CN111235177B - Populus alba PDS gene knocked out by CRISPR/Cas9 system and application thereof - Google Patents
Populus alba PDS gene knocked out by CRISPR/Cas9 system and application thereof Download PDFInfo
- Publication number
- CN111235177B CN111235177B CN202010083041.7A CN202010083041A CN111235177B CN 111235177 B CN111235177 B CN 111235177B CN 202010083041 A CN202010083041 A CN 202010083041A CN 111235177 B CN111235177 B CN 111235177B
- Authority
- CN
- China
- Prior art keywords
- gene
- pds
- populus alba
- seq
- crispr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
Abstract
The invention relates to a CRISPR/Cas9 system knockout poplar PDS gene and application thereof, belonging to the technical field of molecular breeding. The nucleotide sequence of the poplar Phytoene Dehydrogenase (PDS) gene is shown as SEQ ID NO. 1. The target site can realize the fixed-point editing of the PDS gene, and the nucleotide sequence of the target site is shown as SEQ ID NO. 2. The invention provides a new scheme for the gene function research of woody mode plants, establishes a molecular breeding platform of the local tree species populus alba in China, and provides technical support for directionally breeding new forest species which are suitable for the economic development requirements in China.
Description
Technical Field
The invention relates to the technical field of molecular breeding, in particular to application of a PDS gene as a target gene in targeted molecular breeding of populus alba by knocking out endogenous genes of the populus alba through a CRISPR/Cas9 system.
Background
The CRISPR/Cas9 system is being widely studied and applied as a novel gene editing tool. At present, gene editing of part of model tree species is realized, but due to the characteristics of perennial trees, long generation period, high genomic heterozygosity and the like, the problems of poor genetic stability, low genetic transformation efficiency, serious off-target effect and the like still exist in the gene editing process of the trees. Therefore, the genome editing system needs to be further modified and optimized for forest trees.
Disclosure of Invention
The invention aims to provide application of a PDS gene serving as a target gene in targeted molecular breeding of populus alba by knocking out endogenous genes of the populus alba through a CRISPR/Cas9 system. The target site can realize the fixed-point editing of the Populus alba Phytoene Dehydrogenase (PDS) gene, thereby obtaining a Populus alba plant with PDS gene function deletion, and discussing the function of the PDS gene through the research on the mutant plant characters. The invention can promote the gene function research of the local tree species populus alba in China and provides technical support for directionally cultivating new species of forest trees which are suitable for the economic development requirements in China.
The invention provides application of a PDS gene serving as a target gene in targeted molecular breeding of populus alba by knocking out an endogenous gene of the populus alba through a CRISPR/Cas9 system, wherein the nucleotide sequence of the PDS gene is shown as SEQ ID NO. 1.
The invention also provides a target site of the target gene in the technical scheme, and the nucleotide sequence of the target site is shown as SEQ ID NO. 2.
Also provides an adapter primer of the target site in the technical scheme, wherein the adapter primer comprises PDS-gRNA2-F with a nucleotide sequence shown as SEQ ID NO.3 and PDS-gRNA2-R with a nucleotide sequence shown as SEQ ID NO. 4.
The invention also provides a gRNA expression cassette prepared based on the target site or the joint primer in the technical scheme.
The invention also provides a CRISPR/Cas9 system vector prepared based on the target site in the technical scheme, the joint primer in the technical scheme or the gRNA expression cassette in the technical scheme.
The invention also provides application of the target site in the technical scheme, the joint primer in the technical scheme, the gRNA expression cassette in the technical scheme, or the CRISPR/Cas9 vector in the technical scheme in knocking out Populus alba PDS genes.
The invention provides application of a PDS gene serving as a target gene in targeted molecular breeding of populus alba by knocking out an endogenous gene of the populus alba through a CRISPR/Cas9 system. The sequence of the Populus alba PDS gene is taken as a target gene template for screening to obtain a target site, a corresponding Cas9 vector is constructed, the plant of the Populus alba PDS is transferred through agrobacterium mediation, the PDS gene is successfully knocked out, and albino positive seedlings are obtained. Through the fixed-point editing of the PDS gene, the system can be verified to carry out targeted and efficient fixed-point knockout on the populus alba gene, so that the research on the gene function of the populus alba which is a local tree species in China is greatly promoted, and the technical support is provided for directionally cultivating new forest species which are suitable for the economic development requirements in China.
Drawings
FIG. 1 shows the genetic transformation process of Populus alba provided by the present invention;
FIG. 2 shows a regenerated seedling of wild type Populus alba (left) and a regenerated seedling of POpulus alba (right) with PDS gene knocked out, according to the present invention;
FIG. 3 shows the sequence of the PDS gene target site in Populus alba albino seedlings identified by the present invention.
Detailed Description
The invention provides an application of a PDS gene serving as a target gene in targeted molecular breeding of populus alba by knocking out an endogenous gene of the populus alba through a CRISPR/Cas9 system, wherein the nucleotide sequence of the PDS gene is shown as SEQ ID NO. 1:
ATGAGTGCATTGAACTTGAGCTGGCATAGTAAATCATTAGACTCTCAAGTTGCCTTGAGATGTGGCGCTTATCCTACTTGTTCTCACCAAACGAATGCACTAGCTTTTAGAGGCAGTGAATCAATGGGCCATTCTTTGAAATTCCCATTTGGAAATTCTTCTGCTAAAACAAGACTAAGGAATCATATCCGCCCTCCTTTGCGGGTTGTCTGTATGGACTATCCAAGACCGGACCTTGATAACACGGTGAATTTCTTAGAGGCTGCCTTGTTATCTTCATCCTTTCGTTCTTCTCCGCGTCCAGCTAAACCATTAAATGTTGTCATTGCTGGTGCAGGTTTGGCGGGTTTATCGACTGCAAAATACTTGGCAGATGCGGGCCATAAGCCTATATTGCTTGAAGCAAGAGATGTTTTAGGTGGAAAGGTGGCTGCATGGAAAGATGATGATGGAGACTGGTACGAGACAGGCTTGCATATATTCTTTGGGGCATATCCAAATGTGCAGAATCTTTTTGGTGAACTTGGTATCAATGATAGGTTGCAATGGAAGGAGCATTCTATGATATTTGCAATGCCAAATAAGCCAGGAGAATTCAGTCGATTTGATTTTCCTGAAGTTCTCCCTGCACCATTAAATGGGATATTGGCCATTTTAAAGAACAATGAAATGCTGACTTGGCCAGAGAAAGTGAAGTTTGCAATTGGGCTACTTCCAGCAATTGTTGGTGGACAGGCTTATGTTGAGGCTCAAGATGGTTTAAGTGTTCAAGAGTGGATGAGAAAGCAGGGTGTACCTGATAGAGTGACTACTGAGGTGTTTATTGCCATGTCAAAGGCTCTAAACTTTATTAACCCAGATGAGCTTTCAATGCAATGCATTTTGATAGCTTTGAACAGATTTCTTCAGGAGAAACATGGTTCAAAGATGGCTTTCTTGGATGGTAATCCCCCAGAGAGGCTCTGCATGCCAATTGTTGATCATATTCAGTCGCGTGGTGGTGAAGTCAAGCTTAATTCTCGGATAAAGAAGATTGAGCTAAATGATGATGGAACAGTGAAGAGTTTTTTACTAAATACTGGGGATGTGATTGAAGGGGATGTTTATGTGTTTGCCACTCCAGTTGATATCCTGAAGCTTCTTTTGCCTGATAACTGGAAAGAGATTCCTTACTTCAAGAAACTGGAGAAATTAGTTGGAGTTCCTGTTATTAATGTTCACATATGGTTTGACAGGAAACTGAAGAATACATACGATCACCTACTTTTCAGCAGGAGTCCTCTTCTCAGTGTGTATGCTGACATGTCTCTGACATGTAAGGAATATTATGACCCAAATAAATCCATGCTGGAGTTAGTTTTTGCGCCTGCTGAAGAATGGATTTCACGCAGTGACTCAGAGATTATTGATGCTACAATGGGGGAACTCGCAAAACTTTTTCCTGATGAAATATCCGCAGATCAAAGCAAAGCAAAAATCGTGAAGTATCATGTTGTTAAAACTCCAAGGTCGGTTTACAAGACTGTCCCAGATTGTGAACCTTGCCGTCCCTTGCAAAGATCTCCGATAGAGGGTTTCTATTTAGCTGGTGACTACACAAAACAAAAGTACTTGGCTTCAATGGAAGGTGCTGTTCTATCAGGGAAGCTTTGTGCACAGGCAATTATACAGGATTACGAGTTCCTGGTTGCTCGGGGGCAAGGAAGCTTGACTGAGGCAACCATTAGTTAA。
the invention provides a method for performing fixed-point editing on a populus alba gene by using a CRISPR/Cas9 system. The PDS gene is used as a reporter gene to obtain a populus alba plant with PDS gene function deletion, and the function of the PDS gene is studied through the research on the properties of mutant plants. The PDS participates in the synthesis process of the carotenoid, so that the colorless phytoene is converted into the colored carotenoid, and the PDS is a key enzyme in the synthesis process of the carotenoid.
The invention also provides a target site of the target gene in the technical scheme, and the nucleotide sequence of the target site is shown as SEQ ID NO. 2: CCAGAGAGGCTCTGCATGC are provided.
The invention also provides an adapter primer of the target site in the technical scheme, wherein the adapter primer comprises PDS-gRNA2-F with a nucleotide sequence shown as SEQ ID NO.3 and PDS-gRNA2-R with a nucleotide sequence shown as SEQ ID NO. 4. The method for synthesizing the primer is not particularly limited, and the primer can be synthesized by a conventional primer synthesis company well known to those skilled in the art.
The invention also provides a gRNA expression cassette prepared based on the target site or the joint primer in the technical scheme. The method for obtaining the gRNA expression cassette is not particularly limited in the present invention, and a preparation method of the gRNA expression cassette known to those skilled in the art may be used.
The invention also provides a CRISPR/Cas9 system vector prepared based on the target site in the technical scheme, the joint primer in the technical scheme or the gRNA expression cassette in the technical scheme. The type and the preparation method of the vector are not particularly limited, and the conventional vector of the CRISPR/Cas9 system is adopted for conventional preparation.
The invention also provides application of the target site in the technical scheme, the joint primer in the technical scheme, the gRNA expression cassette in the technical scheme, or the CRISPR/Cas9 vector in the technical scheme in knocking out Populus alba PDS genes.
The application of the PDS gene as a target gene in targeted molecular breeding of populus alba by knocking out its endogenous gene through the CRISPR/Cas9 system will be described in further detail with reference to the following embodiments, and the technical solution of the present invention includes, but is not limited to, the following embodiments.
Example 1
An experiment preparation stage:
plant material: tissue culture seedling of Populus alba
Thalli and carrier: pYLsgRNA-AtU 6-29; pYLCRISPR/Cas 9-DH; DH10b E.coli competence; EHA105 agrobacterium.
Experimental reagent: plant RNA extraction kit, reverse transcription kit, DNA rapid recovery and purification kit, pCloneEZ-Blunt-Kan/HCKit, gold medal Mix, 2xHeffTMPCRMastermix, T4DNA ligase, restriction endonuclease BsaI, double distilled water (ddH2O), Sucrose (Sucrose), Agar powder (Agar), Acetosyringone (AS), Zeatin (ZT), naphthylacetic acid (NAA), 6-benzylaminopurine (6-BA), indoleacetic acid (IBA), cephamycin (Cef), hygromycin (Hyg), kanamycin (Kan), rifampicin (Rif), Woody Plant basic Medium with Vitamins (WPM), Luria-Bertani Culture (LB) Yeast Extract Medium Manual Broth (YEB), 1/2MS (1/2MS)
An experimental instrument: PCR instrument, constant temperature incubator, shaking table, super clean bench, ultraviolet spectrophotometer, centrifuge
Preparation work: test tubes, test tube stoppers, 1.5ml Ep tubes, 250ml Erlenmeyer flasks, scissors, tweezers, filter paper, etc. were sterilized in advance.
Target site linker primer design
Designing a joint primer according to the sequence of the target site: PDS-gRNA2-F: 5'-ATTGGCATGCAGAGCCTCTCTGG-3' (SEQ ID NO.3), PDS-gRNA2-R: 5'-AAACCCAGAGAGGCTCTGCATGC-3' (SEQ ID NO. 4). The adaptor primers were dissolved in TE to 100. mu.M of the mother solution, and 1. mu.l of each was added to 98. mu.l of a 0.5 XTE solution. Then, 25. mu.l of each sample was aspirated at 90 ℃ for 30 seconds, and the sample was transferred to room temperature for annealing to form a target site linker for use.
gRNA expression cassette preparation
The pYLsgRNA-AtU6-29 vector is digested by BsaI, and the digestion system is as follows: pYLsgRNA-AtU6-29 plasmid: 1 mu g of the solution; 10X CutSmart Buffer: 5 mu l of the solution; bsa I: 10 units; nuclean-free Water was supplemented to 50. mu.l. The enzyme digestion reaction is carried out for 30min at 37 ℃, and the enzyme is inactivated for 5min at 70 ℃.
The target site linker in 4 was ligated into the pYLsgRNA-AtU6-29 vector using T4DNA ligase as follows: 10x T4DNA ligase buffer: 1 mul; pYLsgRNA-AtU6-29 plasmid: 0.5 mul; target site linker: 1 mul; t4DNA ligase: 0.5 mul; supplemental ddH2O to 10. mu.l, and reacted at room temperature for 30 min.
The gRNA expression cassette was amplified by nested PCR, as follows: (1) the T4 ligation product was used as a template for the first round of PCR amplification using UF/PDS-gRNA2-R and PDS-gRNA2-F/gRNA-R primers, respectively. The primer sequences are as follows: UF: CTCCGTTTTACCTGTGGAATCG (SEQ ID NO. 5); gRNA-R: CGGAGGAAAATTCCATCCAC (SEQ ID NO. 6); PDS-gRNA2-F: ATTGGCATGCAGAGCCTCTCTGG (SEQ ID NO. 3); PDS-gRNA2-R: AAACCCAGAGAGGCTCTGCATGC (SEQ ID NO. 4). The PCR amplification system is as follows: gold medal Mix: 22.0 μ l; ForwardPrimer: 1.0 μ l; ReverePrimer: 1.0 μ l; connecting products: 1 μ l. And (3) amplification procedure: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 15s, extension at 72 ℃ for 40s, 28 cycles; extending for 2min at 72 ℃; 25 ℃ and End. (2) Mu.l of each first PCR product was diluted 10-fold with ddH2O, and 1. mu.l of each was mixed as a template using primers CAS 9-F: ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTGGAATCGGCAGCAAAGG (SEQ ID NO.7), CAS 9-R: TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTCCATCCACTCCAAGCTCTTG (SEQ ID NO.8), the PCR amplification system was as follows: mixing the templates: 2 mu l of the solution; gold medal Mix: 22 mu l of the solution; CAS 9-F: 1 mul; CAS 9-R: 1 μ l. And (3) amplification procedure: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, extension at 72 ℃ for 50s, and 35 cycles; extending for 5min at 72 ℃; 25 ℃ and End. The PCR product is the gRNA expression cassette.
The gRNA expression cassette is linked to pYLCRISPR/Cas9-DH
The pYLCRISPR/Cas9-DH vector was digested with BsaI in the following manner: pYLCRISPR/Cas9-DH plasmid: 5 mu g of the solution; 10 XCutSmartBuffer: 5 mu l of the solution; BsaI: 1 mul; Nuclean-freeWater was supplemented to 50. mu.l. The enzyme digestion reaction is carried out for 1h at 37 ℃, and the enzyme is inactivated for 5min at 70 ℃. The gRNA expression cassette was ligated into pYLCRISPR/Cas9-DH vector using the SeamlessAssemblyCloning kit (Zhongmei and, Beijing) as follows: gRNA expression cassette: 4 mu l of the solution; pYLCRISPR/Cas9-DH linearized vector: 1 mul; 2 × seamlessmastermix:5 μ l. After a reaction at 50 ℃ for 15min, DH10b was transformed by heat shock at 42 ℃ in an ice bath. Sequencing and screening positive clones, extracting plasmids, and transforming agrobacterium EHA105 for genetic transformation of the populus alba.
Genetic transformation of populus alba
Shaking and culturing the agrobacterium liquid at 28 ℃ to OD6000.8. Taking 200 mul of bacterial liquid to be shake-cultured in 200ml of fresh YEB antibiotic-free liquid culture medium at 28 ℃ to OD6000.8. Centrifuging at 4000rpm and 4 deg.C for 10min, and collecting thallus at the bottom of the tube. Resuspending the cells in WPM resuspension medium, shake-culturing at 28 deg.C for 1-2h (adjusted to OD)600Approximately equal to 0.4-0.6), and temporarily storing the bacterial liquid on ice for infection.
The genetic transformation process of populus alba is as follows:
selecting leaves and stem segments of about 4 weeks of sterile tissue culture seedlings of populus alba, cutting the leaves into small blocks with the side length of 0.5cm, cutting the stem segments into small segments with the length of 0.5cm, and soaking the small segments in the bacterial liquid prepared in the last step for about 13min for infection.
The infected leaves and stem segments were blotted with sterile filter paper, spread on CM1 medium and cultured in the dark at 25 ℃ for 2 days.
The leaves and stem sections after dark culture were transferred to CM2 medium, dark culture was carried out at 25 ℃ for 4-5 weeks, during which the medium was changed every 2 weeks.
When the leaf and stem edges appeared to have a yellowish or white mass of callus, it was transferred to CM3 medium under the following conditions: the light intensity was 2000lx, the temperature was 25 ℃, and the light period was 16/8 h. Transferring to CM4 culture medium until callus has adventitious bud, and culturing under the following conditions: the light intensity was 2000lx, the temperature was 25 ℃, and the light period was 16/8 h.
When the adventitious bud grows to about 2CM, the bud is cut off and transferred to a CM5 culture medium to induce adventitious roots.
The medium formulation is shown in table 1:
TABLE 1 culture Medium formulation
And adding agar powder after the pH value of all the culture media is 5.80-6.00, and sterilizing for 20 minutes at 121 ℃. And adding antibiotics and hormone which does not resist high temperature after sterilization. The tissue culture conditions of each stage of the obtained regeneration plant of the populus alba are shown in figure 1, and figure 1 shows the genetic transformation process of the populus alba (wherein, 1, co-culture, 2, selection culture, 3, bud culture I, and 4, CM4 bud culture II, specifically, 1, the co-culture stage is that infected leaves are cultured on a CM1 culture medium for 2 days in a dark mode, 2, the selection culture stage is that the leaves are transferred to a CM2 culture medium for about 5 weeks to form faint yellow or white cluster callus, 3, the bud culture I stage is that the callus is transferred to a CM3 culture medium and cultured on light for about 4 weeks to form adventitious buds, and 4, CM4 bud culture II stage is that the callus with adventitious buds is transferred to a CM4 culture medium and cultured on light for about 3 weeks to continue to develop the adventitious buds).
Identification of Populus alba PDS gene knockout plant
The knockout of the PDS gene results in the albino phenotype of the plant. In the present invention, after tissue culture of Populus alba explants, the differentiated regenerated seedlings appeared to be whitened compared to wild type (FIG. 2, wild type Populus alba regenerated seedling (left) and PDS gene-knocked Populus alba regenerated seedling (right)), indicating that PDS gene has failed to function normally in Populus alba bodies. Extracting genome DNA of albino plants as a template, performing PCR amplification on a target site sequence by using primers PDS-JC1: TCCGAAGCACCTAACTCA (SEQ ID NO.9) and PDS-JC 3: TCTTTCCAGTTATCAGGCAAA (SEQ ID NO.10), connecting an amplification product with a pCloneEZ-Blunt vector, transforming Escherichia coli DH10b, selecting a single clone for sequencing, and displaying a sequencing result that two basic groups are deleted at the target site of the PDS gene of the transgenic plants (figure 3, identifying the sequence at the target site of the PDS gene in the albino poplar seedlings), and the deletion of two basic groups is generated at the target site of the PDS gene of the albino poplar seedlings, so that the frame shift mutation of the PDS gene is generated, and the PDS gene is successfully knocked out in the poplar bodies.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> scientific research institute of forestry in China
<120> CRISPR/Cas9 systematic knockout Populus alba PDS gene and application thereof
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1731
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgagtgcat tgaacttgag ctggcatagt aaatcattag actctcaagt tgccttgaga 60
tgtggcgctt atcctacttg ttctcaccaa acgaatgcac tagcttttag aggcagtgaa 120
tcaatgggcc attctttgaa attcccattt ggaaattctt ctgctaaaac aagactaagg 180
aatcatatcc gccctccttt gcgggttgtc tgtatggact atccaagacc ggaccttgat 240
aacacggtga atttcttaga ggctgccttg ttatcttcat cctttcgttc ttctccgcgt 300
ccagctaaac cattaaatgt tgtcattgct ggtgcaggtt tggcgggttt atcgactgca 360
aaatacttgg cagatgcggg ccataagcct atattgcttg aagcaagaga tgttttaggt 420
ggaaaggtgg ctgcatggaa agatgatgat ggagactggt acgagacagg cttgcatata 480
ttctttgggg catatccaaa tgtgcagaat ctttttggtg aacttggtat caatgatagg 540
ttgcaatgga aggagcattc tatgatattt gcaatgccaa ataagccagg agaattcagt 600
cgatttgatt ttcctgaagt tctccctgca ccattaaatg ggatattggc cattttaaag 660
aacaatgaaa tgctgacttg gccagagaaa gtgaagtttg caattgggct acttccagca 720
attgttggtg gacaggctta tgttgaggct caagatggtt taagtgttca agagtggatg 780
agaaagcagg gtgtacctga tagagtgact actgaggtgt ttattgccat gtcaaaggct 840
ctaaacttta ttaacccaga tgagctttca atgcaatgca ttttgatagc tttgaacaga 900
tttcttcagg agaaacatgg ttcaaagatg gctttcttgg atggtaatcc cccagagagg 960
ctctgcatgc caattgttga tcatattcag tcgcgtggtg gtgaagtcaa gcttaattct 1020
cggataaaga agattgagct aaatgatgat ggaacagtga agagtttttt actaaatact 1080
ggggatgtga ttgaagggga tgtttatgtg tttgccactc cagttgatat cctgaagctt 1140
cttttgcctg ataactggaa agagattcct tacttcaaga aactggagaa attagttgga 1200
gttcctgtta ttaatgttca catatggttt gacaggaaac tgaagaatac atacgatcac 1260
ctacttttca gcaggagtcc tcttctcagt gtgtatgctg acatgtctct gacatgtaag 1320
gaatattatg acccaaataa atccatgctg gagttagttt ttgcgcctgc tgaagaatgg 1380
atttcacgca gtgactcaga gattattgat gctacaatgg gggaactcgc aaaacttttt 1440
cctgatgaaa tatccgcaga tcaaagcaaa gcaaaaatcg tgaagtatca tgttgttaaa 1500
actccaaggt cggtttacaa gactgtccca gattgtgaac cttgccgtcc cttgcaaaga 1560
tctccgatag agggtttcta tttagctggt gactacacaa aacaaaagta cttggcttca 1620
atggaaggtg ctgttctatc agggaagctt tgtgcacagg caattataca ggattacgag 1680
ttcctggttg ctcgggggca aggaagcttg actgaggcaa ccattagtta a 1731
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccagagaggc tctgcatgc 19
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
attggcatgc agagcctctc tgg 23
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aaacccagag aggctctgca tgc 23
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctccgtttta cctgtggaat cg 22
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cggaggaaaa ttccatccac 20
<210> 7
<211> 49
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
accggtaagg cgcgccgtag tgctcgacta gtggaatcgg cagcaaagg 49
<210> 8
<211> 54
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tagctcgaga ggcgcgccaa tgataccgac gcgtccatcc actccaagct cttg 54
<210> 9
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tccgaagcac ctaactca 18
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tctttccagt tatcaggcaa a 21
Claims (1)
1.PDSGene as target gene, and application of gene in targeted molecular breeding of populus alba by knocking out endogenous gene of populus alba through CRISPR/Cas9 systemBy using the followingPDSThe nucleotide sequence of the gene is shown as SEQ ID NO. 1;
the nucleotide sequence of the target site is shown as SEQ ID NO. 2;
the joint primer is shown in SEQ ID NO.3 as a nucleotide sequencePDSthe-gRNA 2-F and the nucleotide sequence are shown in SEQ ID NO.4PDS-gRNA2-R；
The targeted molecular breeding of the populus alba is to obtain the whitening phenotype of the populus alba.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010083041.7A CN111235177B (en) | 2020-02-07 | 2020-02-07 | Populus alba PDS gene knocked out by CRISPR/Cas9 system and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010083041.7A CN111235177B (en) | 2020-02-07 | 2020-02-07 | Populus alba PDS gene knocked out by CRISPR/Cas9 system and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111235177A CN111235177A (en) | 2020-06-05 |
| CN111235177B true CN111235177B (en) | 2022-03-29 |
Family
ID=70876852
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010083041.7A Active CN111235177B (en) | 2020-02-07 | 2020-02-07 | Populus alba PDS gene knocked out by CRISPR/Cas9 system and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111235177B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111979264B (en) * | 2020-08-27 | 2023-08-08 | 湖南美可达生物资源股份有限公司 | Construction method and application of PDS gene editing system of macleaya cordata based on CRISPR/Cas9 system |
| CN112375781B (en) * | 2020-11-08 | 2023-05-02 | 浙江大学 | Application of pC1300-MAS-Cas9 gene editing system in 84K poplar gene editing |
| CN113355337B (en) * | 2021-04-14 | 2023-06-20 | 河南农业大学 | Method for creating rehmannia hybrid mutant and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486111A (en) * | 2018-04-04 | 2018-09-04 | 山西医科大学 | The method and its specificity sgRNA of CRISPR-Cas9 targeting knock out people's SMYD3 genes |
| CN110628934A (en) * | 2019-10-23 | 2019-12-31 | 四川大学 | Populus alba sex determining gene and application thereof in identifying Populus alba sex |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014194190A1 (en) * | 2013-05-30 | 2014-12-04 | The Penn State Research Foundation | Gene targeting and genetic modification of plants via rna-guided genome editing |
-
2020
- 2020-02-07 CN CN202010083041.7A patent/CN111235177B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486111A (en) * | 2018-04-04 | 2018-09-04 | 山西医科大学 | The method and its specificity sgRNA of CRISPR-Cas9 targeting knock out people's SMYD3 genes |
| CN110628934A (en) * | 2019-10-23 | 2019-12-31 | 四川大学 | Populus alba sex determining gene and application thereof in identifying Populus alba sex |
Non-Patent Citations (3)
| Title |
|---|
| Efficient CRISPR/Cas9-mediated Targeted Mutagenesis in Populus in the First Generation;Fan D, Liu T, Li C, et al;《Scientific reports》;20150720;12217 * |
| 利用CRISPR/Cas9系统定点敲除杨树和烟草PDS基因的研究;李媛;《中国优秀硕士学位论文全文数据库》;20170615;A006-17 * |
| 应用 CRISPR/Cas9 技术在杨树中高效敲除多个靶基因;刘婷婷等;《遗传》;20151031;第37卷(第10期);1044-1052页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111235177A (en) | 2020-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111235177B (en) | Populus alba PDS gene knocked out by CRISPR/Cas9 system and application thereof | |
| CN109652422B (en) | Efficient single-base editing system OsSpCas9-eCDA and application thereof | |
| CN110283838B (en) | ScCas9 gene with high shearing efficiency and application thereof | |
| CN112538492B (en) | SpCas9n variant capable of recognizing NRTH (Polyacrylamide) as PAM (Polyacrylamide) sequence and corresponding base editing system | |
| CN110878305B (en) | Wide-window single-base editing gene and application and breeding method thereof | |
| WO2019143077A1 (en) | Method for increasing efficiency of homologous recombination-based gene editing in plant | |
| CN111979264A (en) | Construction method and application of Macleaya cordata PDS gene editing system based on CRISPR/Cas9 system | |
| CN111718954B (en) | Genome editing tool and application thereof | |
| CN113801891B (en) | Construction method and application of beet BvCENH3 gene haploid induction line | |
| CN113265403A (en) | Soybean Dt1 gene editing site and application thereof | |
| CN111961679A (en) | Nucleotide sequence of macleaya cordata phytoene dehydrogenase gene and application thereof | |
| CN115287296A (en) | Application of OsJMJ711 gene in improvement of rice grain number per ear trait | |
| CN111961677B (en) | Method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type and application | |
| CN111235181B (en) | Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof | |
| CN109486840B (en) | Codon-plant-modified NmeCas9 gene and application thereof | |
| CN108841853B (en) | Carrot genetic transformation method using glyphosate as screening agent | |
| CN113493803A (en) | Alfalfa CRISPR/Cas9 genome editing system and application thereof | |
| WO2020055084A1 (en) | Virus-based replicon for editing genome without inserting replicon into plant genome, and use thereof | |
| CN112430612A (en) | SpRY gene capable of being efficiently cut and application thereof | |
| CN113430194B (en) | White birch gene editing method based on CRISPR/Cas9 | |
| CN115820691B (en) | LbCPf1 variant-based rice base editing system and application | |
| CN114875064B (en) | Hybrid sweetgum gene editing vector, construction method and application thereof | |
| CN112575014B (en) | Base editor SpCas9-LjCDAL1 and construction and application thereof | |
| CN116064509B (en) | Plant constitutive promoter CEPro432 and application thereof | |
| CN110257406B (en) | codon-Plant-modified Plant Nme2Cas9 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |