As the T-DNA area of the vector used for the transformation is provided with three expression frames of cas9, bar and gRNA, the expression detection of the bar gene is mature, a commercial detection reagent strip is provided, and a sample can be judged whether to carry the bar gene within 10 minutes after coarse grinding by using the reagent strip, so that the method is faster and more efficient than PCR amplification. Therefore, we used the bar gene detection kit quickstix with the non-transgenic plants as negative controls^TMThe transgenic wheat T0 plant is detected by the following specific operations:

taking 3-5cm of transgenic seedling, placing into a 1.5m centrifuge tube, grinding with a grinding rod, adding 500 μ L Buffer, inserting Bar test strip, standing for 5min, recording data according to the number of bands displayed by the test strip, wherein 2 bands represent positive, and 1 band represents negative. The kit was purchased from maitsen technologies ltd.

The result of screening positive transgenic seedlings is shown in fig. 4, samples 1-8 are T0 generation regenerated seedlings, 9 is a positive control, and 10 is a negative control, wherein two strips appear in samples 1,3,4, 5, 6,7, and 8, the result is consistent with the result of the positive control 9, and the positive transgenic seedlings are positive seedlings; 1 to 8 respectively represent LPR2-01, -02, -03, -04, -05, 06, -07, -08.

Specific amplification and mutant identification of DA2 gene of transgenic plant of generation 3.2T 0

Whether the target gene editing is successful or not needs sequencing for identification, and the Hi-TOM gene editing site detection kit produced by Tianjinnuo grass genesis company is adopted in the experiment. The kit automatically completes the high-throughput library building process by a PCR method, and directly analyzes the variation information of multiple samples and multiple sites by using Hi-TOM online software. Specific primers (Primer-F and Primer-R in Table 1) on both sides of the target sequence are used for amplifying LPR2, and amplified products are sent to a Nordhea nucleic acid source for sequencing after being subjected to library building. The wild type nucleotide sequence of the wheat LPR2 gene of interest is shown as SEQ11, the deduced amino acid sequence is shown as FIG. 5, the nucleotide sequence of the target gene of the mutant is shown as SEQ12, the deduced amino acid sequence is shown as FIG. 6, the alignment shows that the nucleotide of LPR2-2 at +954 lacks 4 bases CCAC (the first part is marked by underline and arrow), TGA (the second part is marked by underline and arrow) appears at +1087 of the mutant sequence, the TGA becomes a stop codon, which causes premature termination of protein translation, the alignment of the nucleotide sequences is shown as FIG. 7, the part marked by bold underline and arrow is the part where the wild type and the mutant are different, the alignment of the amino acid sequences is shown as FIG. 8, and the part marked by underline and arrow is the part where the wild type and the mutant are different.

First round PCR reaction System: mu.L of pBUE411-LPR2 transgenic wheat plant leaf DNA was used as a template, and 2 XTAQA Master Mix 10. mu.L, Primer-F and Primer-R (Table 1) (10. mu.M) in the kit were each 0.5. mu.L, and nucleic-free Water was supplemented to 20. mu.L. The PCR reaction conditions are as follows: denaturation at 94 deg.C for 2 min; denaturation at 94 ℃ for 30s, renaturation at 65 ℃ for 30s, and extension at 72 ℃ for 20s for 33 cycles; finally, extension is carried out for 5min at 72 ℃. After the PCR is finished, 5 mu L of agarose gel electrophoresis is taken to detect the PCR product, so that the existence of the target product is ensured and the specificity is good. Then, a second round of PCR reaction was performed, in which 12. mu.L of Hi-TOM Mix in the kit was added to make up the volume to 20. mu.L using the first round of PCR product as a template, and 1. mu.L of nucleic-free Water was added. PCR reaction procedure: denaturation at 94 deg.C for 2 min; denaturation at 94 ℃ for 30s, renaturation at 57 ℃ for 30s, and extension at 72 ℃ for 25s for 33 cycles; finally, extension is carried out for 5min at 72 ℃.

Phenotypic characterization of 4 Low phosphorus treatment in Gene editing Material and control Material

Placing the wheat seeds which are not subjected to transgenic field material and gene editing material TalPR-6 in a culture dish, adding a proper amount of water, accelerating germination for 15-18 h in a germination box, placing the seeds on a self-made seedling development net for growth for 6 days after the seeds are exposed to the white, selecting the uniform seedlings, transferring the seedlings to a culture box, and starting nutrient solution culture. Wheat seedling culture conditionsThe temperature is 21 +/-1) DEG C, the humidity is 50-60%, and the light intensity is 150-200 mu mol/(cm2 & s). Changing the nutrient solution every 3 days, continuously culturing for 18 days, and investigating the seedling stage characters. The water culture adopts a Hoagland nutrient solution formula and KH under a contrast condition₂PO₄KH at a concentration of 200. mu. mol/L under low-phosphorus conditions₂PO₄The concentration was 5. mu. mol/L. Each treatment was set to 6 replicates, each replicate having about 20 wheat seedlings.

In the control test CK, the mean shoot lengths of the non-transgenic Fielder material and the gene editing material TaLPR-6 were 41.32cm and 41.54cm, respectively (Table 2), with no significant difference in statistical tests; in the low-phosphorus treatment test, the mean seedling lengths of the non-transgenic Fielder material and the gene editing material TaLPR-6 were 37.77cm and 40.07cm, respectively (table 2), and the statistically tested P-value was less than 2.2e-16, reaching a significant difference level.

TABLE 2. seedling length of non-transgenic Fielder material and gene editing material TaLPR-6 after low phosphorous treatment.

In the control test CK, the average values of the fresh aerial weight of the non-transgenic Fielder material and the gene editing material TaLPR-6 were 695.63mg and 696.33mg, respectively (table 3), with no significant difference in statistical test; in the low phosphorus treatment test, the average values of the fresh weights of the overground parts of the non-transgenic Fielder material and the gene editing material TaLPR-6 are 561.03mg and 690.77mg respectively (table 3), and the statistically tested P-value is less than 2.2e-16, which reaches a significant difference level.

TABLE 3 fresh weight of aerial parts of non-transgenic Fielder material and gene editing material TaLPR-6 after low phosphorous treatment.

SEQUENCE LISTING

<110> institute of agricultural sciences of Shandong province

<120> method for improving phosphorus utilization rate of wheat by using gene editing

<130>2019

<160>13

<170>PatentIn version 3.3

<210>1

<211>25

<212>DNA

<213> Artificial sequence

<400>1

ggcgagtctt acttgtggct cgagt 25

<210>2

<211>25

<212>DNA

<213> Artificial sequence

<400>2

aaacactcga gccacaagta agact 25

<210>3

<211>527

<212>DNA

<213> Artificial sequence

<400>3

catgaatcca aaccacacgg agttcaaatt cccacagatt aaggctcgtc cgtcgcacaa 60

ggtaatgtgt gaatattata tctgtcgtgc aaaattgcct ggcctgcaca attgctgtta 120

tagttggcgg cagggagagt tttaacattg actagcgtgc tgataatttg tgagaaataa 180

taattgacaa gtagatactg acatttgaga agagcttctg aactgttatt agtaacaaaa 240

atggaaagct gatgcacgga aaaaggaaag aaaaagccat actttttttt aggtaggaaa 300

agaaaaagcc atacgagact gatgtctctc agatgggccg ggatctgtct atctagcagg 360

cagcagccca ccaacctcac gggccagcaa ttacgagtcc ttctaaaagc tcccgccgag 420

gggcgctggc gctgctgtgc agcagcacgt ctaacattag tcccacctcg ccagtttaca 480

gggagcagaa ccagcttata agcggaggcg cggcaccaag aagcggc 527

<210>4

<211>1992

<212>DNA

<213> Artificial sequence

<400>4

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg 840

ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 900

tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 960

ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct 1020

tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 1080

tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 1140

tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 1200

atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 1260

gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 1320

tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 1380

agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 1440

gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 1500

ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 1560

gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 1620

aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 1680

catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 1740

ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 1800

ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 1860

gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 1920

atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 1980

ttacttctgc ag 1992

<210>5

<211>291

<212>DNA

<213> Artificial sequence

<400>5

tttttttttt cgttttgcat tgagttttct ccgtcgcatg tttgcagttt tattttccgt 60

tttgcattga aatttctccg tctcatgttt gcagcgtgtt caaaaagtac gcagctgtat 120

ttcacttatt tacggcgcca cattttcatg ccgtttgtgc caactatccc gagctagtga 180

atacagcttg gcttcacaca acactggtga cccgctgacc tgctcgtacc tcgtaccgtc 240

gtacggcaca gcatttggaa ttaaagggtg tgatcgatac tgcttgctgc t 291

<210>6

<211>571

<212>DNA

<213> Artificial sequence

<400>6

aagcggccag cggcgacgaa gaaggcgggg caggcgaaga agaagaagtg agctcagagc 60

tttcgttcgt atcatcggtt tcgacaacgt tcgtcaagtt caatgcatca gtttcattgc 120

gcacacacca gaatcctact gagtttgagt attatggcat tgggaaaact gtttttcttg 180

taccatttgt tgtgcttgta atttactgtg ttttttattc ggttttcgct atcgaactgt 240

gaaatggaaa tggatggaga agagttaatg aatgatatgg tccttttgtt cattctcaaa 300

ttaatattat ttgttttttc tcttatttgt tgtgtgttga atttgaaatt ataagagata 360

tgcaaacatt ttgttttgag taaaaatgtg tcaaatcgtg gcctctaatg accgaagtta 420

atatgaggag taaaacactt gtagttgtac cattatgctt attcactagg caacaaatat 480

attttcagac ctagaaaagc tgcaaatgtt actgaataca agtatgtcct cttgtgtttt 540

agacatttat gaactttcct ttatgtaatt t 571

<210>7

<211>916

<212>DNA

<213> Artificial sequence

<400>7

catgaatcca aaccacacgg agttcaaatt cccacagatt aaggctcgtc cgtcgcacaa 60

ggtaatgtgt gaatattata tctgtcgtgc aaaattgcct ggcctgcaca attgctgtta 120

tagttggcgg cagggagagt tttaacattg actagcgtgc tgataatttg tgagaaataa 180

taattgacaa gtagatactg acatttgaga agagcttctg aactgttatt agtaacaaaa 240

atggaaagct gatgcacgga aaaaggaaag aaaaagccat actttttttt aggtaggaaa 300

agaaaaagcc atacgagact gatgtctctc agatgggccg ggatctgtct atctagcagg 360

cagcagccca ccaacctcac gggccagcaa ttacgagtcc ttctaaaagc tcccgccgag 420

gggcgctggc gctgctgtgc agcagcacgt ctaacattag tcccacctcg ccagtttaca 480

gggagcagaa ccagcttata agcggaggcg cggcaccaag aagcggcgag agcatgtcgt 540

aggggcgccg ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact 600

tgaaaaagtg gcaccgagtc ggtgcttttt tttttcgttt tgcattgagt tttctccgtc 660

gcatgtttgc agttttattt tccgttttgc attgaaattt ctccgtctca tgtttgcagc 720

gtgttcaaaa agtacgcagc tgtatttcac ttatttacgg cgccacattt tcatgccgtt 780

tgtgccaact atcccgagct agtgaataca gcttggcttc acacaacact ggtgacccgc 840

tgacctgctc gtacctcgta ccgtcgtacg gcacagcatt tggaattaaa gggtgtgatc 900

gatactgctt gctgct 916

<210>8

<211>6799

<212>DNA

<213> Artificial sequence

<400>8

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg 840

ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 900

tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 960

ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct 1020

tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 1080

tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 1140

tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 1200

atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 1260

gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 1320

tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 1380

agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 1440

gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 1500

ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 1560

gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 1620

aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 1680

catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 1740

ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 1800

ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 1860

gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 1920

atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 1980

ttacttctgc agccctaggc ctactagatg gattacaagg accacgacgg ggattacaag 2040

gaccacgaca ttgattacaa ggatgatgat gacaagatgg ctccgaagaa gaagaggaag 2100

gttggcatcc acggggtgcc agctgctgac aagaagtact cgatcggcct cgatattggg 2160

actaactctg ttggctgggc cgtgatcacc gacgagtaca aggtgccctc aaagaagttc 2220

aaggtcctgg gcaacaccga tcggcattcc atcaagaaga atctcattgg cgctctcctg 2280

ttcgacagcg gcgagacggc tgaggctacg cggctcaagc gcaccgcccg caggcggtac 2340

acgcgcagga agaatcgcat ctgctacctg caggagattt tctccaacga gatggcgaag 2400

gttgacgatt ctttcttcca caggctggag gagtcattcc tcgtggagga ggataagaag 2460

cacgagcggc atccaatctt cggcaacatt gtcgacgagg ttgcctacca cgagaagtac 2520

cctacgatct accatctgcg gaagaagctc gtggactcca cagataaggc ggacctccgc 2580

ctgatctacc tcgctctggc ccacatgatt aagttcaggg gccatttcct gatcgagggg 2640

gatctcaacc cggacaatag cgatgttgac aagctgttca tccagctcgt gcagacgtac 2700

aaccagctct tcgaggagaa ccccattaat gcgtcaggcg tcgacgcgaa ggctatcctg 2760

tccgctaggc tctcgaagtc tcggcgcctc gagaacctga tcgcccagct gccgggcgag 2820

aagaagaacg gcctgttcgg gaatctcatt gcgctcagcc tggggctcac gcccaacttc 2880

aagtcgaatt tcgatctcgc tgaggacgcc aagctgcagc tctccaagga cacatacgac 2940

gatgacctgg ataacctcct ggcccagatc ggcgatcagt acgcggacct gttcctcgct 3000

gccaagaatc tgtcggacgc catcctcctg tctgatattc tcagggtgaa caccgagatt 3060

acgaaggctc cgctctcagc ctccatgatc aagcgctacg acgagcacca tcaggatctg 3120

accctcctga aggcgctggt caggcagcag ctccccgaga agtacaagga gatcttcttc 3180

gatcagtcga agaacggcta cgctgggtac attgacggcg gggcctctca ggaggagttc 3240

tacaagttca tcaagccgat tctggagaag atggacggca cggaggagct gctggtgaag 3300

ctcaatcgcg aggacctcct gaggaagcag cggacattcg ataacggcag catcccacac 3360

cagattcatc tcggggagct gcacgctatc ctgaggaggc aggaggactt ctaccctttc 3420

ctcaaggata accgcgagaa gatcgagaag attctgactt tcaggatccc gtactacgtc 3480

ggcccactcg ctaggggcaa ctcccgcttc gcttggatga cccgcaagtc agaggagacg 3540

atcacgccgt ggaacttcga ggaggtggtc gacaagggcg ctagcgctca gtcgttcatc 3600

gagaggatga cgaatttcga caagaacctg ccaaatgaga aggtgctccc taagcactcg 3660

ctcctgtacg agtacttcac agtctacaac gagctgacta aggtgaagta tgtgaccgag 3720

ggcatgagga agccggcttt cctgtctggg gagcagaaga aggccatcgt ggacctcctg 3780

ttcaagacca accggaaggt cacggttaag cagctcaagg aggactactt caagaagatt 3840

gagtgcttcg attcggtcga gatctctggc gttgaggacc gcttcaacgc ctccctgggg 3900

acctaccacg atctcctgaa gatcattaag gataaggact tcctggacaa cgaggagaat 3960

gaggatatcc tcgaggacat tgtgctgaca ctcactctgt tcgaggaccg ggagatgatc 4020

gaggagcgcc tgaagactta cgcccatctc ttcgatgaca aggtcatgaa gcagctcaag 4080

aggaggaggt acaccggctg ggggaggctg agcaggaagc tcatcaacgg cattcgggac 4140

aagcagtccg ggaagacgat cctcgacttc ctgaagagcg atggcttcgc gaaccgcaat 4200

ttcatgcagc tgattcacga tgacagcctc acattcaagg aggatatcca gaaggctcag 4260

gtgagcggcc agggggactc gctgcacgag catatcgcga acctcgctgg ctcgccagct 4320

atcaagaagg ggattctgca gaccgtgaag gttgtggacg agctggtgaa ggtcatgggc 4380

aggcacaagc ctgagaacat cgtcattgag atggcccggg agaatcagac cacgcagaag 4440

ggccagaaga actcacgcga gaggatgaag aggatcgagg agggcattaa ggagctgggg 4500

tcccagatcc tcaaggagca cccggtggag aacacgcagc tgcagaatga gaagctctac 4560

ctgtactacc tccagaatgg ccgcgatatg tatgtggacc aggagctgga tattaacagg 4620

ctcagcgatt acgacgtcga tcatatcgtt ccacagtcat tcctgaagga tgactccatt 4680

gacaacaagg tcctcaccag gtcggacaag aaccggggca agtctgataa tgttccttca 4740

gaggaggtcg ttaagaagat gaagaactac tggcgccagc tcctgaatgc caagctgatc 4800

acgcagcgga agttcgataa cctcacaaag gctgagaggg gcgggctctc tgagctggac 4860

aaggcgggct tcatcaagag gcagctggtc gagacacggc agatcactaa gcacgttgcg 4920

cagattctcg actcacggat gaacactaag tacgatgaga atgacaagct gatccgcgag 4980

gtgaaggtca tcaccctgaa gtcaaagctc gtctccgact tcaggaagga tttccagttc 5040

tacaaggttc gggagatcaa caattaccac catgcccatg acgcgtacct gaacgcggtg 5100

gtcggcacag ctctgatcaa gaagtaccca aagctcgaga gcgagttcgt gtacggggac 5160

tacaaggttt acgatgtgag gaagatgatc gccaagtcgg agcaggagat tggcaaggct 5220

accgccaagt acttcttcta ctctaacatt atgaatttct tcaagacaga gatcactctg5280

gccaatggcg agatccggaa gcgccccctc atcgagacga acggcgagac gggggagatc 5340

gtgtgggaca agggcaggga tttcgcgacc gtcaggaagg ttctctccat gccacaagtg 5400

aatatcgtca agaagacaga ggtccagact ggcgggttct ctaaggagtc aattctgcct 5460

aagcggaaca gcgacaagct catcgcccgc aagaaggact gggatccgaa gaagtacggc 5520

gggttcgaca gccccactgt ggcctactcg gtcctggttg tggcgaaggt tgagaagggc 5580

aagtccaaga agctcaagag cgtgaaggag ctgctgggga tcacgattat ggagcgctcc 5640

agcttcgaga agaacccgat cgatttcctg gaggcgaagg gctacaagga ggtgaagaag 5700

gacctgatca ttaagctccc caagtactca ctcttcgagc tggagaacgg caggaagcgg 5760

atgctggctt ccgctggcga gctgcagaag gggaacgagc tggctctgcc gtccaagtat 5820

gtgaacttcc tctacctggc ctcccactac gagaagctca agggcagccc cgaggacaac 5880

gagcagaagc agctgttcgt cgagcagcac aagcattacc tcgacgagat cattgagcag 5940

atttccgagt tctccaagcg cgtgatcctg gccgacgcga atctggataa ggtcctctcc 6000

gcgtacaaca agcaccgcga caagccaatc agggagcagg ctgagaatat cattcatctc 6060

ttcaccctga cgaacctcgg cgcccctgct gctttcaagt acttcgacac aactatcgat 6120

cgcaagaggt acacaagcac taaggaggtc ctggacgcga ccctcatcca ccagtcgatt 6180

accggcctct acgagacgcg catcgacctg tctcagctcg ggggcgacaa gcggccagcg 6240

gcgacgaaga aggcggggca ggcgaagaag aagaagtgag ctcagagctt tcgttcgtat 6300

catcggtttc gacaacgttc gtcaagttca atgcatcagt ttcattgcgc acacaccaga 6360

atcctactga gtttgagtat tatggcattg ggaaaactgt ttttcttgta ccatttgttg 6420

tgcttgtaat ttactgtgtt ttttattcgg ttttcgctat cgaactgtga aatggaaatg 6480

gatggagaag agttaatgaa tgatatggtc cttttgttca ttctcaaatt aatattattt 6540

gttttttctc ttatttgttg tgtgttgaat ttgaaattat aagagatatg caaacatttt 6600

gttttgagta aaaatgtgtc aaatcgtggc ctctaatgac cgaagttaat atgaggagta 6660

aaacacttgt agttgtacca ttatgcttat tcactaggca acaaatatat tttcagacct 6720

agaaaagctg caaatgttac tgaatacaag tatgtcctct tgtgttttag acatttatga 6780

actttccttt atgtaattt 6799

<210>9

<211>16231

<212>DNA

<213> Artificial sequence

<400>9

gtaaacgctc ttttctctta ggtttacccg ccaatatatc ctgtcaaaca ctgatagttt 60

aaactgaagg cgggaaacga caatctgatc caagctcaag ctgctctagc attcgccatt 120

caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagct 180

ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcccagtc 240

acgacgttgt aaaacgacgg ccagtgccaa gcttcatgaa tccaaaccac acggagttca 300

aattcccaca gattaaggct cgtccgtcgc acaaggtaat gtgtgaatat tatatctgtc 360

gtgcaaaatt gcctggcctg cacaattgct gttatagttg gcggcaggga gagttttaac 420

attgactagc gtgctgataa tttgtgagaa ataataattg acaagtagat actgacattt 480

gagaagagct tctgaactgt tattagtaac aaaaatggaa agctgatgca cggaaaaagg 540

aaagaaaaag ccatactttt ttttaggtag gaaaagaaaa agccatacga gactgatgtc 600

tctcagatgg gccgggatct gtctatctag caggcagcag cccaccaacc tcacgggcca 660

gcaattacga gtccttctaa aagctcccgc cgaggggcgc tggcgctgct gtgcagcagc 720

acgtctaaca ttagtcccac ctcgccagtt tacagggagc agaaccagct tataagcgga 780

ggcgcggcac caagaagcgg cgacggagcc gacgacgtgg aaggttttag agctagaaat 840

agcaagttaa aataaggcta gtccgttatc aacttgaaaa agtggcaccg agtcggtgct 900

tttttttttc gttttgcatt gagttttctc cgtcgcatgt ttgcagtttt attttccgtt 960

ttgcattgaa atttctccgt ctcatgtttg cagcgtgttc aaaaagtacg cagctgtatt 1020

tcacttattt acggcgccac attttcatgc cgtttgtgcc aactatcccg agctagtgaa 1080

tacagcttgg cttcacacaa cactggtgac ccgctgacct gctcgtacct cgtaccgtcg 1140

tacggcacag catttggaat taaagggtgt gatcgatact gcttgctgct aagcttgcat 1200

gcctgcagtg cagcgtgacc cggtcgtgcc cctctctaga gataatgagc attgcatgtc 1260

taagttataa aaaattacca catatttttt ttgtcacact tgtttgaagt gcagtttatc 1320

tatctttata catatattta aactttactc tacgaataat ataatctata gtactacaat 1380

aatatcagtg ttttagagaa tcatataaat gaacagttag acatggtcta aaggacaatt 1440

gagtattttg acaacaggac tctacagttt tatcttttta gtgtgcatgt gttctccttt 1500

ttttttgcaa atagcttcac ctatataata cttcatccat tttattagta catccattta 1560

gggtttaggg ttaatggttt ttatagacta atttttttag tacatctatt ttattctatt 1620

ttagcctcta aattaagaaa actaaaactc tattttagtt tttttattta ataatttaga 1680

tataaaatag aataaaataa agtgactaaa aattaaacaa atacccttta agaaattaaa 1740

aaaactaagg aaacattttt cttgtttcga gtagataatg ccagcctgtt aaacgccgtc 1800

gacgagtcta acggacacca accagcgaac cagcagcgtc gcgtcgggcc aagcgaagca 1860

gacggcacgg catctctgtc gctgcctctg gacccctctc gagagttccg ctccaccgtt 1920

ggacttgctc cgctgtcggc atccagaaat tgcgtggcgg agcggcagac gtgagccggc 1980

acggcaggcg gcctcctcct cctctcacgg cacggcagct acgggggatt cctttcccac 2040

cgctccttcg ctttcccttc ctcgcccgcc gtaataaata gacaccccct ccacaccctc 2100

tttccccaac ctcgtgttgt tcggagcgca cacacacaca accagatctc ccccaaatcc 2160

acccgtcggc acctccgctt caaggtacgc cgctcgtcct cccccccccc ccctctctac 2220

cttctctaga tcggcgttcc ggtccatggt tagggcccgg tagttctact tctgttcatg 2280

tttgtgttag atccgtgttt gtgttagatc cgtgctgcta gcgttcgtac acggatgcga 2340

cctgtacgtc agacacgttc tgattgctaa cttgccagtg tttctctttg gggaatcctg 2400

ggatggctct agccgttccg cagacgggat cgatttcatg attttttttg tttcgttgca 2460

tagggtttgg tttgcccttt tcctttattt caatatatgc cgtgcacttg tttgtcgggt 2520

catcttttca tgcttttttt tgtcttggtt gtgatgatgt ggtctggttg ggcggtcgtt 2580

ctagatcgga gtagaattct gtttcaaact acctggtgga tttattaatt ttggatctgt 2640

atgtgtgtgc catacatatt catagttacg aattgaagat gatggatgga aatatcgatc 2700

taggataggt atacatgttg atgcgggttt tactgatgca tatacagaga tgctttttgt 2760

tcgcttggtt gtgatgatgt ggtgtggttg ggcggtcgtt cattcgttct agatcggagt 2820

agaatactgt ttcaaactac ctggtgtatt tattaatttt ggaactgtat gtgtgtgtca 2880

tacatcttca tagttacgag tttaagatgg atggaaatat cgatctagga taggtataca 2940

tgttgatgtg ggttttactg atgcatatac atgatggcat atgcagcatc tattcatatg 3000

ctctaacctt gagtacctat ctattataat aaacaagtat gttttataat tattttgatc 3060

ttgatatact tggatgatgg catatgcagc agctatatgt ggattttttt agccctgcct 3120

tcatacgcta tttatttgct tggtactgtt tcttttgtcg atgctcaccc tgttgtttgg 3180

tgttacttct gcagccctag gcctactaga tggattacaa ggaccacgac ggggattaca 3240

aggaccacga cattgattac aaggatgatg atgacaagat ggctccgaag aagaagagga 3300

aggttggcat ccacggggtg ccagctgctg acaagaagta ctcgatcggc ctcgatattg 3360

ggactaactc tgttggctgg gccgtgatca ccgacgagta caaggtgccc tcaaagaagt 3420

tcaaggtcct gggcaacacc gatcggcatt ccatcaagaa gaatctcatt ggcgctctcc 3480

tgttcgacag cggcgagacg gctgaggcta cgcggctcaa gcgcaccgcc cgcaggcggt 3540

acacgcgcag gaagaatcgc atctgctacc tgcaggagat tttctccaac gagatggcga 3600

aggttgacga ttctttcttc cacaggctgg aggagtcatt cctcgtggag gaggataaga 3660

agcacgagcg gcatccaatc ttcggcaaca ttgtcgacga ggttgcctac cacgagaagt 3720

accctacgat ctaccatctg cggaagaagc tcgtggactc cacagataag gcggacctcc 3780

gcctgatcta cctcgctctg gcccacatga ttaagttcag gggccatttc ctgatcgagg 3840

gggatctcaa cccggacaat agcgatgttg acaagctgtt catccagctc gtgcagacgt 3900

acaaccagct cttcgaggag aaccccatta atgcgtcagg cgtcgacgcg aaggctatcc 3960

tgtccgctag gctctcgaag tctcggcgcc tcgagaacct gatcgcccag ctgccgggcg 4020

agaagaagaa cggcctgttc gggaatctca ttgcgctcag cctggggctc acgcccaact 4080

tcaagtcgaa tttcgatctc gctgaggacg ccaagctgca gctctccaag gacacatacg 4140

acgatgacct ggataacctc ctggcccaga tcggcgatca gtacgcggac ctgttcctcg 4200

ctgccaagaa tctgtcggac gccatcctcc tgtctgatat tctcagggtg aacaccgaga 4260

ttacgaaggc tccgctctca gcctccatga tcaagcgcta cgacgagcac catcaggatc 4320

tgaccctcct gaaggcgctg gtcaggcagc agctccccga gaagtacaag gagatcttct 4380

tcgatcagtc gaagaacggc tacgctgggt acattgacgg cggggcctct caggaggagt 4440

tctacaagtt catcaagccg attctggaga agatggacgg cacggaggag ctgctggtga 4500

agctcaatcg cgaggacctc ctgaggaagc agcggacatt cgataacggc agcatcccac 4560

accagattca tctcggggag ctgcacgcta tcctgaggag gcaggaggac ttctaccctt 4620

tcctcaagga taaccgcgag aagatcgaga agattctgac tttcaggatc ccgtactacg 4680

tcggcccact cgctaggggc aactcccgct tcgcttggat gacccgcaag tcagaggaga 4740

cgatcacgcc gtggaacttc gaggaggtgg tcgacaaggg cgctagcgct cagtcgttca 4800

tcgagaggat gacgaatttc gacaagaacc tgccaaatga gaaggtgctc cctaagcact 4860

cgctcctgta cgagtacttc acagtctaca acgagctgac taaggtgaag tatgtgaccg 4920

agggcatgag gaagccggct ttcctgtctg gggagcagaa gaaggccatc gtggacctcc 4980

tgttcaagac caaccggaag gtcacggtta agcagctcaa ggaggactac ttcaagaaga 5040

ttgagtgctt cgattcggtc gagatctctg gcgttgagga ccgcttcaac gcctccctgg 5100

ggacctacca cgatctcctg aagatcatta aggataagga cttcctggac aacgaggaga 5160

atgaggatat cctcgaggac attgtgctga cactcactct gttcgaggac cgggagatga 5220

tcgaggagcg cctgaagact tacgcccatc tcttcgatga caaggtcatg aagcagctca 5280

agaggaggag gtacaccggc tgggggaggc tgagcaggaa gctcatcaac ggcattcggg 5340

acaagcagtc cgggaagacg atcctcgact tcctgaagag cgatggcttc gcgaaccgca 5400

atttcatgca gctgattcac gatgacagcc tcacattcaa ggaggatatc cagaaggctc 5460

aggtgagcgg ccagggggac tcgctgcacg agcatatcgc gaacctcgct ggctcgccag 5520

ctatcaagaa ggggattctg cagaccgtga aggttgtgga cgagctggtg aaggtcatgg 5580

gcaggcacaa gcctgagaac atcgtcattg agatggcccg ggagaatcag accacgcaga 5640

agggccagaa gaactcacgc gagaggatga agaggatcga ggagggcatt aaggagctgg 5700

ggtcccagat cctcaaggag cacccggtgg agaacacgca gctgcagaat gagaagctct 5760

acctgtacta cctccagaat ggccgcgata tgtatgtgga ccaggagctg gatattaaca 5820

ggctcagcga ttacgacgtc gatcatatcg ttccacagtc attcctgaag gatgactcca 5880

ttgacaacaa ggtcctcacc aggtcggaca agaaccgggg caagtctgat aatgttcctt 5940

cagaggaggt cgttaagaag atgaagaact actggcgcca gctcctgaat gccaagctga 6000

tcacgcagcg gaagttcgat aacctcacaa aggctgagag gggcgggctc tctgagctgg 6060

acaaggcggg cttcatcaag aggcagctgg tcgagacacg gcagatcact aagcacgttg 6120

cgcagattct cgactcacgg atgaacacta agtacgatga gaatgacaag ctgatccgcg 6180

aggtgaaggt catcaccctg aagtcaaagc tcgtctccga cttcaggaag gatttccagt 6240

tctacaaggt tcgggagatc aacaattacc accatgccca tgacgcgtac ctgaacgcgg 6300

tggtcggcac agctctgatc aagaagtacc caaagctcga gagcgagttc gtgtacgggg 6360

actacaaggt ttacgatgtg aggaagatga tcgccaagtc ggagcaggag attggcaagg 6420

ctaccgccaa gtacttcttc tactctaaca ttatgaattt cttcaagaca gagatcactc 6480

tggccaatgg cgagatccgg aagcgccccc tcatcgagac gaacggcgag acgggggaga 6540

tcgtgtggga caagggcagg gatttcgcga ccgtcaggaa ggttctctcc atgccacaag 6600

tgaatatcgt caagaagaca gaggtccaga ctggcgggtt ctctaaggag tcaattctgc 6660

ctaagcggaa cagcgacaag ctcatcgccc gcaagaagga ctgggatccg aagaagtacg 6720

gcgggttcga cagccccact gtggcctact cggtcctggt tgtggcgaag gttgagaagg 6780

gcaagtccaa gaagctcaag agcgtgaagg agctgctggg gatcacgatt atggagcgct 6840

ccagcttcga gaagaacccg atcgatttcc tggaggcgaa gggctacaag gaggtgaaga 6900

aggacctgat cattaagctc cccaagtact cactcttcga gctggagaac ggcaggaagc 6960

ggatgctggc ttccgctggc gagctgcaga aggggaacga gctggctctg ccgtccaagt 7020

atgtgaactt cctctacctg gcctcccact acgagaagct caagggcagc cccgaggaca 7080

acgagcagaa gcagctgttc gtcgagcagc acaagcatta cctcgacgag atcattgagc 7140

agatttccga gttctccaag cgcgtgatcc tggccgacgc gaatctggat aaggtcctct 7200

ccgcgtacaa caagcaccgc gacaagccaa tcagggagca ggctgagaat atcattcatc 7260

tcttcaccct gacgaacctc ggcgcccctg ctgctttcaa gtacttcgac acaactatcg 7320

atcgcaagag gtacacaagc actaaggagg tcctggacgc gaccctcatc caccagtcga 7380

ttaccggcct ctacgagacg cgcatcgacc tgtctcagct cgggggcgac aagcggccag 7440

cggcgacgaa gaaggcgggg caggcgaaga agaagaagtg agctcagagc tttcgttcgt 7500

atcatcggtt tcgacaacgt tcgtcaagtt caatgcatca gtttcattgc gcacacacca 7560

gaatcctact gagtttgagt attatggcat tgggaaaact gtttttcttg taccatttgt 7620

tgtgcttgta atttactgtg ttttttattc ggttttcgct atcgaactgt gaaatggaaa 7680

tggatggaga agagttaatg aatgatatgg tccttttgtt cattctcaaa ttaatattat 7740

ttgttttttc tcttatttgt tgtgtgttga atttgaaatt ataagagata tgcaaacatt 7800

ttgttttgag taaaaatgtg tcaaatcgtg gcctctaatg accgaagtta atatgaggag 7860

taaaacactt gtagttgtac cattatgctt attcactagg caacaaatat attttcagac 7920

ctagaaaagc tgcaaatgtt actgaataca agtatgtcct cttgtgtttt agacatttat 7980

gaactttcct ttatgtaatt ttccagaatc cttgtcagat tctaatcatt gctttataat 8040

tatagttata ctcatggatt tgtagttgag tatgaaaata ttttttaatg cattttatga 8100

cttgccaatt gattgacaac gaattcgtaa tcatggtcat agctgtttcc tgtgtgaaat 8160

tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg 8220

ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag 8280

tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 8340

ttgcgtattg gctagagcag cttgccaaca tggtggagca cgacactctc gtctactcca 8400

agaatatcaa agatacagtc tcagaagacc aaagggctat tgagactttt caacaaaggg 8460

taatatcggg aaacctcctc ggattccatt gcccagctat ctgtcacttc atcaaaagga 8520

cagtagaaaa ggaaggtggc acctacaaat gccatcattg cgataaagga aaggctatcg 8580

ttcaagatgc ctctgccgac agtggtccca aagatggacc cccacccacg aggagcatcg 8640

tggaaaaaga agacgttcca accacgtctt caaagcaagt ggattgatgt gataacatgg 8700

tggagcacga cactctcgtc tactccaaga atatcaaaga tacagtctca gaagaccaaa 8760

gggctattga gacttttcaa caaagggtaa tatcgggaaa cctcctcgga ttccattgcc 8820

cagctatctg tcacttcatc aaaaggacag tagaaaagga aggtggcacc tacaaatgcc 8880

atcattgcga taaaggaaag gctatcgttc aagatgcctc tgccgacagt ggtcccaaag 8940

atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa 9000

agcaagtgga ttgatgtgat atctccactg acgtaaggga tgacgcacaa tcccactatc 9060

cttcgcaaga ccttcctcta tataaggaag ttcatttcat ttggagagga cacgctgaaa 9120

tcaccagtct ctctctacaa atctatctct ctcgagtcta ccatgagccc agaacgacgc 9180

ccggccgaca tccgccgtgc caccgaggcg gacatgccgg cggtctgcac catcgtcaac 9240

cactacatcg agacaagcac ggtcaacttc cgtaccgagc cgcaggaacc gcaggagtgg 9300

acggacgacc tcgtccgtct gcgggagcgc tatccctggc tcgtcgccga ggtggacggc 9360

gaggtcgccg gcatcgccta cgcgggcccc tggaaggcac gcaacgccta cgactggacg 9420

gccgagtcga ccgtgtacgt ctccccccgc caccagcgga cgggactggg ctccacgctc 9480

tacacccacc tgctgaagtc cctggaggca cagggcttca agagcgtggt cgctgtcatc 9540

gggctgccca acgacccgag cgtgcgcatg cacgaggcgc tcggatatgc cccccgcggc 9600

atgctgcggg cggccggctt caagcacggg aactggcatg acgtgggttt ctggcagctg 9660

gacttcagcc tgccggtacc gccccgtccg gtcctgcccg tcaccgagat ttgactcgag 9720

tttctccata ataatgtgtg agtagttccc agataaggga attagggttc ctatagggtt 9780

tcgctcatgt gttgagcata taagaaaccc ttagtatgta tttgtatttg taaaatactt 9840

ctatcaataa aatttctaat tcctaaaacc aaaatccagt actaaaatcc agatcccccg 9900

aattaattcg gcgttaattc agtacattaa aaacgtccgc aatgtgttat taagttgtct 9960

aagcgtcaat ttgtttacac cacaatatat cctgccacca gccagccaac agctccccga 10020

ccggcagctc ggcacaaaat caccactcga tacaggcagc ccatcagtcc gggacggcgt 10080

cagcgggaga gccgttgtaa ggcggcagac tttgctcatg ttaccgatgc tattcggaag 10140

aacggcaact aagctgccgg gtttgaaaca cggatgatct cgcggagggt agcatgttga 10200

ttgtaacgat gacagagcgt tgctgcctgt gatcaccgcg gtttcaaaat cggctccgtc 10260

gatactatgt tatacgccaa ctttgaaaac aactttgaaa aagctgtttt ctggtattta 10320

aggttttaga atgcaaggaa cagtgaattg gagttcgtct tgttataatt agcttcttgg 10380

ggtatcttta aatactgtag aaaagaggaa ggaaataata aatggctaaa atgagaatat 10440

caccggaatt gaaaaaactg atcgaaaaat accgctgcgt aaaagatacg gaaggaatgt 10500

ctcctgctaa ggtatataag ctggtgggag aaaatgaaaa cctatattta aaaatgacgg 10560

acagccggta taaagggacc acctatgatg tggaacggga aaaggacatg atgctatggc 10620

tggaaggaaa gctgcctgtt ccaaaggtcc tgcactttga acggcatgat ggctggagca 10680

atctgctcat gagtgaggcc gatggcgtcc tttgctcgga agagtatgaa gatgaacaaa 10740

gccctgaaaa gattatcgag ctgtatgcgg agtgcatcag gctctttcac tccatcgaca 10800

tatcggattg tccctatacg aatagcttag acagccgctt agccgaattg gattacttac 10860

tgaataacga tctggccgat gtggattgcg aaaactggga agaagacact ccatttaaag 10920

atccgcgcga gctgtatgat tttttaaaga cggaaaagcc cgaagaggaa cttgtctttt 10980

cccacggcga cctgggagac agcaacatct ttgtgaaaga tggcaaagta agtggcttta 11040

ttgatcttgg gagaagcggc agggcggaca agtggtatga cattgccttc tgcgtccggt 11100

cgatcaggga ggatatcggg gaagaacagt atgtcgagct attttttgac ttactgggga 11160

tcaagcctga ttgggagaaa ataaaatatt atattttact ggatgaattg ttttagtacc 11220

tagaatgcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg 11280

tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc 11340

aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 11400

tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt 11460

agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc 11520

taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact 11580

caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac 11640

agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag 11700

aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg 11760

gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg 11820

tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga 11880

gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt 11940

ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct 12000

ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg 12060

aggaagcgga agagcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac 12120

accgcatatg gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagtata 12180

cactccgcta tcgctacgtg actgggtcat ggctgcgccc cgacacccgc caacacccgc 12240

tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt 12300

ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgaggcaggg 12360

tgccttgatg tgggcgccgg cggtcgagtg gcgacggcgc ggcttgtccg cgccctggta 12420

gattgcctgg ccgtaggcca gccatttttg agcggccagc ggccgcgata ggccgacgcg 12480

aagcggcggg gcgtagggag cgcagcgacc gaagggtagg cgctttttgc agctcttcgg 12540

ctgtgcgctg gccagacagt tatgcacagg ccaggcgggt tttaagagtt ttaataagtt 12600

ttaaagagtt ttaggcggaa aaatcgcctt ttttctcttt tatatcagtc acttacatgt 12660

gtgaccggtt cccaatgtac ggctttgggt tcccaatgta cgggttccgg ttcccaatgt 12720

acggctttgg gttcccaatg tacgtgctat ccacaggaaa cagacctttt cgaccttttt 12780

cccctgctag ggcaatttgc cctagcatct gctccgtaca ttaggaaccg gcggatgctt 12840

cgccctcgat caggttgcgg tagcgcatga ctaggatcgg gccagcctgc cccgcctcct 12900

ccttcaaatc gtactccggc aggtcatttg acccgatcag cttgcgcacg gtgaaacaga 12960

acttcttgaa ctctccggcg ctgccactgc gttcgtagat cgtcttgaac aaccatctgg 13020

cttctgcctt gcctgcggcg cggcgtgcca ggcggtagag aaaacggccg atgccgggat 13080

cgatcaaaaa gtaatcgggg tgaaccgtca gcacgtccgg gttcttgcct tctgtgatct 13140

cgcggtacat ccaatcagct agctcgatct cgatgtactc cggccgcccg gtttcgctct 13200

ttacgatctt gtagcggcta atcaaggctt caccctcgga taccgtcacc aggcggccgt 13260

tcttggcctt cttcgtacgc tgcatggcaa cgtgcgtggt gtttaaccga atgcaggttt 13320

ctaccaggtc gtctttctgc tttccgccat cggctcgccg gcagaacttg agtacgtccg 13380

caacgtgtgg acggaacacg cggccgggct tgtctccctt cccttcccgg tatcggttca 13440

tggattcggt tagatgggaa accgccatca gtaccaggtc gtaatcccac acactggcca 13500

tgccggccgg ccctgcggaa acctctacgt gcccgtctgg aagctcgtag cggatcacct 13560

cgccagctcg tcggtcacgc ttcgacagac ggaaaacggc cacgtccatg atgctgcgac 13620

tatcgcgggt gcccacgtca tagagcatcg gaacgaaaaa atctggttgc tcgtcgccct 13680

tgggcggctt cctaatcgac ggcgcaccgg ctgccggcgg ttgccgggat tctttgcgga 13740

ttcgatcagc ggccgcttgc cacgattcac cggggcgtgc ttctgcctcg atgcgttgcc 13800

gctgggcggc ctgcgcggcc ttcaacttct ccaccaggtc atcacccagc gccgcgccga 13860

tttgtaccgg gccggatggt ttgcgaccgc tcacgccgat tcctcgggct tgggggttcc 13920

agtgccattg cagggccggc agacaaccca gccgcttacg cctggccaac cgcccgttcc 13980

tccacacatg gggcattcca cggcgtcggt gcctggttgt tcttgatttt ccatgccgcc 14040

tcctttagcc gctaaaattc atctactcat ttattcattt gctcatttac tctggtagct 14100

gcgcgatgta ttcagatagc agctcggtaa tggtcttgcc ttggcgtacc gcgtacatct 14160

tcagcttggt gtgatcctcc gccggcaact gaaagttgac ccgcttcatg gctggcgtgt 14220

ctgccaggct ggccaacgtt gcagccttgc tgctgcgtgc gctcggacgg ccggcactta 14280

gcgtgtttgt gcttttgctc attttctctt tacctcatta actcaaatga gttttgattt 14340

aatttcagcg gccagcgcct ggacctcgcg ggcagcgtcg ccctcgggtt ctgattcaag 14400

aacggttgtg ccggcggcgg cagtgcctgg gtagctcacg cgctgcgtga tacgggactc 14460

aagaatgggc agctcgtacc cggccagcgc ctcggcaacc tcaccgccga tgcgcgtgcc 14520

tttgatcgcc cgcgacacga caaaggccgc ttgtagcctt ccatccgtga cctcaatgcg 14580

ctgcttaacc agctccacca ggtcggcggt ggcccatatg tcgtaagggc ttggctgcac 14640

cggaatcagc acgaagtcgg ctgccttgat cgcggacaca gccaagtccg ccgcctgggg 14700

cgctccgtcg atcactacga agtcgcgccg gccgatggcc ttcacgtcgc ggtcaatcgt 14760

cgggcggtcg atgccgacaa cggttagcgg ttgatcttcc cgcacggccg cccaatcgcg 14820

ggcactgccc tggggatcgg aatcgactaa cagaacatcg gccccggcga gttgcagggc 14880

gcgggctaga tgggttgcga tggtcgtctt gcctgacccg cctttctggt taagtacagc 14940

gataaccttc atgcgttccc cttgcgtatt tgtttattta ctcatcgcat catatacgca 15000

gcgaccgcat gacgcaagct gttttactca aatacacatc acctttttag acggcggcgc 15060

tcggtttctt cagcggccaa gctggccggc caggccgcca gcttggcatc agacaaaccg 15120

gccaggattt catgcagccg cacggttgag acgtgcgcgg gcggctcgaa cacgtacccg 15180

gccgcgatca tctccgcctc gatctcttcg gtaatgaaaa acggttcgtc ctggccgtcc 15240

tggtgcggtt tcatgcttgt tcctcttggc gttcattctc ggcggccgcc agggcgtcgg 15300

cctcggtcaa tgcgtcctca cggaaggcac cgcgccgcct ggcctcggtg ggcgtcactt 15360

cctcgctgcg ctcaagtgcg cggtacaggg tcgagcgatg cacgccaagc agtgcagccg 15420

cctctttcac ggtgcggcct tcctggtcga tcagctcgcg ggcgtgcgcg atctgtgccg 15480

gggtgagggt agggcggggg ccaaacttca cgcctcgggc cttggcggcc tcgcgcccgc 15540

tccgggtgcg gtcgatgatt agggaacgct cgaactcggc aatgccggcg aacacggtca 15600

acaccatgcg gccggccggc gtggtggtgt cggcccacgg ctctgccagg ctacgcaggc 15660

ccgcgccggc ctcctggatg cgctcggcaa tgtccagtag gtcgcgggtg ctgcgggcca 15720

ggcggtctag cctggtcact gtcacaacgt cgccagggcg taggtggtca agcatcctgg 15780

ccagctccgg gcggtcgcgc ctggtgccgg tgatcttctc ggaaaacagc ttggtgcagc 15840

cggccgcgtg cagttcggcc cgttggttgg tcaagtcctg gtcgtcggtg ctgacgcggg 15900

catagcccag caggccagcg gcggcgctct tgttcatggc gtaatgtctc cggttctagt 15960

cgcaagtatt ctactttatg cgactaaaac acgcgacaag aaaacgccag gaaaagggca 16020

gggcggcagc ctgtcgcgta acttaggact tgtgcgacat gtcgttttca gaagacggct 16080

gcactgaacg tcagaagccg actgcactat agcagcggag gggttggatc aaagtacttt 16140

gatcccgagg ggaaccctgt ggttggcatg cacatacaaa tggacgaacg gataaacctt 16200

ttcacgccct tttaaatatc cgttattcta a 16231

<210>10

<211>20

<212>DNA

<213> Artificial sequence

<400>10

cggagccgac gacgtggaag 20

<210>11

<211>1761

<212>DNA

<213> Artificial sequence

<400>11

atgccggacg gaatgctcgg caaggcggcg ctcgccgtcc ttctcgtgct cgccggcctt 60

gcggccggga ccaggccgcc cccgccgccg gtgtcggagg acacgctgga gaaggtcgcc 120

ggctcgctgg aaatgtacgt cgacaggctc ccccagatgc ccaaggtacg cggctactcc 180

gtggaacgcg gccgcgccac gccggtgcac ctcgccgtcg ggatgtacca aaagaaatgg 240

aaattccacc gcgacctgcc ggcgaccacc gtgttcgtgt tcggagagtc ggcggagagc 300

gccacgttcc ccgggccgac catcgaggcg ctgcaagggg tccctctgtc ggtgacgtgg 360

gagaaccacc tgccggagaa ccacatcctt ccgtgggacc ccaccgtgcc cgtcgccatc 420

cccaggcacg gcggcgtccc gaccgtcgtc cacctccacg gcggcgtcca cccgccgcag 480

tccgacgcca gcgccttcgc atggttcacc gccggcttcc gcgagaccgg cgccaagtgg 540

acgacgccga cgtacgtgta cccgaacgtg cagtcccccg gtgtcctctg gtaccacgac 600

cacgccctcg gcctcacgcg cgccaacctc ctcgccggcc tcctcggcgc ctacgtcatc 660

cgcaatccgg cggtggagtg gccgctcggc ctcccttgcg gcgacgagtt cgaccgcgtg 720

ctcgtgctcg ccgaccgcag cttctatgcc aacggctccc tctacatgaa ctccaccggc 780

gacaacccgc acgtccaccc tcagtggcag cctgagtact tcggcgacgt catcaccgtc 840

aacggcaagg cgtggccgtt ccttcccgtc gcccggcgcc gctaccgctt ccgcgtcatc 900

aacgccagca acgcgcgcta cttcaacctc tcgctgagca acggcctccc cttccacgtc 960

gtcggctccg acaccagcta cctggcccgg ccggtcgccg ccacccacgt cgtcgtcggc 1020

gtgtccgagt cgtttgacgt cgtcatcgac ttctccgacg acgagtccaa cacgcccgag 1080

gtggagctgg tgaacacggc gccgtacccg ttccccgacg gcaacgcgcc gggccgcctc 1140

tccagcaagg tgatgaagtt cgtcatcgaa ccagcgaaga caagggacca ctccagggtg 1200

ccggcgaggc tgctggagta ccacgcgaag gtcgccgagg aagaggcgac aagaaagcga 1260

tacatcgtga tgtacgagta cgacgacggc gcgacgggcg gcccgacgca cctgtacatc 1320

aacgggaagc ggctggagga cccggcgacg gagacgccgc gcgtgggggc gacggaggtg 1380

tgggaggtgg tcaacctcac gccggacgac cacccgctcc acctccatct ggccacgttc 1440

caggcggtgc gcgcccgggg gctggtcggg cttgacgagt tcaggcgctg catggccagg 1500

ctcaacgacg cggccaggtg caacgtgagc cagcacgccg ctggggacgc ggtgggcgtg 1560

ccggagcacg agaggacgtg gaagaacgtg gggaagatgg cgccggggca cgtgacgacg 1620

gcggtggtca agttcctgat ggtggacacc ggcgaggact acccgttcga cgccacggcc 1680

gagcctggct acgtctatca ctgtcacatt ttggatcatg aggacaatgc catgattcgc 1740

ccgctaaagc tcatcagata a 1761

<210>12

<211>1757

<212>DNA

<213> Artificial sequence

<400>12

atgccggacg gaatgctcgg caaggcggcg ctcgccgtcc ttctcgtgct cgccggcctt 60

gcggccggga ccaggccgcc cccgccgccg gtgtcggagg acacgctgga gaaggtcgcc 120

ggctcgctgg aaatgtacgt cgacaggctc ccccagatgc ccaaggtacg cggctactcc 180

gtggaacgcg gccgcgccac gccggtgcac ctcgccgtcg ggatgtacca aaagaaatgg 240

aaattccacc gcgacctgcc ggcgaccacc gtgttcgtgt tcggagagtc ggcggagagc 300

gccacgttcc ccgggccgac catcgaggcg ctgcaagggg tccctctgtc ggtgacgtgg 360

gagaaccacc tgccggagaa ccacatcctt ccgtgggacc ccaccgtgcc cgtcgccatc 420

cccaggcacg gcggcgtccc gaccgtcgtc cacctccacg gcggcgtcca cccgccgcag 480

tccgacgcca gcgccttcgc atggttcacc gccggcttcc gcgagaccgg cgccaagtgg 540

acgacgccga cgtacgtgta cccgaacgtg cagtcccccg gtgtcctctg gtaccacgac 600

cacgccctcg gcctcacgcg cgccaacctc ctcgccggcc tcctcggcgc ctacgtcatc 660

cgcaatccgg cggtggagtg gccgctcggc ctcccttgcg gcgacgagtt cgaccgcgtg 720

ctcgtgctcg ccgaccgcag cttctatgcc aacggctccc tctacatgaa ctccaccggc 780

gacaacccgc acgtccaccc tcagtggcag cctgagtact tcggcgacgt catcaccgtc 840

aacggcaagg cgtggccgtt ccttcccgtc gcccggcgcc gctaccgctt ccgcgtcatc 900

aacgccagca acgcgcgcta cttcaacctc tcgctgagca acggcctccc cttgtcgtcg 960

gctccgacac cagctacctg gcccggccgg tcgccgccac ccacgtcgtc gtcggcgtgt 1020

ccgagtcgtt tgacgtcgtc atcgacttct ccgacgacga gtccaacacg cccgaggtgg 1080

agctggtgaa cacggcgccg tacccgttcc ccgacggcaa cgcgccgggc cgcctctcca 1140

gcaaggtgat gaagttcgtc atcgaaccag cgaagacaag ggaccactcc agggtgccgg 1200

cgaggctgct ggagtaccac gcgaaggtcg ccgaggaaga ggcgacaaga aagcgataca 1260

tcgtgatgta cgagtacgac gacggcgcga cgggcggccc gacgcacctg tacatcaacg 1320

ggaagcggct ggaggacccg gcgacggaga cgccgcgcgt gggggcgacg gaggtgtggg 1380

aggtggtcaa cctcacgccg gacgaccacc cgctccacct ccatctggcc acgttccagg 1440

cggtgcgcgc ccgggggctg gtcgggcttg acgagttcag gcgctgcatggccaggctca 1500

acgacgcggc caggtgcaac gtgagccagc acgccgctgg ggacgcggtg ggcgtgccgg 1560

agcacgagag gacgtggaag aacgtgggga agatggcgcc ggggcacgtg acgacggcgg 1620

tggtcaagtt cctgatggtg gacaccggcg aggactaccc gttcgacgcc acggccgagc 1680

ctggctacgt ctatcactgt cacattttgg atcatgagga caatgccatg attcgcccgc 1740

taaagctcat cagataa 1757

<210>13

<211>4107

<212>DNA

<213> Artificial sequence

<400>13

atggacaaga agtactcgat cggcctcgat attgggacta actctgttgg ctgggccgtg 60

atcaccgacg agtacaaggt gccctcaaag aagttcaagg tcctgggcaa caccgatcgg 120

cattccatca agaagaatct cattggcgct ctcctgttcg acagcggcga gacggctgag 180

gctacgcggc tcaagcgcac cgcccgcagg cggtacacgc gcaggaagaa tcgcatctgc 240

tacctgcagg agattttctc caacgagatg gcgaaggttg acgattcttt cttccacagg 300

ctggaggagt cattcctcgt ggaggaggat aagaagcacg agcggcatcc aatcttcggc 360

aacattgtcg acgaggttgc ctaccacgag aagtacccta cgatctacca tctgcggaag 420

aagctcgtgg actccacaga taaggcggac ctccgcctga tctacctcgc tctggcccac 480

atgattaagt tcaggggcca tttcctgatc gagggggatc tcaacccgga caatagcgat 540

gttgacaagc tgttcatcca gctcgtgcag acgtacaacc agctcttcga ggagaacccc 600

attaatgcgt caggcgtcga cgcgaaggct atcctgtccg ctaggctctcgaagtctcgg 660

cgcctcgaga acctgatcgc ccagctgccg ggcgagaaga agaacggcct gttcgggaat 720

ctcattgcgc tcagcctggg gctcacgccc aacttcaagt cgaatttcga tctcgctgag 780

gacgccaagc tgcagctctc caaggacaca tacgacgatg acctggataa cctcctggcc 840

cagatcggcg atcagtacgc ggacctgttc ctcgctgcca agaatctgtc ggacgccatc 900

ctcctgtctg atattctcag ggtgaacacc gagattacga aggctccgct ctcagcctcc 960

atgatcaagc gctacgacga gcaccatcag gatctgaccc tcctgaaggc gctggtcagg 1020

cagcagctcc ccgagaagta caaggagatc ttcttcgatc agtcgaagaa cggctacgct 1080

gggtacattg acggcggggc ctctcaggag gagttctaca agttcatcaa gccgattctg 1140

gagaagatgg acggcacgga ggagctgctg gtgaagctca atcgcgagga cctcctgagg 1200

aagcagcgga cattcgataa cggcagcatc ccacaccaga ttcatctcgg ggagctgcac 1260

gctatcctga ggaggcagga ggacttctac cctttcctca aggataaccg cgagaagatc 1320

gagaagattc tgactttcag gatcccgtac tacgtcggcc cactcgctag gggcaactcc 1380

cgcttcgctt ggatgacccg caagtcagag gagacgatca cgccgtggaa cttcgaggag 1440

gtggtcgaca agggcgctag cgctcagtcg ttcatcgaga ggatgacgaa tttcgacaag 1500

aacctgccaa atgagaaggt gctccctaag cactcgctcc tgtacgagta cttcacagtc 1560

tacaacgagc tgactaaggt gaagtatgtg accgagggca tgaggaagcc ggctttcctg 1620

tctggggagc agaagaaggc catcgtggac ctcctgttca agaccaaccg gaaggtcacg 1680

gttaagcagc tcaaggagga ctacttcaag aagattgagt gcttcgattc ggtcgagatc 1740

tctggcgttg aggaccgctt caacgcctcc ctggggacct accacgatct cctgaagatc 1800

attaaggata aggacttcct ggacaacgag gagaatgagg atatcctcga ggacattgtg 1860

ctgacactca ctctgttcga ggaccgggag atgatcgagg agcgcctgaa gacttacgcc 1920

catctcttcg atgacaaggt catgaagcag ctcaagagga ggaggtacac cggctggggg 1980

aggctgagca ggaagctcat caacggcatt cgggacaagc agtccgggaa gacgatcctc 2040

gacttcctga agagcgatgg cttcgcgaac cgcaatttca tgcagctgat tcacgatgac 2100

agcctcacat tcaaggagga tatccagaag gctcaggtga gcggccaggg ggactcgctg 2160

cacgagcata tcgcgaacct cgctggctcg ccagctatca agaaggggat tctgcagacc 2220

gtgaaggttg tggacgagct ggtgaaggtc atgggcaggc acaagcctga gaacatcgtc 2280

attgagatgg cccgggagaa tcagaccacg cagaagggcc agaagaactc acgcgagagg 2340

atgaagagga tcgaggaggg cattaaggag ctggggtccc agatcctcaa ggagcacccg 2400

gtggagaaca cgcagctgca gaatgagaag ctctacctgt actacctcca gaatggccgc 2460

gatatgtatg tggaccagga gctggatatt aacaggctca gcgattacga cgtcgatcat 2520

atcgttccac agtcattcct gaaggatgac tccattgaca acaaggtcct caccaggtcg 2580

gacaagaacc ggggcaagtc tgataatgtt ccttcagagg aggtcgttaa gaagatgaag 2640

aactactggc gccagctcct gaatgccaag ctgatcacgc agcggaagtt cgataacctc 2700

acaaaggctg agaggggcgg gctctctgag ctggacaagg cgggcttcat caagaggcag 2760

ctggtcgaga cacggcagat cactaagcac gttgcgcaga ttctcgactc acggatgaac 2820

actaagtacg atgagaatga caagctgatc cgcgaggtga aggtcatcac cctgaagtca 2880

aagctcgtct ccgacttcag gaaggatttc cagttctaca aggttcggga gatcaacaat 2940

taccaccatg cccatgacgc gtacctgaac gcggtggtcg gcacagctct gatcaagaag 3000

tacccaaagc tcgagagcga gttcgtgtac ggggactaca aggtttacga tgtgaggaag 3060

atgatcgcca agtcggagca ggagattggc aaggctaccg ccaagtactt cttctactct 3120

aacattatga atttcttcaa gacagagatc actctggcca atggcgagat ccggaagcgc 3180

cccctcatcg agacgaacgg cgagacgggg gagatcgtgt gggacaaggg cagggatttc 3240

gcgaccgtca ggaaggttct ctccatgcca caagtgaata tcgtcaagaa gacagaggtc 3300

cagactggcg ggttctctaa ggagtcaatt ctgcctaagc ggaacagcga caagctcatc 3360

gcccgcaaga aggactggga tccgaagaag tacggcgggt tcgacagccc cactgtggcc 3420

tactcggtcc tggttgtggc gaaggttgag aagggcaagt ccaagaagct caagagcgtg 3480

aaggagctgc tggggatcac gattatggag cgctccagct tcgagaagaa cccgatcgat 3540

ttcctggagg cgaagggcta caaggaggtg aagaaggacc tgatcattaa gctccccaag 3600

tactcactct tcgagctgga gaacggcagg aagcggatgc tggcttccgc tggcgagctg 3660

cagaagggga acgagctggc tctgccgtcc aagtatgtga acttcctcta cctggcctcc 3720

cactacgaga agctcaaggg cagccccgag gacaacgagc agaagcagct gttcgtcgag 3780

cagcacaagc attacctcga cgagatcatt gagcagattt ccgagttctc caagcgcgtg 3840

atcctggccg acgcgaatct ggataaggtc ctctccgcgt acaacaagca ccgcgacaag 3900

ccaatcaggg agcaggctga gaatatcatt catctcttca ccctgacgaa cctcggcgcc 3960

cctgctgctt tcaagtactt cgacacaact atcgatcgca agaggtacac aagcactaag 4020

gaggtcctgg acgcgaccct catccaccag tcgattaccg gcctctacga gacgcgcatc 4080

gacctgtctc agctcggggg cgactga 4107

Claims (9)

1. A pBUE411-LPR2 binary vector with the function of knocking out LPR2 gene is characterized by comprising an expression cassette A and an expression cassette B;

the expression cassette A specifically comprises the following elements from upstream to downstream in sequence: the TaU3 promoter A from wheat, the sgRNA of the LPR2 gene and the terminator A;

the expression cassette B specifically comprises the following elements from upstream to downstream in sequence: the promoter B, the maize Cas9 coding sequence, the terminator B.

2. The pBUE411-LPR2 binary vector of claim 1, wherein the DNA sequence of sgRNA of LPR2 gene is shown as sequence SEQ 10; the maize Cas9 coding sequence is shown in SEQ 13; the sequence of the promoter A is shown as SEQ 3;

the promoter B sequence is shown as SEQ 4; the terminator A sequence is shown as SEQ 5; the terminator B sequence is shown as SEQ 6.

3. The pBUE411-LPR2 binary vector of claim 1, wherein the expression cassette A sequence is specifically set forth in SEQ 7;

the sequence of the expression cassette B is specifically shown as SEQ 8;

the expression cassette A is located at the upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.

4. The pBUE411-LPR2 binary vector of claim 2, further comprising a resistance marker gene; the nucleotide sequence of the pBUE411-LPR2 binary vector is shown in SEQ 9.

5. The method for constructing the binary vector pBUE411-LPR2 according to claim 1, comprising the steps of:

s11, designing sgRNA of a targeting LPR2 gene, wherein primers corresponding to oligonucleotides of the sgRNA are LPR2-gR1-TaU3-F shown in SEQ1 and LPR2-gR1-TaU3-R shown in SEQ 2;

s12 phosphorylates and anneals 2 oligos of the synthesized sgRNA to form double chains;

s13, utilizing restriction enzyme BsaI to cut the pBUE411 vector, and recovering vector fragments containing the promoter A, the terminator A, the promoter B and the terminator B;

s14 the recovered pBUE411 carrier fragment and double-stranded sgRNA with sticky ends are connected by T4 ligase to obtain the final pBUE411-LPR2 binary carrier.

6. A transformant comprising the pBUE411-LPR2 binary vector of any one of claims 1-5.

7. The use of the pBUE411-LPR2 binary vector of any one of claims 1-5 to increase phosphorus utilization in wheat.

8. Use of the pBUE411-LPR2 binary vector of claims 1-5 in breeding transgenic wheat.

9. A method for improving phosphorus utilization rate of wheat by using gene editing is characterized by comprising the following steps: the function of the wheat LPR2 gene is reduced or lost, and the expression and/or activity of the protein coded by the wheat LPR2 gene is inhibited, so that the phosphorus utilization rate of the wheat is improved;

the method for reducing or losing the function of wheat LPR2 gene is to construct pBUE411-LPR2 binary vector as described in any one of claims 1-5.

Images