CN111269934A - Method for improving phosphorus utilization rate of wheat by using gene editing - Google Patents

Method for improving phosphorus utilization rate of wheat by using gene editing Download PDF

Info

Publication number
CN111269934A
CN111269934A CN202010299274.0A CN202010299274A CN111269934A CN 111269934 A CN111269934 A CN 111269934A CN 202010299274 A CN202010299274 A CN 202010299274A CN 111269934 A CN111269934 A CN 111269934A
Authority
CN
China
Prior art keywords
lpr2
gene
pbue411
sequence
wheat
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202010299274.0A
Other languages
Chinese (zh)
Other versions
CN111269934B (en
Inventor
李根英
张荣志
张淑娟
李玉莲
宋国琦
高洁
李玮
李吉虎
刘敏
陈明丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CROP Research Institute of Shandong Academy of Agricultural Sciences
Original Assignee
CROP Research Institute of Shandong Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CROP Research Institute of Shandong Academy of Agricultural Sciences filed Critical CROP Research Institute of Shandong Academy of Agricultural Sciences
Publication of CN111269934A publication Critical patent/CN111269934A/en
Application granted granted Critical
Publication of CN111269934B publication Critical patent/CN111269934B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213Targeted insertion of genes into the plant genome by homologous recombination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases RNAses, DNAses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a method for improving the phosphorus utilization rate of wheat by using gene editing. According to the invention, through the design of the specific guide single-chain sgRNA, an expression vector capable of realizing in vivo editing of LPR2 gene is constructed, and the LPR2 gene of wheat can be knocked out, so that silencing of LPR2 gene at genome level is realized, the phosphorus utilization rate of wheat is improved, and transgenic wheat is cultivated.

Description

Method for improving phosphorus utilization rate of wheat by using gene editing
Technical Field
The invention relates to a method for improving the phosphorus utilization rate of wheat by using gene editing, and relates to the field of gene editing.
Background
Phosphorus is one of the major elements necessary for plant growth and development. It is a main component of nucleic acid, nucleoprotein, phospholipid, adenosine triphosphate, etc. of plants, and also plays an important role in energy metabolism, photosynthesis, respiration, regulation of enzyme activity, redox reaction, signal transduction, carbon metabolism, etc. The lack of phosphorus can affect the formation of nucleoprotein, inhibit cell division and proliferation, reduce protein synthesis, block the transportation of sugar, finally cause the branch of the plant to be less, the stem and the root to be slender, the plant to be short and small, the flower and fruit to be easy to fall off and reduce the yield, etc. The growth and output capacity of plants are obviously dependent on the effectiveness of inorganic phosphorus (Pi), but the content of effective phosphorus in most soil is very low and is only 1-10 mu mol/L. Although the organic phosphorus in the soil can reach 80 percent, the organic phosphorus cannot be absorbed by plants, and the organic phosphorus must be converted into inorganic phosphorus before being absorbed and utilized (Schachtman et al, 1998; Holford, 1997). In agricultural production, phosphate fertilizer is commonly added to ensure normal growth and development of crops, and the global easy-to-harvest phosphate rock resource faces a crisis that has been eliminated in this century (Gilbert, 2009; Vance et al, 2003).
Wheat is an important food crop in China, and how to cultivate a low-fertilizer high-yield environment-friendly wheat variety is a great challenge for wheat breeders. Plants have developed mechanisms to cope with the severe deficiency of available phosphorus in the agricultural natural ecosystem over a long period of evolution. Therefore, the gene for fully exploiting the phosphorus with high efficiency in the wheat has important guiding significance for improving the molecular breeding with low phosphorus, high efficiency, environmental friendliness and sustainable yield increase.
Under Low phosphorus stress, the growth of the main Root of arabidopsis thaliana is inhibited, and in an arabidopsis thaliana mutant with LPR1(Low phosphorate Root1) losing function, the growth of the main Root is normal. LPR1 encodes multicopper oxidases (multicopper oxidases) and controls the growth of the main roots by regulating the expression levels of scr (scarecrow) and SHR (Short-root), which slow down growth and increase the number and length of lateral roots under low phosphorus stress (svistonoff et al, 2007). Homologous genes of these genes can be found in rice, maize, wheat, sword bean and white lupin, suggesting that root architecture changes in plants that respond to low phosphorus stress may have similar regulatory pathways.
Disclosure of Invention
The invention overcomes the defects of the prior art and provides a method for improving the phosphorus utilization rate of wheat by using gene editing. The method constructs an expression vector pBUE411-LPR2 with the function of knocking out LPR2 gene, and reduces the expression level of LPR2 gene through gene transformation process.
A method for improving phosphorus utilization rate of wheat by using gene editing comprises the following steps: the function of the wheat LPR2 gene is reduced or lost, and the expression and/or activity of the protein coded by the wheat LPR2 gene is inhibited, so that the phosphorus utilization rate of the wheat is improved.
Furthermore, the method for reducing or losing the function of the wheat LPR2 gene in the method is to construct a pBUE411-LPR2 binary vector with the function of knocking out LPR2 gene.
The pBUE411-LPR2 binary vector with the function of knocking out LPR2 gene comprises an expression cassette A and an expression cassette B; the expression cassette A specifically comprises the following elements from upstream to downstream in sequence: the TaU3 promoter A from wheat, the sgRNA of the LPR2 gene and the terminator A; the expression cassette B specifically comprises the following elements from upstream to downstream in sequence: the promoter B, the maize Cas9 coding sequence, the terminator B.
Further, the sgRNA sequence of the LPR2 gene is shown as a sequence SEQ 10; the maize Cas9 coding sequence is shown in SEQ 13; the sequence of the promoter A is shown as SEQ 3; the promoter B sequence is shown as SEQ 4; the terminator A sequence is shown as SEQ 5; the terminator B sequence is shown as SEQ 6.
Further, the sequence of the expression cassette A is specifically shown as SEQ 7; the sequence of the expression cassette B is specifically shown as SEQ 8; the expression cassette A is located at the upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.
Further, the pBUE411-LPR2 binary vector also contains a resistance marker gene, such as a bar gene; the nucleotide sequence of the pBUE411-LPR2 binary vector is shown in SEQ 9.
Further, the construction method of the pBUE411-LPR2 binary vector comprises the following steps:
s11 designs sgRNA targeting LPR2 gene, the oligonucleotides of sgRNA are corresponding to LPR2-gR1-TaU3-F and LPR2-gR1-TaU3-R, namely the sequence of LPR2-gR1-TaU3-F is shown in SEQ1, and the sequence of LPR2-gR1-TaU3-R is shown in SEQ 2;
s12 phosphorylates and anneals 2 oligos of the synthesized sgRNA to form double chains;
s13, utilizing restriction enzyme BsaI to cut the pBUE411 vector, and recovering vector fragments containing the promoter A, the terminator A, the promoter B and the terminator B;
s14 the recovered pBUE411 carrier fragment and double-stranded sgRNA with sticky ends are connected by T4 ligase to obtain the final pBUE411-LPR2 binary carrier.
The transformant containing the pBUE411-LPR2 binary vector also belongs to the protection scope of the invention.
The pBUE411-LPR2 binary vector is applied to improving the utilization rate of wheat phosphorus.
The pBUE411-LPR2 binary vector is applied to cultivation of transgenic wheat; compared with the wheat before transgenosis, the phosphorus utilization rate of the transgenic wheat is improved.
The invention also protects the following DNA fragment I:
the DNA fragment I consists of guide sgRNA of LPR2 gene, and the sequence of the DNA fragment I can be specifically shown as sequence SEQ 10.
Has the advantages that:
according to the invention, through the design of the specific guide single-chain sgRNA, an expression vector capable of realizing in-vivo editing of LPR2 gene is constructed, and the wheat LPR2 gene can be knocked out. The LPR2 gene is located on 4A, 4B and 4D of chromosome IV in wheat and is named TaLPR2-4A, TaLPR2-4B and TaLPR2-4D respectively. The genome sequence is 1972, 1957 and 1940 bases in the whole length of 4A, 4B and 4D, and the three homologous genes are composed of 3 exons and 2 introns. TaLPR2-4A, TaLPR2-4B and TaLPR2-4D contain 1761, 1761 and 1746 base open reading frames, respectively, encoding a segment of polypeptide chain containing 587, 587 and 582 amino acid residues, respectively. Based on this genetic information, we cloned the TalPR2-4A gene in Fielder using homologous cloning and submitted it to NCBI under GenBank accession number MK 676068. The similarity of the coding regions among the three homologous genes is very high, and the characteristic provides a theoretical basis for synchronously silencing the TaLPR2 gene of the three sites by using a gene editing technology.
In practical application, the gene conversion process can realize the silencing of LPR2 gene at genome level, and is a powerful tool for improving the utilization rate of phosphorus in wheat by using genetic engineering technology.
Drawings
FIG. 1 the coding region of the LPR2 gene.
FIG. 2 restriction electrophoresis of the vector BsaI pBUE 411.
FIG. 3 shows the sequencing result of the CRISPR/Cas9 recombinant vector pBUE411-LPR2 targeting LPR2 gene.
FIG. 4Bar test strip test transgenic wheat plants.
FIG. 5 deduced amino acid sequence of wild type wheat LPR2 gene.
FIG. 6 deduced amino acid sequence of mutant wheat LPR2 gene.
FIG. 7 alignment chart of CDS sequences of LPR2 gene of wild type and mutant type.
FIG. 8 alignment of deduced amino acid sequences of wild-type and mutant LPR2 genes.
Detailed Description
The experimental procedures used in the following examples, unless otherwise specified, were all purchased from conventional biochemical stores, the quantitative tests in the following examples, were set up in triplicate, the results were averaged, the high fidelity enzyme required for PCR amplification, the T4 ligase required for DNA fragment ligation, the gel recovery kit required for enzyme fragment recovery, and the plasmid extraction kit were purchased from Dalianbao Bio Inc., the plasmid extraction kit was purchased from Tiangen, the inorganic salts required for medium formulation were purchased from the national drug group, the vitamins and antibiotics, and hormones were purchased from Sigma, the plant CRISPR/Cas9 gene editing vector is pBUE411, contains the wheat U3 promoter TaU3 to initiate sgRNA, the Cas9p simulates the gramineous plant gene as having a high GC content at the 5' end, which is a codon optimized for the plant designed and synthesized, and the strain E.coli 5 α.
Reagents such as T4 ligase and DNA Marker DL2000 are purchased from Takara, Fastpfu, 2 Taq Mix, DH5 α are purchased from Beijing Quanjin, restriction enzyme BsaI-HF is purchased from NEB, and the used primers are synthesized by Qingdao Kagaku Xixi Biotechnology Limited and have the following sequences:
TABLE 1 primers used in this study
Figure BDA0002453368250000021
Figure BDA0002453368250000031
The wheat variety Jw1 is a new germplasm with good tissue culture capability self-bred by crops of agricultural academy of Shandong province, and can be obtained by the public from the crop research institute of agricultural academy of Shandong province.
Plasmid pBUE411(17430bp) was supplied by the Sunzhou project group of Chinese university of agriculture; the public is available from the university of agriculture in China.
Experimental example 1 construction of expression vector
1. Design of sgrnas targeting LPR2
The sequence of LPR2 gene was amplified in wheat variety Fielder, the amplified sequence is shown in FIG. 1, the underlined sequence is sgRNA sequence targeting LPR2 gene, the three-digit sequence after the underlined is labeled PAM sequence, and is 100% similar to the gene sequence of wheat in NCBI database. The gene has total length of 1761 basic groups, 1 suitable targeting site is searched for in a coding region of LPR2 gene through a website CRISPRDIRect (http:// crispr. dbcls. jp /), a 20bp sequence fragment is found in front of a PAM structure and is set as a target sequence, and a sgRNA sequence is selected as CGGAGCCGACGACGTGGAAG.
Annealing of sgRNA and formation of double strands
The 2 oligos of sgRNA of LPR2 gene were synthesized by Hippocastanaceae Biotechnology Inc., where the oligonucleotides of sgRNA corresponded to LPR2-gR1-TaU3-F and LPR2-gR1-TaU3-R (Table 1), and the underlined base portions in the primers matched to the sequences in pBUE411 vector. Respectively phosphorylating 2 oligos of the sgRNA, and directly annealing to form double chains, wherein the system is as follows: LPR2-gR1-TaU3-F (10. mu.M): 4 μ L, LPR2-gR1-TaU3-R (10 uM): 4 μ L,10 XT 4 PNKbuffer:1.5 μ L, PNK:1 μ L, ATP:1 μ L, ddH2O make up to 15. mu.L. The program was run in a PCR instrument under the following conditions: 30min at 37 ℃; 95 ℃ for 5 min; ramp to 25 ℃ at5 ℃/min (0.08 ℃/s). Or boiling in boiling water for 5min, and naturally cooling to room temperature.
Linearization of the pBUE411 vector
The pBUE411 carrier is cut by the endonuclease of BsaI for 3h as shown in the figure 2, and 1 is that the pBUE411 is cut by the BsaI; 2 is DL2000 Marker; 3 is a Marker of 1kb, linear vector fragments are recovered after electrophoresis, and vector fragments containing the promoter A, the terminator A, the promoter B and the terminator B are recovered; .
Ligation of the pBUE411 vector with sgRNA
The linking reaction system is:5×ligation Buffer 2μL,annealed oligo duplex 4μL,pBUE411/BsaI 2ul(100ng),T4 ligase1μL,ddH2O to 10. mu.L, and ligation was performed at 25 ℃ for 30 min.
5. Verification of transformation
The ligation product is transformed into escherichia coli, the recombinant plasmid is transformed into DH5 α competent cells, then the cells are cultured on an LB (Kan) plate until clones grow out, a single clone is selected for carrying out bacteria liquid PCR identification and sequencing, the primers are pBUE411-F and pBUE411-R, sequencing results (shown in figure 3) detect target sequences of sgRNA, meanwhile TaU3 promoter sequences are detected at the upstream of the target sequences, the sequencing results show that the sgRNA expression cassette is successfully constructed and successfully assembled into a pBUE411 binary expression vector, and the construction success of a CRISPR/Cas9 gene editing vector of TaLPR2 is proved.
Experimental example 2 transformation of Gene editing vector into common wheat
1. Preparing a culture medium: see Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol.1223DOI10.007/978-1-4939-
2. And (3) agrobacterium transformation: taking wheat ears pollinated for about 15 days, taking grains and stripping embryos. The agrobacterium suspension is shaken one day before the test, cultured at 160r and 28 ℃ for 24 hours, after the ear is prepared, 1ml of the agrobacterium suspension is prepared, and 1.4ul of acetosyringone (0.1M) is added into a 1.5ml centrifuge tube and mixed evenly. Adding prepared bacterial liquid for infection for 5 minutes, placing on a co-culture medium, and performing dark culture at 23 ℃ for 3 days. After co-culture, the cells were placed on a resting medium for dark culture for 5 days at 25 ℃. The calli were transferred to selection medium 1. The petri dish was sealed with a sealing film and cultured in a 25.5 degree incubator for 2 weeks in the dark. The calli were cut and transferred to selection medium 2.
The petri dish was sealed with a sealing film and cultured in a 25.5 degree incubator for 2 weeks in the dark. After 2 weeks of callus excision screening, resistant calli were transferred to regeneration medium. The resistant calli generally have green buds or dots, or have beautiful beige globular structures.
Pasty and brown callus did not transfer. The proliferated calli can be cut into smaller calli again. The patches from the same callus should be re-laid on the same line. Note the direction of the calli, e.g., green bud and green dot up.
The culture dish is sealed and put into a 25-degree incubator for 2 weeks under illumination (16 h). After 2 weeks of regeneration, healthy growing plantlets were transferred to new resistant regeneration pods. When the seedlings grow to a certain size, sampling detection can be carried out.
3. Mutant detection of transgenic seedlings
3.1T 0 generation transgenic line positive identification and mutant screening
As the T-DNA area of the vector used for the transformation is provided with three expression frames of cas9, bar and gRNA, the expression detection of the bar gene is mature, a commercial detection reagent strip is provided, and a sample can be judged whether to carry the bar gene within 10 minutes after coarse grinding by using the reagent strip, so that the method is faster and more efficient than PCR amplification. Therefore, we used the bar gene detection kit quickstix with the non-transgenic plants as negative controlsTMThe transgenic wheat T0 plant is detected by the following specific operations:
taking 3-5cm of transgenic seedling, placing into a 1.5m centrifuge tube, grinding with a grinding rod, adding 500 μ L Buffer, inserting Bar test strip, standing for 5min, recording data according to the number of bands displayed by the test strip, wherein 2 bands represent positive, and 1 band represents negative. The kit was purchased from maitsen technologies ltd.
The result of screening positive transgenic seedlings is shown in fig. 4, samples 1-8 are T0 generation regenerated seedlings, 9 is a positive control, and 10 is a negative control, wherein two strips appear in samples 1,3,4, 5, 6,7, and 8, the result is consistent with the result of the positive control 9, and the positive transgenic seedlings are positive seedlings; 1 to 8 respectively represent LPR2-01, -02, -03, -04, -05, 06, -07, -08.
Specific amplification and mutant identification of DA2 gene of transgenic plant of generation 3.2T 0
Whether the target gene editing is successful or not needs sequencing for identification, and the Hi-TOM gene editing site detection kit produced by Tianjinnuo grass genesis company is adopted in the experiment. The kit automatically completes the high-throughput library building process by a PCR method, and directly analyzes the variation information of multiple samples and multiple sites by using Hi-TOM online software. Specific primers (Primer-F and Primer-R in Table 1) on both sides of the target sequence are used for amplifying LPR2, and amplified products are sent to a Nordhea nucleic acid source for sequencing after being subjected to library building. The wild type nucleotide sequence of the wheat LPR2 gene of interest is shown as SEQ11, the deduced amino acid sequence is shown as FIG. 5, the nucleotide sequence of the target gene of the mutant is shown as SEQ12, the deduced amino acid sequence is shown as FIG. 6, the alignment shows that the nucleotide of LPR2-2 at +954 lacks 4 bases CCAC (the first part is marked by underline and arrow), TGA (the second part is marked by underline and arrow) appears at +1087 of the mutant sequence, the TGA becomes a stop codon, which causes premature termination of protein translation, the alignment of the nucleotide sequences is shown as FIG. 7, the part marked by bold underline and arrow is the part where the wild type and the mutant are different, the alignment of the amino acid sequences is shown as FIG. 8, and the part marked by underline and arrow is the part where the wild type and the mutant are different.
First round PCR reaction System: mu.L of pBUE411-LPR2 transgenic wheat plant leaf DNA was used as a template, and 2 XTAQA Master Mix 10. mu.L, Primer-F and Primer-R (Table 1) (10. mu.M) in the kit were each 0.5. mu.L, and nucleic-free Water was supplemented to 20. mu.L. The PCR reaction conditions are as follows: denaturation at 94 deg.C for 2 min; denaturation at 94 ℃ for 30s, renaturation at 65 ℃ for 30s, and extension at 72 ℃ for 20s for 33 cycles; finally, extension is carried out for 5min at 72 ℃. After the PCR is finished, 5 mu L of agarose gel electrophoresis is taken to detect the PCR product, so that the existence of the target product is ensured and the specificity is good. Then, a second round of PCR reaction was performed, in which 12. mu.L of Hi-TOM Mix in the kit was added to make up the volume to 20. mu.L using the first round of PCR product as a template, and 1. mu.L of nucleic-free Water was added. PCR reaction procedure: denaturation at 94 deg.C for 2 min; denaturation at 94 ℃ for 30s, renaturation at 57 ℃ for 30s, and extension at 72 ℃ for 25s for 33 cycles; finally, extension is carried out for 5min at 72 ℃.
Phenotypic characterization of 4 Low phosphorus treatment in Gene editing Material and control Material
Placing the wheat seeds which are not subjected to transgenic field material and gene editing material TalPR-6 in a culture dish, adding a proper amount of water, accelerating germination for 15-18 h in a germination box, placing the seeds on a self-made seedling development net for growth for 6 days after the seeds are exposed to the white, selecting the uniform seedlings, transferring the seedlings to a culture box, and starting nutrient solution culture. Wheat seedling culture conditionsThe temperature is 21 +/-1) DEG C, the humidity is 50-60%, and the light intensity is 150-200 mu mol/(cm2 & s). Changing the nutrient solution every 3 days, continuously culturing for 18 days, and investigating the seedling stage characters. The water culture adopts a Hoagland nutrient solution formula and KH under a contrast condition2PO4KH at a concentration of 200. mu. mol/L under low-phosphorus conditions2PO4The concentration was 5. mu. mol/L. Each treatment was set to 6 replicates, each replicate having about 20 wheat seedlings.
In the control test CK, the mean shoot lengths of the non-transgenic Fielder material and the gene editing material TaLPR-6 were 41.32cm and 41.54cm, respectively (Table 2), with no significant difference in statistical tests; in the low-phosphorus treatment test, the mean seedling lengths of the non-transgenic Fielder material and the gene editing material TaLPR-6 were 37.77cm and 40.07cm, respectively (table 2), and the statistically tested P-value was less than 2.2e-16, reaching a significant difference level.
TABLE 2. seedling length of non-transgenic Fielder material and gene editing material TaLPR-6 after low phosphorous treatment.
Figure BDA0002453368250000041
In the control test CK, the average values of the fresh aerial weight of the non-transgenic Fielder material and the gene editing material TaLPR-6 were 695.63mg and 696.33mg, respectively (table 3), with no significant difference in statistical test; in the low phosphorus treatment test, the average values of the fresh weights of the overground parts of the non-transgenic Fielder material and the gene editing material TaLPR-6 are 561.03mg and 690.77mg respectively (table 3), and the statistically tested P-value is less than 2.2e-16, which reaches a significant difference level.
TABLE 3 fresh weight of aerial parts of non-transgenic Fielder material and gene editing material TaLPR-6 after low phosphorous treatment.
Figure BDA0002453368250000051
SEQUENCE LISTING
<110> institute of agricultural sciences of Shandong province
<120> method for improving phosphorus utilization rate of wheat by using gene editing
<130>2019
<160>13
<170>PatentIn version 3.3
<210>1
<211>25
<212>DNA
<213> Artificial sequence
<400>1
ggcgagtctt acttgtggct cgagt 25
<210>2
<211>25
<212>DNA
<213> Artificial sequence
<400>2
aaacactcga gccacaagta agact 25
<210>3
<211>527
<212>DNA
<213> Artificial sequence
<400>3
catgaatcca aaccacacgg agttcaaatt cccacagatt aaggctcgtc cgtcgcacaa 60
ggtaatgtgt gaatattata tctgtcgtgc aaaattgcct ggcctgcaca attgctgtta 120
tagttggcgg cagggagagt tttaacattg actagcgtgc tgataatttg tgagaaataa 180
taattgacaa gtagatactg acatttgaga agagcttctg aactgttatt agtaacaaaa 240
atggaaagct gatgcacgga aaaaggaaag aaaaagccat actttttttt aggtaggaaa 300
agaaaaagcc atacgagact gatgtctctc agatgggccg ggatctgtct atctagcagg 360
cagcagccca ccaacctcac gggccagcaa ttacgagtcc ttctaaaagc tcccgccgag 420
gggcgctggc gctgctgtgc agcagcacgt ctaacattag tcccacctcg ccagtttaca 480
gggagcagaa ccagcttata agcggaggcg cggcaccaag aagcggc 527
<210>4
<211>1992
<212>DNA
<213> Artificial sequence
<400>4
ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60
agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120
tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180
tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240
gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300
ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360
gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420
agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480
taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540
aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600
cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660
cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720
acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780
ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg 840
ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 900
tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 960
ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct 1020
tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 1080
tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 1140
tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 1200
atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 1260
gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 1320
tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 1380
agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 1440
gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 1500
ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 1560
gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 1620
aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 1680
catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 1740
ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 1800
ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 1860
gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 1920
atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 1980
ttacttctgc ag 1992
<210>5
<211>291
<212>DNA
<213> Artificial sequence
<400>5
tttttttttt cgttttgcat tgagttttct ccgtcgcatg tttgcagttt tattttccgt 60
tttgcattga aatttctccg tctcatgttt gcagcgtgtt caaaaagtac gcagctgtat 120
ttcacttatt tacggcgcca cattttcatg ccgtttgtgc caactatccc gagctagtga 180
atacagcttg gcttcacaca acactggtga cccgctgacc tgctcgtacc tcgtaccgtc 240
gtacggcaca gcatttggaa ttaaagggtg tgatcgatac tgcttgctgc t 291
<210>6
<211>571
<212>DNA
<213> Artificial sequence
<400>6
aagcggccag cggcgacgaa gaaggcgggg caggcgaaga agaagaagtg agctcagagc 60
tttcgttcgt atcatcggtt tcgacaacgt tcgtcaagtt caatgcatca gtttcattgc 120
gcacacacca gaatcctact gagtttgagt attatggcat tgggaaaact gtttttcttg 180
taccatttgt tgtgcttgta atttactgtg ttttttattc ggttttcgct atcgaactgt 240
gaaatggaaa tggatggaga agagttaatg aatgatatgg tccttttgtt cattctcaaa 300
ttaatattat ttgttttttc tcttatttgt tgtgtgttga atttgaaatt ataagagata 360
tgcaaacatt ttgttttgag taaaaatgtg tcaaatcgtg gcctctaatg accgaagtta 420
atatgaggag taaaacactt gtagttgtac cattatgctt attcactagg caacaaatat 480
attttcagac ctagaaaagc tgcaaatgtt actgaataca agtatgtcct cttgtgtttt 540
agacatttat gaactttcct ttatgtaatt t 571
<210>7
<211>916
<212>DNA
<213> Artificial sequence
<400>7
catgaatcca aaccacacgg agttcaaatt cccacagatt aaggctcgtc cgtcgcacaa 60
ggtaatgtgt gaatattata tctgtcgtgc aaaattgcct ggcctgcaca attgctgtta 120
tagttggcgg cagggagagt tttaacattg actagcgtgc tgataatttg tgagaaataa 180
taattgacaa gtagatactg acatttgaga agagcttctg aactgttatt agtaacaaaa 240
atggaaagct gatgcacgga aaaaggaaag aaaaagccat actttttttt aggtaggaaa 300
agaaaaagcc atacgagact gatgtctctc agatgggccg ggatctgtct atctagcagg 360
cagcagccca ccaacctcac gggccagcaa ttacgagtcc ttctaaaagc tcccgccgag 420
gggcgctggc gctgctgtgc agcagcacgt ctaacattag tcccacctcg ccagtttaca 480
gggagcagaa ccagcttata agcggaggcg cggcaccaag aagcggcgag agcatgtcgt 540
aggggcgccg ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact 600
tgaaaaagtg gcaccgagtc ggtgcttttt tttttcgttt tgcattgagt tttctccgtc 660
gcatgtttgc agttttattt tccgttttgc attgaaattt ctccgtctca tgtttgcagc 720
gtgttcaaaa agtacgcagc tgtatttcac ttatttacgg cgccacattt tcatgccgtt 780
tgtgccaact atcccgagct agtgaataca gcttggcttc acacaacact ggtgacccgc 840
tgacctgctc gtacctcgta ccgtcgtacg gcacagcatt tggaattaaa gggtgtgatc 900
gatactgctt gctgct 916
<210>8
<211>6799
<212>DNA
<213> Artificial sequence
<400>8
ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60
agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120
tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180
tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240
gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300
ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360
gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420
agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480
taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540
aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600
cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660
cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720
acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780
ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg 840
ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 900
tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 960
ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct 1020
tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 1080
tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 1140
tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 1200
atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 1260
gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 1320
tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 1380
agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 1440
gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 1500
ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 1560
gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 1620
aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 1680
catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 1740
ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 1800
ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 1860
gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 1920
atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 1980
ttacttctgc agccctaggc ctactagatg gattacaagg accacgacgg ggattacaag 2040
gaccacgaca ttgattacaa ggatgatgat gacaagatgg ctccgaagaa gaagaggaag 2100
gttggcatcc acggggtgcc agctgctgac aagaagtact cgatcggcct cgatattggg 2160
actaactctg ttggctgggc cgtgatcacc gacgagtaca aggtgccctc aaagaagttc 2220
aaggtcctgg gcaacaccga tcggcattcc atcaagaaga atctcattgg cgctctcctg 2280
ttcgacagcg gcgagacggc tgaggctacg cggctcaagc gcaccgcccg caggcggtac 2340
acgcgcagga agaatcgcat ctgctacctg caggagattt tctccaacga gatggcgaag 2400
gttgacgatt ctttcttcca caggctggag gagtcattcc tcgtggagga ggataagaag 2460
cacgagcggc atccaatctt cggcaacatt gtcgacgagg ttgcctacca cgagaagtac 2520
cctacgatct accatctgcg gaagaagctc gtggactcca cagataaggc ggacctccgc 2580
ctgatctacc tcgctctggc ccacatgatt aagttcaggg gccatttcct gatcgagggg 2640
gatctcaacc cggacaatag cgatgttgac aagctgttca tccagctcgt gcagacgtac 2700
aaccagctct tcgaggagaa ccccattaat gcgtcaggcg tcgacgcgaa ggctatcctg 2760
tccgctaggc tctcgaagtc tcggcgcctc gagaacctga tcgcccagct gccgggcgag 2820
aagaagaacg gcctgttcgg gaatctcatt gcgctcagcc tggggctcac gcccaacttc 2880
aagtcgaatt tcgatctcgc tgaggacgcc aagctgcagc tctccaagga cacatacgac 2940
gatgacctgg ataacctcct ggcccagatc ggcgatcagt acgcggacct gttcctcgct 3000
gccaagaatc tgtcggacgc catcctcctg tctgatattc tcagggtgaa caccgagatt 3060
acgaaggctc cgctctcagc ctccatgatc aagcgctacg acgagcacca tcaggatctg 3120
accctcctga aggcgctggt caggcagcag ctccccgaga agtacaagga gatcttcttc 3180
gatcagtcga agaacggcta cgctgggtac attgacggcg gggcctctca ggaggagttc 3240
tacaagttca tcaagccgat tctggagaag atggacggca cggaggagct gctggtgaag 3300
ctcaatcgcg aggacctcct gaggaagcag cggacattcg ataacggcag catcccacac 3360
cagattcatc tcggggagct gcacgctatc ctgaggaggc aggaggactt ctaccctttc 3420
ctcaaggata accgcgagaa gatcgagaag attctgactt tcaggatccc gtactacgtc 3480
ggcccactcg ctaggggcaa ctcccgcttc gcttggatga cccgcaagtc agaggagacg 3540
atcacgccgt ggaacttcga ggaggtggtc gacaagggcg ctagcgctca gtcgttcatc 3600
gagaggatga cgaatttcga caagaacctg ccaaatgaga aggtgctccc taagcactcg 3660
ctcctgtacg agtacttcac agtctacaac gagctgacta aggtgaagta tgtgaccgag 3720
ggcatgagga agccggcttt cctgtctggg gagcagaaga aggccatcgt ggacctcctg 3780
ttcaagacca accggaaggt cacggttaag cagctcaagg aggactactt caagaagatt 3840
gagtgcttcg attcggtcga gatctctggc gttgaggacc gcttcaacgc ctccctgggg 3900
acctaccacg atctcctgaa gatcattaag gataaggact tcctggacaa cgaggagaat 3960
gaggatatcc tcgaggacat tgtgctgaca ctcactctgt tcgaggaccg ggagatgatc 4020
gaggagcgcc tgaagactta cgcccatctc ttcgatgaca aggtcatgaa gcagctcaag 4080
aggaggaggt acaccggctg ggggaggctg agcaggaagc tcatcaacgg cattcgggac 4140
aagcagtccg ggaagacgat cctcgacttc ctgaagagcg atggcttcgc gaaccgcaat 4200
ttcatgcagc tgattcacga tgacagcctc acattcaagg aggatatcca gaaggctcag 4260
gtgagcggcc agggggactc gctgcacgag catatcgcga acctcgctgg ctcgccagct 4320
atcaagaagg ggattctgca gaccgtgaag gttgtggacg agctggtgaa ggtcatgggc 4380
aggcacaagc ctgagaacat cgtcattgag atggcccggg agaatcagac cacgcagaag 4440
ggccagaaga actcacgcga gaggatgaag aggatcgagg agggcattaa ggagctgggg 4500
tcccagatcc tcaaggagca cccggtggag aacacgcagc tgcagaatga gaagctctac 4560
ctgtactacc tccagaatgg ccgcgatatg tatgtggacc aggagctgga tattaacagg 4620
ctcagcgatt acgacgtcga tcatatcgtt ccacagtcat tcctgaagga tgactccatt 4680
gacaacaagg tcctcaccag gtcggacaag aaccggggca agtctgataa tgttccttca 4740
gaggaggtcg ttaagaagat gaagaactac tggcgccagc tcctgaatgc caagctgatc 4800
acgcagcgga agttcgataa cctcacaaag gctgagaggg gcgggctctc tgagctggac 4860
aaggcgggct tcatcaagag gcagctggtc gagacacggc agatcactaa gcacgttgcg 4920
cagattctcg actcacggat gaacactaag tacgatgaga atgacaagct gatccgcgag 4980
gtgaaggtca tcaccctgaa gtcaaagctc gtctccgact tcaggaagga tttccagttc 5040
tacaaggttc gggagatcaa caattaccac catgcccatg acgcgtacct gaacgcggtg 5100
gtcggcacag ctctgatcaa gaagtaccca aagctcgaga gcgagttcgt gtacggggac 5160
tacaaggttt acgatgtgag gaagatgatc gccaagtcgg agcaggagat tggcaaggct 5220
accgccaagt acttcttcta ctctaacatt atgaatttct tcaagacaga gatcactctg5280
gccaatggcg agatccggaa gcgccccctc atcgagacga acggcgagac gggggagatc 5340
gtgtgggaca agggcaggga tttcgcgacc gtcaggaagg ttctctccat gccacaagtg 5400
aatatcgtca agaagacaga ggtccagact ggcgggttct ctaaggagtc aattctgcct 5460
aagcggaaca gcgacaagct catcgcccgc aagaaggact gggatccgaa gaagtacggc 5520
gggttcgaca gccccactgt ggcctactcg gtcctggttg tggcgaaggt tgagaagggc 5580
aagtccaaga agctcaagag cgtgaaggag ctgctgggga tcacgattat ggagcgctcc 5640
agcttcgaga agaacccgat cgatttcctg gaggcgaagg gctacaagga ggtgaagaag 5700
gacctgatca ttaagctccc caagtactca ctcttcgagc tggagaacgg caggaagcgg 5760
atgctggctt ccgctggcga gctgcagaag gggaacgagc tggctctgcc gtccaagtat 5820
gtgaacttcc tctacctggc ctcccactac gagaagctca agggcagccc cgaggacaac 5880
gagcagaagc agctgttcgt cgagcagcac aagcattacc tcgacgagat cattgagcag 5940
atttccgagt tctccaagcg cgtgatcctg gccgacgcga atctggataa ggtcctctcc 6000
gcgtacaaca agcaccgcga caagccaatc agggagcagg ctgagaatat cattcatctc 6060
ttcaccctga cgaacctcgg cgcccctgct gctttcaagt acttcgacac aactatcgat 6120
cgcaagaggt acacaagcac taaggaggtc ctggacgcga ccctcatcca ccagtcgatt 6180
accggcctct acgagacgcg catcgacctg tctcagctcg ggggcgacaa gcggccagcg 6240
gcgacgaaga aggcggggca ggcgaagaag aagaagtgag ctcagagctt tcgttcgtat 6300
catcggtttc gacaacgttc gtcaagttca atgcatcagt ttcattgcgc acacaccaga 6360
atcctactga gtttgagtat tatggcattg ggaaaactgt ttttcttgta ccatttgttg 6420
tgcttgtaat ttactgtgtt ttttattcgg ttttcgctat cgaactgtga aatggaaatg 6480
gatggagaag agttaatgaa tgatatggtc cttttgttca ttctcaaatt aatattattt 6540
gttttttctc ttatttgttg tgtgttgaat ttgaaattat aagagatatg caaacatttt 6600
gttttgagta aaaatgtgtc aaatcgtggc ctctaatgac cgaagttaat atgaggagta 6660
aaacacttgt agttgtacca ttatgcttat tcactaggca acaaatatat tttcagacct 6720
agaaaagctg caaatgttac tgaatacaag tatgtcctct tgtgttttag acatttatga 6780
actttccttt atgtaattt 6799
<210>9
<211>16231
<212>DNA
<213> Artificial sequence
<400>9
gtaaacgctc ttttctctta ggtttacccg ccaatatatc ctgtcaaaca ctgatagttt 60
aaactgaagg cgggaaacga caatctgatc caagctcaag ctgctctagc attcgccatt 120
caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagct 180
ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcccagtc 240
acgacgttgt aaaacgacgg ccagtgccaa gcttcatgaa tccaaaccac acggagttca 300
aattcccaca gattaaggct cgtccgtcgc acaaggtaat gtgtgaatat tatatctgtc 360
gtgcaaaatt gcctggcctg cacaattgct gttatagttg gcggcaggga gagttttaac 420
attgactagc gtgctgataa tttgtgagaa ataataattg acaagtagat actgacattt 480
gagaagagct tctgaactgt tattagtaac aaaaatggaa agctgatgca cggaaaaagg 540
aaagaaaaag ccatactttt ttttaggtag gaaaagaaaa agccatacga gactgatgtc 600
tctcagatgg gccgggatct gtctatctag caggcagcag cccaccaacc tcacgggcca 660
gcaattacga gtccttctaa aagctcccgc cgaggggcgc tggcgctgct gtgcagcagc 720
acgtctaaca ttagtcccac ctcgccagtt tacagggagc agaaccagct tataagcgga 780
ggcgcggcac caagaagcgg cgacggagcc gacgacgtgg aaggttttag agctagaaat 840
agcaagttaa aataaggcta gtccgttatc aacttgaaaa agtggcaccg agtcggtgct 900
tttttttttc gttttgcatt gagttttctc cgtcgcatgt ttgcagtttt attttccgtt 960
ttgcattgaa atttctccgt ctcatgtttg cagcgtgttc aaaaagtacg cagctgtatt 1020
tcacttattt acggcgccac attttcatgc cgtttgtgcc aactatcccg agctagtgaa 1080
tacagcttgg cttcacacaa cactggtgac ccgctgacct gctcgtacct cgtaccgtcg 1140
tacggcacag catttggaat taaagggtgt gatcgatact gcttgctgct aagcttgcat 1200
gcctgcagtg cagcgtgacc cggtcgtgcc cctctctaga gataatgagc attgcatgtc 1260
taagttataa aaaattacca catatttttt ttgtcacact tgtttgaagt gcagtttatc 1320
tatctttata catatattta aactttactc tacgaataat ataatctata gtactacaat 1380
aatatcagtg ttttagagaa tcatataaat gaacagttag acatggtcta aaggacaatt 1440
gagtattttg acaacaggac tctacagttt tatcttttta gtgtgcatgt gttctccttt 1500
ttttttgcaa atagcttcac ctatataata cttcatccat tttattagta catccattta 1560
gggtttaggg ttaatggttt ttatagacta atttttttag tacatctatt ttattctatt 1620
ttagcctcta aattaagaaa actaaaactc tattttagtt tttttattta ataatttaga 1680
tataaaatag aataaaataa agtgactaaa aattaaacaa atacccttta agaaattaaa 1740
aaaactaagg aaacattttt cttgtttcga gtagataatg ccagcctgtt aaacgccgtc 1800
gacgagtcta acggacacca accagcgaac cagcagcgtc gcgtcgggcc aagcgaagca 1860
gacggcacgg catctctgtc gctgcctctg gacccctctc gagagttccg ctccaccgtt 1920
ggacttgctc cgctgtcggc atccagaaat tgcgtggcgg agcggcagac gtgagccggc 1980
acggcaggcg gcctcctcct cctctcacgg cacggcagct acgggggatt cctttcccac 2040
cgctccttcg ctttcccttc ctcgcccgcc gtaataaata gacaccccct ccacaccctc 2100
tttccccaac ctcgtgttgt tcggagcgca cacacacaca accagatctc ccccaaatcc 2160
acccgtcggc acctccgctt caaggtacgc cgctcgtcct cccccccccc ccctctctac 2220
cttctctaga tcggcgttcc ggtccatggt tagggcccgg tagttctact tctgttcatg 2280
tttgtgttag atccgtgttt gtgttagatc cgtgctgcta gcgttcgtac acggatgcga 2340
cctgtacgtc agacacgttc tgattgctaa cttgccagtg tttctctttg gggaatcctg 2400
ggatggctct agccgttccg cagacgggat cgatttcatg attttttttg tttcgttgca 2460
tagggtttgg tttgcccttt tcctttattt caatatatgc cgtgcacttg tttgtcgggt 2520
catcttttca tgcttttttt tgtcttggtt gtgatgatgt ggtctggttg ggcggtcgtt 2580
ctagatcgga gtagaattct gtttcaaact acctggtgga tttattaatt ttggatctgt 2640
atgtgtgtgc catacatatt catagttacg aattgaagat gatggatgga aatatcgatc 2700
taggataggt atacatgttg atgcgggttt tactgatgca tatacagaga tgctttttgt 2760
tcgcttggtt gtgatgatgt ggtgtggttg ggcggtcgtt cattcgttct agatcggagt 2820
agaatactgt ttcaaactac ctggtgtatt tattaatttt ggaactgtat gtgtgtgtca 2880
tacatcttca tagttacgag tttaagatgg atggaaatat cgatctagga taggtataca 2940
tgttgatgtg ggttttactg atgcatatac atgatggcat atgcagcatc tattcatatg 3000
ctctaacctt gagtacctat ctattataat aaacaagtat gttttataat tattttgatc 3060
ttgatatact tggatgatgg catatgcagc agctatatgt ggattttttt agccctgcct 3120
tcatacgcta tttatttgct tggtactgtt tcttttgtcg atgctcaccc tgttgtttgg 3180
tgttacttct gcagccctag gcctactaga tggattacaa ggaccacgac ggggattaca 3240
aggaccacga cattgattac aaggatgatg atgacaagat ggctccgaag aagaagagga 3300
aggttggcat ccacggggtg ccagctgctg acaagaagta ctcgatcggc ctcgatattg 3360
ggactaactc tgttggctgg gccgtgatca ccgacgagta caaggtgccc tcaaagaagt 3420
tcaaggtcct gggcaacacc gatcggcatt ccatcaagaa gaatctcatt ggcgctctcc 3480
tgttcgacag cggcgagacg gctgaggcta cgcggctcaa gcgcaccgcc cgcaggcggt 3540
acacgcgcag gaagaatcgc atctgctacc tgcaggagat tttctccaac gagatggcga 3600
aggttgacga ttctttcttc cacaggctgg aggagtcatt cctcgtggag gaggataaga 3660
agcacgagcg gcatccaatc ttcggcaaca ttgtcgacga ggttgcctac cacgagaagt 3720
accctacgat ctaccatctg cggaagaagc tcgtggactc cacagataag gcggacctcc 3780
gcctgatcta cctcgctctg gcccacatga ttaagttcag gggccatttc ctgatcgagg 3840
gggatctcaa cccggacaat agcgatgttg acaagctgtt catccagctc gtgcagacgt 3900
acaaccagct cttcgaggag aaccccatta atgcgtcagg cgtcgacgcg aaggctatcc 3960
tgtccgctag gctctcgaag tctcggcgcc tcgagaacct gatcgcccag ctgccgggcg 4020
agaagaagaa cggcctgttc gggaatctca ttgcgctcag cctggggctc acgcccaact 4080
tcaagtcgaa tttcgatctc gctgaggacg ccaagctgca gctctccaag gacacatacg 4140
acgatgacct ggataacctc ctggcccaga tcggcgatca gtacgcggac ctgttcctcg 4200
ctgccaagaa tctgtcggac gccatcctcc tgtctgatat tctcagggtg aacaccgaga 4260
ttacgaaggc tccgctctca gcctccatga tcaagcgcta cgacgagcac catcaggatc 4320
tgaccctcct gaaggcgctg gtcaggcagc agctccccga gaagtacaag gagatcttct 4380
tcgatcagtc gaagaacggc tacgctgggt acattgacgg cggggcctct caggaggagt 4440
tctacaagtt catcaagccg attctggaga agatggacgg cacggaggag ctgctggtga 4500
agctcaatcg cgaggacctc ctgaggaagc agcggacatt cgataacggc agcatcccac 4560
accagattca tctcggggag ctgcacgcta tcctgaggag gcaggaggac ttctaccctt 4620
tcctcaagga taaccgcgag aagatcgaga agattctgac tttcaggatc ccgtactacg 4680
tcggcccact cgctaggggc aactcccgct tcgcttggat gacccgcaag tcagaggaga 4740
cgatcacgcc gtggaacttc gaggaggtgg tcgacaaggg cgctagcgct cagtcgttca 4800
tcgagaggat gacgaatttc gacaagaacc tgccaaatga gaaggtgctc cctaagcact 4860
cgctcctgta cgagtacttc acagtctaca acgagctgac taaggtgaag tatgtgaccg 4920
agggcatgag gaagccggct ttcctgtctg gggagcagaa gaaggccatc gtggacctcc 4980
tgttcaagac caaccggaag gtcacggtta agcagctcaa ggaggactac ttcaagaaga 5040
ttgagtgctt cgattcggtc gagatctctg gcgttgagga ccgcttcaac gcctccctgg 5100
ggacctacca cgatctcctg aagatcatta aggataagga cttcctggac aacgaggaga 5160
atgaggatat cctcgaggac attgtgctga cactcactct gttcgaggac cgggagatga 5220
tcgaggagcg cctgaagact tacgcccatc tcttcgatga caaggtcatg aagcagctca 5280
agaggaggag gtacaccggc tgggggaggc tgagcaggaa gctcatcaac ggcattcggg 5340
acaagcagtc cgggaagacg atcctcgact tcctgaagag cgatggcttc gcgaaccgca 5400
atttcatgca gctgattcac gatgacagcc tcacattcaa ggaggatatc cagaaggctc 5460
aggtgagcgg ccagggggac tcgctgcacg agcatatcgc gaacctcgct ggctcgccag 5520
ctatcaagaa ggggattctg cagaccgtga aggttgtgga cgagctggtg aaggtcatgg 5580
gcaggcacaa gcctgagaac atcgtcattg agatggcccg ggagaatcag accacgcaga 5640
agggccagaa gaactcacgc gagaggatga agaggatcga ggagggcatt aaggagctgg 5700
ggtcccagat cctcaaggag cacccggtgg agaacacgca gctgcagaat gagaagctct 5760
acctgtacta cctccagaat ggccgcgata tgtatgtgga ccaggagctg gatattaaca 5820
ggctcagcga ttacgacgtc gatcatatcg ttccacagtc attcctgaag gatgactcca 5880
ttgacaacaa ggtcctcacc aggtcggaca agaaccgggg caagtctgat aatgttcctt 5940
cagaggaggt cgttaagaag atgaagaact actggcgcca gctcctgaat gccaagctga 6000
tcacgcagcg gaagttcgat aacctcacaa aggctgagag gggcgggctc tctgagctgg 6060
acaaggcggg cttcatcaag aggcagctgg tcgagacacg gcagatcact aagcacgttg 6120
cgcagattct cgactcacgg atgaacacta agtacgatga gaatgacaag ctgatccgcg 6180
aggtgaaggt catcaccctg aagtcaaagc tcgtctccga cttcaggaag gatttccagt 6240
tctacaaggt tcgggagatc aacaattacc accatgccca tgacgcgtac ctgaacgcgg 6300
tggtcggcac agctctgatc aagaagtacc caaagctcga gagcgagttc gtgtacgggg 6360
actacaaggt ttacgatgtg aggaagatga tcgccaagtc ggagcaggag attggcaagg 6420
ctaccgccaa gtacttcttc tactctaaca ttatgaattt cttcaagaca gagatcactc 6480
tggccaatgg cgagatccgg aagcgccccc tcatcgagac gaacggcgag acgggggaga 6540
tcgtgtggga caagggcagg gatttcgcga ccgtcaggaa ggttctctcc atgccacaag 6600
tgaatatcgt caagaagaca gaggtccaga ctggcgggtt ctctaaggag tcaattctgc 6660
ctaagcggaa cagcgacaag ctcatcgccc gcaagaagga ctgggatccg aagaagtacg 6720
gcgggttcga cagccccact gtggcctact cggtcctggt tgtggcgaag gttgagaagg 6780
gcaagtccaa gaagctcaag agcgtgaagg agctgctggg gatcacgatt atggagcgct 6840
ccagcttcga gaagaacccg atcgatttcc tggaggcgaa gggctacaag gaggtgaaga 6900
aggacctgat cattaagctc cccaagtact cactcttcga gctggagaac ggcaggaagc 6960
ggatgctggc ttccgctggc gagctgcaga aggggaacga gctggctctg ccgtccaagt 7020
atgtgaactt cctctacctg gcctcccact acgagaagct caagggcagc cccgaggaca 7080
acgagcagaa gcagctgttc gtcgagcagc acaagcatta cctcgacgag atcattgagc 7140
agatttccga gttctccaag cgcgtgatcc tggccgacgc gaatctggat aaggtcctct 7200
ccgcgtacaa caagcaccgc gacaagccaa tcagggagca ggctgagaat atcattcatc 7260
tcttcaccct gacgaacctc ggcgcccctg ctgctttcaa gtacttcgac acaactatcg 7320
atcgcaagag gtacacaagc actaaggagg tcctggacgc gaccctcatc caccagtcga 7380
ttaccggcct ctacgagacg cgcatcgacc tgtctcagct cgggggcgac aagcggccag 7440
cggcgacgaa gaaggcgggg caggcgaaga agaagaagtg agctcagagc tttcgttcgt 7500
atcatcggtt tcgacaacgt tcgtcaagtt caatgcatca gtttcattgc gcacacacca 7560
gaatcctact gagtttgagt attatggcat tgggaaaact gtttttcttg taccatttgt 7620
tgtgcttgta atttactgtg ttttttattc ggttttcgct atcgaactgt gaaatggaaa 7680
tggatggaga agagttaatg aatgatatgg tccttttgtt cattctcaaa ttaatattat 7740
ttgttttttc tcttatttgt tgtgtgttga atttgaaatt ataagagata tgcaaacatt 7800
ttgttttgag taaaaatgtg tcaaatcgtg gcctctaatg accgaagtta atatgaggag 7860
taaaacactt gtagttgtac cattatgctt attcactagg caacaaatat attttcagac 7920
ctagaaaagc tgcaaatgtt actgaataca agtatgtcct cttgtgtttt agacatttat 7980
gaactttcct ttatgtaatt ttccagaatc cttgtcagat tctaatcatt gctttataat 8040
tatagttata ctcatggatt tgtagttgag tatgaaaata ttttttaatg cattttatga 8100
cttgccaatt gattgacaac gaattcgtaa tcatggtcat agctgtttcc tgtgtgaaat 8160
tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg 8220
ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag 8280
tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 8340
ttgcgtattg gctagagcag cttgccaaca tggtggagca cgacactctc gtctactcca 8400
agaatatcaa agatacagtc tcagaagacc aaagggctat tgagactttt caacaaaggg 8460
taatatcggg aaacctcctc ggattccatt gcccagctat ctgtcacttc atcaaaagga 8520
cagtagaaaa ggaaggtggc acctacaaat gccatcattg cgataaagga aaggctatcg 8580
ttcaagatgc ctctgccgac agtggtccca aagatggacc cccacccacg aggagcatcg 8640
tggaaaaaga agacgttcca accacgtctt caaagcaagt ggattgatgt gataacatgg 8700
tggagcacga cactctcgtc tactccaaga atatcaaaga tacagtctca gaagaccaaa 8760
gggctattga gacttttcaa caaagggtaa tatcgggaaa cctcctcgga ttccattgcc 8820
cagctatctg tcacttcatc aaaaggacag tagaaaagga aggtggcacc tacaaatgcc 8880
atcattgcga taaaggaaag gctatcgttc aagatgcctc tgccgacagt ggtcccaaag 8940
atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa 9000
agcaagtgga ttgatgtgat atctccactg acgtaaggga tgacgcacaa tcccactatc 9060
cttcgcaaga ccttcctcta tataaggaag ttcatttcat ttggagagga cacgctgaaa 9120
tcaccagtct ctctctacaa atctatctct ctcgagtcta ccatgagccc agaacgacgc 9180
ccggccgaca tccgccgtgc caccgaggcg gacatgccgg cggtctgcac catcgtcaac 9240
cactacatcg agacaagcac ggtcaacttc cgtaccgagc cgcaggaacc gcaggagtgg 9300
acggacgacc tcgtccgtct gcgggagcgc tatccctggc tcgtcgccga ggtggacggc 9360
gaggtcgccg gcatcgccta cgcgggcccc tggaaggcac gcaacgccta cgactggacg 9420
gccgagtcga ccgtgtacgt ctccccccgc caccagcgga cgggactggg ctccacgctc 9480
tacacccacc tgctgaagtc cctggaggca cagggcttca agagcgtggt cgctgtcatc 9540
gggctgccca acgacccgag cgtgcgcatg cacgaggcgc tcggatatgc cccccgcggc 9600
atgctgcggg cggccggctt caagcacggg aactggcatg acgtgggttt ctggcagctg 9660
gacttcagcc tgccggtacc gccccgtccg gtcctgcccg tcaccgagat ttgactcgag 9720
tttctccata ataatgtgtg agtagttccc agataaggga attagggttc ctatagggtt 9780
tcgctcatgt gttgagcata taagaaaccc ttagtatgta tttgtatttg taaaatactt 9840
ctatcaataa aatttctaat tcctaaaacc aaaatccagt actaaaatcc agatcccccg 9900
aattaattcg gcgttaattc agtacattaa aaacgtccgc aatgtgttat taagttgtct 9960
aagcgtcaat ttgtttacac cacaatatat cctgccacca gccagccaac agctccccga 10020
ccggcagctc ggcacaaaat caccactcga tacaggcagc ccatcagtcc gggacggcgt 10080
cagcgggaga gccgttgtaa ggcggcagac tttgctcatg ttaccgatgc tattcggaag 10140
aacggcaact aagctgccgg gtttgaaaca cggatgatct cgcggagggt agcatgttga 10200
ttgtaacgat gacagagcgt tgctgcctgt gatcaccgcg gtttcaaaat cggctccgtc 10260
gatactatgt tatacgccaa ctttgaaaac aactttgaaa aagctgtttt ctggtattta 10320
aggttttaga atgcaaggaa cagtgaattg gagttcgtct tgttataatt agcttcttgg 10380
ggtatcttta aatactgtag aaaagaggaa ggaaataata aatggctaaa atgagaatat 10440
caccggaatt gaaaaaactg atcgaaaaat accgctgcgt aaaagatacg gaaggaatgt 10500
ctcctgctaa ggtatataag ctggtgggag aaaatgaaaa cctatattta aaaatgacgg 10560
acagccggta taaagggacc acctatgatg tggaacggga aaaggacatg atgctatggc 10620
tggaaggaaa gctgcctgtt ccaaaggtcc tgcactttga acggcatgat ggctggagca 10680
atctgctcat gagtgaggcc gatggcgtcc tttgctcgga agagtatgaa gatgaacaaa 10740
gccctgaaaa gattatcgag ctgtatgcgg agtgcatcag gctctttcac tccatcgaca 10800
tatcggattg tccctatacg aatagcttag acagccgctt agccgaattg gattacttac 10860
tgaataacga tctggccgat gtggattgcg aaaactggga agaagacact ccatttaaag 10920
atccgcgcga gctgtatgat tttttaaaga cggaaaagcc cgaagaggaa cttgtctttt 10980
cccacggcga cctgggagac agcaacatct ttgtgaaaga tggcaaagta agtggcttta 11040
ttgatcttgg gagaagcggc agggcggaca agtggtatga cattgccttc tgcgtccggt 11100
cgatcaggga ggatatcggg gaagaacagt atgtcgagct attttttgac ttactgggga 11160
tcaagcctga ttgggagaaa ataaaatatt atattttact ggatgaattg ttttagtacc 11220
tagaatgcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg 11280
tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc 11340
aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 11400
tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt 11460
agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc 11520
taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact 11580
caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac 11640
agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag 11700
aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg 11760
gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg 11820
tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga 11880
gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt 11940
ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct 12000
ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg 12060
aggaagcgga agagcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac 12120
accgcatatg gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagtata 12180
cactccgcta tcgctacgtg actgggtcat ggctgcgccc cgacacccgc caacacccgc 12240
tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt 12300
ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgaggcaggg 12360
tgccttgatg tgggcgccgg cggtcgagtg gcgacggcgc ggcttgtccg cgccctggta 12420
gattgcctgg ccgtaggcca gccatttttg agcggccagc ggccgcgata ggccgacgcg 12480
aagcggcggg gcgtagggag cgcagcgacc gaagggtagg cgctttttgc agctcttcgg 12540
ctgtgcgctg gccagacagt tatgcacagg ccaggcgggt tttaagagtt ttaataagtt 12600
ttaaagagtt ttaggcggaa aaatcgcctt ttttctcttt tatatcagtc acttacatgt 12660
gtgaccggtt cccaatgtac ggctttgggt tcccaatgta cgggttccgg ttcccaatgt 12720
acggctttgg gttcccaatg tacgtgctat ccacaggaaa cagacctttt cgaccttttt 12780
cccctgctag ggcaatttgc cctagcatct gctccgtaca ttaggaaccg gcggatgctt 12840
cgccctcgat caggttgcgg tagcgcatga ctaggatcgg gccagcctgc cccgcctcct 12900
ccttcaaatc gtactccggc aggtcatttg acccgatcag cttgcgcacg gtgaaacaga 12960
acttcttgaa ctctccggcg ctgccactgc gttcgtagat cgtcttgaac aaccatctgg 13020
cttctgcctt gcctgcggcg cggcgtgcca ggcggtagag aaaacggccg atgccgggat 13080
cgatcaaaaa gtaatcgggg tgaaccgtca gcacgtccgg gttcttgcct tctgtgatct 13140
cgcggtacat ccaatcagct agctcgatct cgatgtactc cggccgcccg gtttcgctct 13200
ttacgatctt gtagcggcta atcaaggctt caccctcgga taccgtcacc aggcggccgt 13260
tcttggcctt cttcgtacgc tgcatggcaa cgtgcgtggt gtttaaccga atgcaggttt 13320
ctaccaggtc gtctttctgc tttccgccat cggctcgccg gcagaacttg agtacgtccg 13380
caacgtgtgg acggaacacg cggccgggct tgtctccctt cccttcccgg tatcggttca 13440
tggattcggt tagatgggaa accgccatca gtaccaggtc gtaatcccac acactggcca 13500
tgccggccgg ccctgcggaa acctctacgt gcccgtctgg aagctcgtag cggatcacct 13560
cgccagctcg tcggtcacgc ttcgacagac ggaaaacggc cacgtccatg atgctgcgac 13620
tatcgcgggt gcccacgtca tagagcatcg gaacgaaaaa atctggttgc tcgtcgccct 13680
tgggcggctt cctaatcgac ggcgcaccgg ctgccggcgg ttgccgggat tctttgcgga 13740
ttcgatcagc ggccgcttgc cacgattcac cggggcgtgc ttctgcctcg atgcgttgcc 13800
gctgggcggc ctgcgcggcc ttcaacttct ccaccaggtc atcacccagc gccgcgccga 13860
tttgtaccgg gccggatggt ttgcgaccgc tcacgccgat tcctcgggct tgggggttcc 13920
agtgccattg cagggccggc agacaaccca gccgcttacg cctggccaac cgcccgttcc 13980
tccacacatg gggcattcca cggcgtcggt gcctggttgt tcttgatttt ccatgccgcc 14040
tcctttagcc gctaaaattc atctactcat ttattcattt gctcatttac tctggtagct 14100
gcgcgatgta ttcagatagc agctcggtaa tggtcttgcc ttggcgtacc gcgtacatct 14160
tcagcttggt gtgatcctcc gccggcaact gaaagttgac ccgcttcatg gctggcgtgt 14220
ctgccaggct ggccaacgtt gcagccttgc tgctgcgtgc gctcggacgg ccggcactta 14280
gcgtgtttgt gcttttgctc attttctctt tacctcatta actcaaatga gttttgattt 14340
aatttcagcg gccagcgcct ggacctcgcg ggcagcgtcg ccctcgggtt ctgattcaag 14400
aacggttgtg ccggcggcgg cagtgcctgg gtagctcacg cgctgcgtga tacgggactc 14460
aagaatgggc agctcgtacc cggccagcgc ctcggcaacc tcaccgccga tgcgcgtgcc 14520
tttgatcgcc cgcgacacga caaaggccgc ttgtagcctt ccatccgtga cctcaatgcg 14580
ctgcttaacc agctccacca ggtcggcggt ggcccatatg tcgtaagggc ttggctgcac 14640
cggaatcagc acgaagtcgg ctgccttgat cgcggacaca gccaagtccg ccgcctgggg 14700
cgctccgtcg atcactacga agtcgcgccg gccgatggcc ttcacgtcgc ggtcaatcgt 14760
cgggcggtcg atgccgacaa cggttagcgg ttgatcttcc cgcacggccg cccaatcgcg 14820
ggcactgccc tggggatcgg aatcgactaa cagaacatcg gccccggcga gttgcagggc 14880
gcgggctaga tgggttgcga tggtcgtctt gcctgacccg cctttctggt taagtacagc 14940
gataaccttc atgcgttccc cttgcgtatt tgtttattta ctcatcgcat catatacgca 15000
gcgaccgcat gacgcaagct gttttactca aatacacatc acctttttag acggcggcgc 15060
tcggtttctt cagcggccaa gctggccggc caggccgcca gcttggcatc agacaaaccg 15120
gccaggattt catgcagccg cacggttgag acgtgcgcgg gcggctcgaa cacgtacccg 15180
gccgcgatca tctccgcctc gatctcttcg gtaatgaaaa acggttcgtc ctggccgtcc 15240
tggtgcggtt tcatgcttgt tcctcttggc gttcattctc ggcggccgcc agggcgtcgg 15300
cctcggtcaa tgcgtcctca cggaaggcac cgcgccgcct ggcctcggtg ggcgtcactt 15360
cctcgctgcg ctcaagtgcg cggtacaggg tcgagcgatg cacgccaagc agtgcagccg 15420
cctctttcac ggtgcggcct tcctggtcga tcagctcgcg ggcgtgcgcg atctgtgccg 15480
gggtgagggt agggcggggg ccaaacttca cgcctcgggc cttggcggcc tcgcgcccgc 15540
tccgggtgcg gtcgatgatt agggaacgct cgaactcggc aatgccggcg aacacggtca 15600
acaccatgcg gccggccggc gtggtggtgt cggcccacgg ctctgccagg ctacgcaggc 15660
ccgcgccggc ctcctggatg cgctcggcaa tgtccagtag gtcgcgggtg ctgcgggcca 15720
ggcggtctag cctggtcact gtcacaacgt cgccagggcg taggtggtca agcatcctgg 15780
ccagctccgg gcggtcgcgc ctggtgccgg tgatcttctc ggaaaacagc ttggtgcagc 15840
cggccgcgtg cagttcggcc cgttggttgg tcaagtcctg gtcgtcggtg ctgacgcggg 15900
catagcccag caggccagcg gcggcgctct tgttcatggc gtaatgtctc cggttctagt 15960
cgcaagtatt ctactttatg cgactaaaac acgcgacaag aaaacgccag gaaaagggca 16020
gggcggcagc ctgtcgcgta acttaggact tgtgcgacat gtcgttttca gaagacggct 16080
gcactgaacg tcagaagccg actgcactat agcagcggag gggttggatc aaagtacttt 16140
gatcccgagg ggaaccctgt ggttggcatg cacatacaaa tggacgaacg gataaacctt 16200
ttcacgccct tttaaatatc cgttattcta a 16231
<210>10
<211>20
<212>DNA
<213> Artificial sequence
<400>10
cggagccgac gacgtggaag 20
<210>11
<211>1761
<212>DNA
<213> Artificial sequence
<400>11
atgccggacg gaatgctcgg caaggcggcg ctcgccgtcc ttctcgtgct cgccggcctt 60
gcggccggga ccaggccgcc cccgccgccg gtgtcggagg acacgctgga gaaggtcgcc 120
ggctcgctgg aaatgtacgt cgacaggctc ccccagatgc ccaaggtacg cggctactcc 180
gtggaacgcg gccgcgccac gccggtgcac ctcgccgtcg ggatgtacca aaagaaatgg 240
aaattccacc gcgacctgcc ggcgaccacc gtgttcgtgt tcggagagtc ggcggagagc 300
gccacgttcc ccgggccgac catcgaggcg ctgcaagggg tccctctgtc ggtgacgtgg 360
gagaaccacc tgccggagaa ccacatcctt ccgtgggacc ccaccgtgcc cgtcgccatc 420
cccaggcacg gcggcgtccc gaccgtcgtc cacctccacg gcggcgtcca cccgccgcag 480
tccgacgcca gcgccttcgc atggttcacc gccggcttcc gcgagaccgg cgccaagtgg 540
acgacgccga cgtacgtgta cccgaacgtg cagtcccccg gtgtcctctg gtaccacgac 600
cacgccctcg gcctcacgcg cgccaacctc ctcgccggcc tcctcggcgc ctacgtcatc 660
cgcaatccgg cggtggagtg gccgctcggc ctcccttgcg gcgacgagtt cgaccgcgtg 720
ctcgtgctcg ccgaccgcag cttctatgcc aacggctccc tctacatgaa ctccaccggc 780
gacaacccgc acgtccaccc tcagtggcag cctgagtact tcggcgacgt catcaccgtc 840
aacggcaagg cgtggccgtt ccttcccgtc gcccggcgcc gctaccgctt ccgcgtcatc 900
aacgccagca acgcgcgcta cttcaacctc tcgctgagca acggcctccc cttccacgtc 960
gtcggctccg acaccagcta cctggcccgg ccggtcgccg ccacccacgt cgtcgtcggc 1020
gtgtccgagt cgtttgacgt cgtcatcgac ttctccgacg acgagtccaa cacgcccgag 1080
gtggagctgg tgaacacggc gccgtacccg ttccccgacg gcaacgcgcc gggccgcctc 1140
tccagcaagg tgatgaagtt cgtcatcgaa ccagcgaaga caagggacca ctccagggtg 1200
ccggcgaggc tgctggagta ccacgcgaag gtcgccgagg aagaggcgac aagaaagcga 1260
tacatcgtga tgtacgagta cgacgacggc gcgacgggcg gcccgacgca cctgtacatc 1320
aacgggaagc ggctggagga cccggcgacg gagacgccgc gcgtgggggc gacggaggtg 1380
tgggaggtgg tcaacctcac gccggacgac cacccgctcc acctccatct ggccacgttc 1440
caggcggtgc gcgcccgggg gctggtcggg cttgacgagt tcaggcgctg catggccagg 1500
ctcaacgacg cggccaggtg caacgtgagc cagcacgccg ctggggacgc ggtgggcgtg 1560
ccggagcacg agaggacgtg gaagaacgtg gggaagatgg cgccggggca cgtgacgacg 1620
gcggtggtca agttcctgat ggtggacacc ggcgaggact acccgttcga cgccacggcc 1680
gagcctggct acgtctatca ctgtcacatt ttggatcatg aggacaatgc catgattcgc 1740
ccgctaaagc tcatcagata a 1761
<210>12
<211>1757
<212>DNA
<213> Artificial sequence
<400>12
atgccggacg gaatgctcgg caaggcggcg ctcgccgtcc ttctcgtgct cgccggcctt 60
gcggccggga ccaggccgcc cccgccgccg gtgtcggagg acacgctgga gaaggtcgcc 120
ggctcgctgg aaatgtacgt cgacaggctc ccccagatgc ccaaggtacg cggctactcc 180
gtggaacgcg gccgcgccac gccggtgcac ctcgccgtcg ggatgtacca aaagaaatgg 240
aaattccacc gcgacctgcc ggcgaccacc gtgttcgtgt tcggagagtc ggcggagagc 300
gccacgttcc ccgggccgac catcgaggcg ctgcaagggg tccctctgtc ggtgacgtgg 360
gagaaccacc tgccggagaa ccacatcctt ccgtgggacc ccaccgtgcc cgtcgccatc 420
cccaggcacg gcggcgtccc gaccgtcgtc cacctccacg gcggcgtcca cccgccgcag 480
tccgacgcca gcgccttcgc atggttcacc gccggcttcc gcgagaccgg cgccaagtgg 540
acgacgccga cgtacgtgta cccgaacgtg cagtcccccg gtgtcctctg gtaccacgac 600
cacgccctcg gcctcacgcg cgccaacctc ctcgccggcc tcctcggcgc ctacgtcatc 660
cgcaatccgg cggtggagtg gccgctcggc ctcccttgcg gcgacgagtt cgaccgcgtg 720
ctcgtgctcg ccgaccgcag cttctatgcc aacggctccc tctacatgaa ctccaccggc 780
gacaacccgc acgtccaccc tcagtggcag cctgagtact tcggcgacgt catcaccgtc 840
aacggcaagg cgtggccgtt ccttcccgtc gcccggcgcc gctaccgctt ccgcgtcatc 900
aacgccagca acgcgcgcta cttcaacctc tcgctgagca acggcctccc cttgtcgtcg 960
gctccgacac cagctacctg gcccggccgg tcgccgccac ccacgtcgtc gtcggcgtgt 1020
ccgagtcgtt tgacgtcgtc atcgacttct ccgacgacga gtccaacacg cccgaggtgg 1080
agctggtgaa cacggcgccg tacccgttcc ccgacggcaa cgcgccgggc cgcctctcca 1140
gcaaggtgat gaagttcgtc atcgaaccag cgaagacaag ggaccactcc agggtgccgg 1200
cgaggctgct ggagtaccac gcgaaggtcg ccgaggaaga ggcgacaaga aagcgataca 1260
tcgtgatgta cgagtacgac gacggcgcga cgggcggccc gacgcacctg tacatcaacg 1320
ggaagcggct ggaggacccg gcgacggaga cgccgcgcgt gggggcgacg gaggtgtggg 1380
aggtggtcaa cctcacgccg gacgaccacc cgctccacct ccatctggcc acgttccagg 1440
cggtgcgcgc ccgggggctg gtcgggcttg acgagttcag gcgctgcatggccaggctca 1500
acgacgcggc caggtgcaac gtgagccagc acgccgctgg ggacgcggtg ggcgtgccgg 1560
agcacgagag gacgtggaag aacgtgggga agatggcgcc ggggcacgtg acgacggcgg 1620
tggtcaagtt cctgatggtg gacaccggcg aggactaccc gttcgacgcc acggccgagc 1680
ctggctacgt ctatcactgt cacattttgg atcatgagga caatgccatg attcgcccgc 1740
taaagctcat cagataa 1757
<210>13
<211>4107
<212>DNA
<213> Artificial sequence
<400>13
atggacaaga agtactcgat cggcctcgat attgggacta actctgttgg ctgggccgtg 60
atcaccgacg agtacaaggt gccctcaaag aagttcaagg tcctgggcaa caccgatcgg 120
cattccatca agaagaatct cattggcgct ctcctgttcg acagcggcga gacggctgag 180
gctacgcggc tcaagcgcac cgcccgcagg cggtacacgc gcaggaagaa tcgcatctgc 240
tacctgcagg agattttctc caacgagatg gcgaaggttg acgattcttt cttccacagg 300
ctggaggagt cattcctcgt ggaggaggat aagaagcacg agcggcatcc aatcttcggc 360
aacattgtcg acgaggttgc ctaccacgag aagtacccta cgatctacca tctgcggaag 420
aagctcgtgg actccacaga taaggcggac ctccgcctga tctacctcgc tctggcccac 480
atgattaagt tcaggggcca tttcctgatc gagggggatc tcaacccgga caatagcgat 540
gttgacaagc tgttcatcca gctcgtgcag acgtacaacc agctcttcga ggagaacccc 600
attaatgcgt caggcgtcga cgcgaaggct atcctgtccg ctaggctctcgaagtctcgg 660
cgcctcgaga acctgatcgc ccagctgccg ggcgagaaga agaacggcct gttcgggaat 720
ctcattgcgc tcagcctggg gctcacgccc aacttcaagt cgaatttcga tctcgctgag 780
gacgccaagc tgcagctctc caaggacaca tacgacgatg acctggataa cctcctggcc 840
cagatcggcg atcagtacgc ggacctgttc ctcgctgcca agaatctgtc ggacgccatc 900
ctcctgtctg atattctcag ggtgaacacc gagattacga aggctccgct ctcagcctcc 960
atgatcaagc gctacgacga gcaccatcag gatctgaccc tcctgaaggc gctggtcagg 1020
cagcagctcc ccgagaagta caaggagatc ttcttcgatc agtcgaagaa cggctacgct 1080
gggtacattg acggcggggc ctctcaggag gagttctaca agttcatcaa gccgattctg 1140
gagaagatgg acggcacgga ggagctgctg gtgaagctca atcgcgagga cctcctgagg 1200
aagcagcgga cattcgataa cggcagcatc ccacaccaga ttcatctcgg ggagctgcac 1260
gctatcctga ggaggcagga ggacttctac cctttcctca aggataaccg cgagaagatc 1320
gagaagattc tgactttcag gatcccgtac tacgtcggcc cactcgctag gggcaactcc 1380
cgcttcgctt ggatgacccg caagtcagag gagacgatca cgccgtggaa cttcgaggag 1440
gtggtcgaca agggcgctag cgctcagtcg ttcatcgaga ggatgacgaa tttcgacaag 1500
aacctgccaa atgagaaggt gctccctaag cactcgctcc tgtacgagta cttcacagtc 1560
tacaacgagc tgactaaggt gaagtatgtg accgagggca tgaggaagcc ggctttcctg 1620
tctggggagc agaagaaggc catcgtggac ctcctgttca agaccaaccg gaaggtcacg 1680
gttaagcagc tcaaggagga ctacttcaag aagattgagt gcttcgattc ggtcgagatc 1740
tctggcgttg aggaccgctt caacgcctcc ctggggacct accacgatct cctgaagatc 1800
attaaggata aggacttcct ggacaacgag gagaatgagg atatcctcga ggacattgtg 1860
ctgacactca ctctgttcga ggaccgggag atgatcgagg agcgcctgaa gacttacgcc 1920
catctcttcg atgacaaggt catgaagcag ctcaagagga ggaggtacac cggctggggg 1980
aggctgagca ggaagctcat caacggcatt cgggacaagc agtccgggaa gacgatcctc 2040
gacttcctga agagcgatgg cttcgcgaac cgcaatttca tgcagctgat tcacgatgac 2100
agcctcacat tcaaggagga tatccagaag gctcaggtga gcggccaggg ggactcgctg 2160
cacgagcata tcgcgaacct cgctggctcg ccagctatca agaaggggat tctgcagacc 2220
gtgaaggttg tggacgagct ggtgaaggtc atgggcaggc acaagcctga gaacatcgtc 2280
attgagatgg cccgggagaa tcagaccacg cagaagggcc agaagaactc acgcgagagg 2340
atgaagagga tcgaggaggg cattaaggag ctggggtccc agatcctcaa ggagcacccg 2400
gtggagaaca cgcagctgca gaatgagaag ctctacctgt actacctcca gaatggccgc 2460
gatatgtatg tggaccagga gctggatatt aacaggctca gcgattacga cgtcgatcat 2520
atcgttccac agtcattcct gaaggatgac tccattgaca acaaggtcct caccaggtcg 2580
gacaagaacc ggggcaagtc tgataatgtt ccttcagagg aggtcgttaa gaagatgaag 2640
aactactggc gccagctcct gaatgccaag ctgatcacgc agcggaagtt cgataacctc 2700
acaaaggctg agaggggcgg gctctctgag ctggacaagg cgggcttcat caagaggcag 2760
ctggtcgaga cacggcagat cactaagcac gttgcgcaga ttctcgactc acggatgaac 2820
actaagtacg atgagaatga caagctgatc cgcgaggtga aggtcatcac cctgaagtca 2880
aagctcgtct ccgacttcag gaaggatttc cagttctaca aggttcggga gatcaacaat 2940
taccaccatg cccatgacgc gtacctgaac gcggtggtcg gcacagctct gatcaagaag 3000
tacccaaagc tcgagagcga gttcgtgtac ggggactaca aggtttacga tgtgaggaag 3060
atgatcgcca agtcggagca ggagattggc aaggctaccg ccaagtactt cttctactct 3120
aacattatga atttcttcaa gacagagatc actctggcca atggcgagat ccggaagcgc 3180
cccctcatcg agacgaacgg cgagacgggg gagatcgtgt gggacaaggg cagggatttc 3240
gcgaccgtca ggaaggttct ctccatgcca caagtgaata tcgtcaagaa gacagaggtc 3300
cagactggcg ggttctctaa ggagtcaatt ctgcctaagc ggaacagcga caagctcatc 3360
gcccgcaaga aggactggga tccgaagaag tacggcgggt tcgacagccc cactgtggcc 3420
tactcggtcc tggttgtggc gaaggttgag aagggcaagt ccaagaagct caagagcgtg 3480
aaggagctgc tggggatcac gattatggag cgctccagct tcgagaagaa cccgatcgat 3540
ttcctggagg cgaagggcta caaggaggtg aagaaggacc tgatcattaa gctccccaag 3600
tactcactct tcgagctgga gaacggcagg aagcggatgc tggcttccgc tggcgagctg 3660
cagaagggga acgagctggc tctgccgtcc aagtatgtga acttcctcta cctggcctcc 3720
cactacgaga agctcaaggg cagccccgag gacaacgagc agaagcagct gttcgtcgag 3780
cagcacaagc attacctcga cgagatcatt gagcagattt ccgagttctc caagcgcgtg 3840
atcctggccg acgcgaatct ggataaggtc ctctccgcgt acaacaagca ccgcgacaag 3900
ccaatcaggg agcaggctga gaatatcatt catctcttca ccctgacgaa cctcggcgcc 3960
cctgctgctt tcaagtactt cgacacaact atcgatcgca agaggtacac aagcactaag 4020
gaggtcctgg acgcgaccct catccaccag tcgattaccg gcctctacga gacgcgcatc 4080
gacctgtctc agctcggggg cgactga 4107

Claims (9)

1. A pBUE411-LPR2 binary vector with the function of knocking out LPR2 gene is characterized by comprising an expression cassette A and an expression cassette B;
the expression cassette A specifically comprises the following elements from upstream to downstream in sequence: the TaU3 promoter A from wheat, the sgRNA of the LPR2 gene and the terminator A;
the expression cassette B specifically comprises the following elements from upstream to downstream in sequence: the promoter B, the maize Cas9 coding sequence, the terminator B.
2. The pBUE411-LPR2 binary vector of claim 1, wherein the DNA sequence of sgRNA of LPR2 gene is shown as sequence SEQ 10; the maize Cas9 coding sequence is shown in SEQ 13; the sequence of the promoter A is shown as SEQ 3;
the promoter B sequence is shown as SEQ 4; the terminator A sequence is shown as SEQ 5; the terminator B sequence is shown as SEQ 6.
3. The pBUE411-LPR2 binary vector of claim 1, wherein the expression cassette A sequence is specifically set forth in SEQ 7;
the sequence of the expression cassette B is specifically shown as SEQ 8;
the expression cassette A is located at the upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.
4. The pBUE411-LPR2 binary vector of claim 2, further comprising a resistance marker gene; the nucleotide sequence of the pBUE411-LPR2 binary vector is shown in SEQ 9.
5. The method for constructing the binary vector pBUE411-LPR2 according to claim 1, comprising the steps of:
s11, designing sgRNA of a targeting LPR2 gene, wherein primers corresponding to oligonucleotides of the sgRNA are LPR2-gR1-TaU3-F shown in SEQ1 and LPR2-gR1-TaU3-R shown in SEQ 2;
s12 phosphorylates and anneals 2 oligos of the synthesized sgRNA to form double chains;
s13, utilizing restriction enzyme BsaI to cut the pBUE411 vector, and recovering vector fragments containing the promoter A, the terminator A, the promoter B and the terminator B;
s14 the recovered pBUE411 carrier fragment and double-stranded sgRNA with sticky ends are connected by T4 ligase to obtain the final pBUE411-LPR2 binary carrier.
6. A transformant comprising the pBUE411-LPR2 binary vector of any one of claims 1-5.
7. The use of the pBUE411-LPR2 binary vector of any one of claims 1-5 to increase phosphorus utilization in wheat.
8. Use of the pBUE411-LPR2 binary vector of claims 1-5 in breeding transgenic wheat.
9. A method for improving phosphorus utilization rate of wheat by using gene editing is characterized by comprising the following steps: the function of the wheat LPR2 gene is reduced or lost, and the expression and/or activity of the protein coded by the wheat LPR2 gene is inhibited, so that the phosphorus utilization rate of the wheat is improved;
the method for reducing or losing the function of wheat LPR2 gene is to construct pBUE411-LPR2 binary vector as described in any one of claims 1-5.
CN202010299274.0A 2019-04-17 2020-04-16 Method for improving phosphorus utilization rate of wheat by using gene editing Active CN111269934B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2019103064192 2019-04-17
CN201910306419 2019-04-17

Publications (2)

Publication Number Publication Date
CN111269934A true CN111269934A (en) 2020-06-12
CN111269934B CN111269934B (en) 2022-08-09

Family

ID=70998310

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010299274.0A Active CN111269934B (en) 2019-04-17 2020-04-16 Method for improving phosphorus utilization rate of wheat by using gene editing

Country Status (1)

Country Link
CN (1) CN111269934B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107164402A (en) * 2017-05-31 2017-09-15 未名兴旺系统作物设计前沿实验室(北京)有限公司 A kind of gene editing carrier and its application based on CRISPR Cas9 systems

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107164402A (en) * 2017-05-31 2017-09-15 未名兴旺系统作物设计前沿实验室(北京)有限公司 A kind of gene editing carrier and its application based on CRISPR Cas9 systems

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SERGIO SVISTOONOFF ET AL.: "Root tip contact with low-phosphate media reprograms plant root architecture", 《NATURE GENETICS》 *
SHUJUAN ZHANG ET AL.: "Targeted mutagenesis using the Agrobacterium tumefaciens-mediated CRISPR-Cas9 system in common wheat", 《BMC PLANT BIOLOGY》 *

Also Published As

Publication number Publication date
CN111269934B (en) 2022-08-09

Similar Documents

Publication Publication Date Title
CN111139260B (en) Method for improving whiteness of wheat flour by using gene editing
CN101405394B (en) D-amino acid selection for soybean
AU2019297209B2 (en) Method of obtaining multi-leaf alfalfa material by means of MsPALM1 artificial site-directed mutant
CN111630175B (en) Method for improving gene editing efficiency based on homologous recombination in plant body
CN111187775B (en) Rice humidity-sensitive sterile gene and application thereof and sterile line cultivation method
CN112725348B (en) Gene and method for improving single-base editing efficiency of rice and application of gene
CN108753815A (en) A kind of method that big flux screening plant virus replicates required host&#39;s gene
CN105755022A (en) Rice cadmium-tolerant gene OsGSTU5, encoding protein thereof and application of rice cadmium-tolerant gene OsGSTU5
CN111574605A (en) Application of rice gene OsLAT5 in regulation of absorption and accumulation of diquat
CN109811004B (en) Application of expression vector in producing brown yellow fiber by specifically expressing GhPSY2 gene in secondary wall development stage of cotton
CN103014035A (en) Tumorous stem mustard stress-resistant gene, plant expression vector, construction method and application thereof
CN104328127A (en) Tumorous stem mustard stress resistance gene BjEFh1 as well as plant expression vector and application thereof
CN114657207B (en) Genetic transformation system, genetic transformation method and application of Rutaceae plant
KR101206928B1 (en) RNA interference cassette against a self-incompatibility factor of Brassica genus, vector comprising the same and transgenic Brassica plant comprising the same
CN111269934B (en) Method for improving phosphorus utilization rate of wheat by using gene editing
CN111269935B (en) Wheat TaDA2 gene Cas9 vector and application thereof
CN114107373B (en) Method for preparing arabidopsis autophagy gene mutant and application thereof
CN111534522B (en) Wheat TaRDR6 gene and application thereof in male sterility
CN111424044B (en) Wheat TaDCL4 gene and application thereof in pollen fertility
CN111575312B (en) Method for inducing abortion of wheat pollen
CN110616220A (en) Method for improving hardness of wheat grains
CN114045302A (en) Single-base editing vector and construction and application thereof
CN112280797B (en) Can improve coenzyme Q in tomato 10 Content combined vector and construction method and application thereof
CN111793624A (en) Oligo DNA group of sgRNA for site-directed knockout of rice Osaurora1 gene
CN111793625A (en) Oligo DNA group of sgRNA for site-directed knockout of rice OsAUR2 gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant