CN111218452A

CN111218452A - Recombinant human TSG-6 gene, recombinant human TSG-6 protein standard, and preparation methods and applications thereof

Info

Publication number: CN111218452A
Application number: CN202010116879.1A
Authority: CN
Inventors: 王明丽; 何志远; 吴博; 蒋敏之; 夏兵兵; 周炜
Original assignee: Wuhu Tianming Biotechnology Co ltd
Current assignee: Wuhu Tianming Biotechnology Co ltd
Priority date: 2020-02-25
Filing date: 2020-02-25
Publication date: 2020-06-02
Anticipated expiration: 2040-02-25
Also published as: CN111218452B

Abstract

The invention discloses a recombinant human TSG-6 gene, a recombinant human TSG-6 protein standard substance, a preparation method and an application thereof, wherein the recombinant human TSG-6 gene is optimized, cloned into a pET-32a expression vector and transformed into escherichia coli, induced expression is carried out after culture, a recombinant human TSG-6 protein crude product can be obtained by washing, denaturation and renaturation of expressed thalli, the recombinant human TSG-6 protein pure product is obtained after separation and purification, and the recombinant human TSG-6 protein standard substance is prepared by freeze drying after being mixed with a freeze-drying protective agent; compared with the prior art, the invention realizes the high-efficiency expression of the recombinant human TSG-6 protein through codon optimization, realizes the batch preparation of the recombinant human TSG-6 protein standard substance, and can ensure that the titer detection result of the recombinant human TSG-6 protein measured in different batches is more reliable and credible by taking the standard substance as a standard.

Description

Recombinant human TSG-6 gene, recombinant human TSG-6 protein standard, and preparation methods and applications thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a recombinant human TSG-6 gene, a recombinant human TSG-6 protein standard substance, and a preparation method and application thereof.

Background

tumor necrosis factor α -stimulating gene 6 (TSG-6) is an inflammation-associated secretory protein, is produced by mesenchymal stem cells or stromal cells (MSCs) in response to inflammatory signals, and is highly expressed in a variety of inflammatory diseases or inflammatory-like pathological processes.

TSG-6 is encoded by TNFAIP6(tumor necrosis factor-induced gene 6 protein, TNFAIP6) gene, and is a novel gene discovered by Lee et al in screening human diploid FS-4 fibroblast cDNA library interfered by tumor necrosis factor α.

TSG-6 gene is mainly composed of two adjacent components, i.e., Link component and CUB component, wherein the Link component is responsible for recognition of signal molecules, binding to Hyaluronic Acid (HA), chondroitin sulfate, proteoglycan and G1 chain of proteoglycan, etc., and CUB plays its biological role as a functional region, TSG-6 gene promoter sequence HAs binding sites for activator protein 1 (AP-1) and nuclear factor interleukin (NF-IL6), which is significantly increased in fibroblast expression when stimulated by inflammatory factors such as TNF- α, interleukin-1 (IL-1), etc., and thus is considered as a gene regulated by inflammatory factors such as TNF- α, TSG-6 gene is located on human chromosome 2q 233, mRNA 1440bp, its encoded protein contains 277 amino acid residues, belongs to the family of hyaluronic acid binding proteins, HAs various roles including inhibition of neutrophil migration, regulation of protein network, etc., a protein involved in TNF- α reaction, induction of inflammatory response, regulation of inflammatory response, inflammatory cell remodeling, and many kinds of inflammatory cell adhesion, and a function of extracellular matrix, and a plurality of inflammatory cell adhesion, and a plurality of inflammatory cell mediated by a plurality of inflammatory cell adhesion, and a plurality of inflammatory response, and a plurality of inflammatory cell.

A large number of researches show that TSG-6 is an anti-inflammatory factor with obvious effect, and in the inflammatory processes of hepatitis, arthritis, retinitis, tissue injury, keloid and the like, TSG-6 can inhibit the expression of inflammatory factors TNF- α, IL-1 β, IL-6 and the like, has the functions of inhibiting neutrophil infiltration and the like, and plays a strong anti-inflammatory role.

Although the research of TSG-6 and the biological function thereof are increasingly regarded, reports that the recombinant protein has antiviral activity and a preparation method for preparing a standard product thereof on a large scale are not found so far. The invention discovers for the first time that recombinant human TSG-6(recombinant human TSG-6, rhTSG-6) has antiviral activity in vitro and in vivo. Filling the blank of the field.

Disclosure of Invention

The invention provides a recombinant human TSG-6 gene, a recombinant human TSG-6 protein standard substance, and a preparation method and application thereof. The method specifically comprises the following steps: after the existing recombinant human TSG-6 gene is optimized, the gene is cloned into a pET-32a expression vector and is transformed into Escherichia coli. Inducing expression after culturing; washing, denaturing and renaturing the expressed thallus to obtain recombinant human TSG-6 protein; and then the recombinant human TSG-6 protein pure product is obtained after separation and purification. And then mixing with a freeze-drying protective agent, and freeze-drying to prepare the recombinant human TSG-6 protein standard. The invention realizes the high-efficiency expression of the recombinant human TSG-6 protein through codon optimization and realizes the batch preparation of the recombinant human TSG-6 protein standard substance. Meanwhile, the invention provides a detection result system which is based on the phenomenon that rhTSG-6 can protect MDBK cells but not limited to the cells from VSV virus, but not limited to the invasion effect of the virus, namely, a method for detecting the antiviral activity of rhTSG-6 in vitro by adopting a cytopathic inhibition method. The method can accurately and objectively observe and detect the antiviral activity of the TSG-6, and has high repeatability and accuracy. The rhTSG-6 standard substance has the titer against VSV virus as high as about 1000.00U/mL through the verification of the method.

The rhTSG-6 standard substance detected by the cytopathic effect inhibition method can inhibit the cytopathic effect of cells infected with VSV virus, and the detection result of the titer of the recombinant human TSG-6 protein measured in different batches can be more reliable and credible by taking the standard substance as the standard of the evaluation result.

The technical scheme adopted by the invention is as follows:

a recombinant human TSG-6 gene, the SEQUENCE of the recombinant human TSG-6 gene is shown in SEQUENCE testing 400 (2).

The amino acid sequence of the recombinant human TSG-6 protein coded by the recombinant human TSG-6 gene is shown in SEQUENCELLING 400 < 3 >. The N-terminal 16 amino acid residues are deleted from the amino acid residue sequence, the partial sequence is a signal peptide sequence which is not beneficial to the expression of rhTSG-6 in a prokaryotic system, and the expression quantity of the recombinant human TSG-6 provided by the invention is 100 times higher than that of the prior art.

The invention also provides a preparation method of the recombinant human TSG-6 protein standard substance, which comprises the following steps:

(1) carrying out codon optimization on rare codons such as AGG, AGA, ATA, CTA, CGA, CGG, CCC, UCG and the like in the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <1 > to obtain the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <2 >, and improving the codon adaptation index and the expression level of the target protein through optimization;

(2) subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector, converting the subcloned recombinant human TSG-6 gene into BL21(DE3) escherichia coli, and coating an LB plate containing ampicillin to culture overnight to obtain recombinant human TSG-6 recombinant bacteria BL21/pET32 a-rhTSG-6;

(3) carrying out amplification culture on the recombinant human TSG-6 recombinant bacteria, carrying out IPTG induced expression, and then collecting thalli;

(4) crushing the thalli collected in the step (3), centrifuging, collecting precipitate, washing, denaturing and renaturing the precipitate to obtain a crude product of the recombinant human TSG-6 protein;

(5) separating and purifying the recombinant human TSG-6 protein crude product to obtain a recombinant human TSG-6 protein pure product;

(6) and mixing the pure recombinant human TSG-6 protein with a freeze-drying protective agent, and freeze-drying to obtain the recombinant human TSG-6 protein standard substance.

Further, the step (2) further comprises the step of carrying out PCR and BamH I and HindIII double enzyme digestion identification on a single colony obtained by culturing on an LB plate, and the successful construction of the recombinant human TSG-6 recombinant bacterium is indicated if the identification result is positive.

Designing head and tail primers by using Primer Premier 5 software according to a target gene sequence, wherein the primers during PCR identification are as follows:

F1：GGATCCTGGGGTTTTAAAGATGGC；

R1：AAGCTTTTACAGATGACTAAAGCGAC。

in the step (3), the culture medium used for the amplification culture is an LB culture medium containing 100 mu g/mL ampicillin; culturing to OD value of 0.6-0.8, and inducing expression with IPTG with final concentration of 1.0mM at 30 deg.C for 5 h.

In the step (5), the separation and purification method comprises the following steps: filtering the recombinant human TSG-6 protein crude product, purifying the filtered recombinant human TSG-6 protein crude product by a His-tag affinity chromatographic column, collecting the purified recombinant human TSG-6 protein, dialyzing, and then adjusting the pH value to 5.0; and purifying by an anion exchange chromatography column to obtain the recombinant human TSG-6 protein.

In step (5), the eluent used for the purification of the His-tag affinity chromatography column is a mixture of 50mM Tris-Cl and 500mM imidazole, and the pH value is 8.0.

In the step (6), the lyoprotectant is PBS mixed liquor with the final concentration of 100mL/L of glycerin, 0.12g/mL of mannitol and 0.025g/mL of sucrose.

The invention also provides a recombinant human TSG-6 protein standard substance prepared by the preparation method.

The invention also provides the application of the recombinant human TSG-6 protein standard substance in antiviral drugs, the antiviral activity of the recombinant human TSG-6 protein standard substance is determined on the basis of an MDBK/VSV titer determination system, and the result shows that the recombinant human TSG-6 protein standard substance can inhibit the cytopathy of VSV virus infected cells, and the recombinant human TSG-6 protein standard substance has the activity of resisting the VSV virus, and the titer of the recombinant human TSG-6 protein standard substance is 1.59 multiplied by 10³IU/mL。

The invention discovers for the first time that recombinant human TSG-6(recombinant human TSG-6, rhTSG-6) has antiviral activity in vitro and in vivo. The rhTSG-6 antiviral activity phenomenon is detected by taking the phenomenon that rhTSG-6 inhibits virus cytopathic effect (CPE) as a result of detecting the activity of the rhTSG-6, namely, the reciprocal of the dilution which can still protect half of cells (50%) from the attack of virus by the highest dilution of a rhTSG-6 test sample per milliliter is defined as rhTSG-6 unit (or titer), and is often expressed by unit (U). The result is observed by staining the survival MDBK cells with crystal violet, and the antiviral activity of the rhTSG-6 is calculated according to the Reed-Muench formula according to the shade of the staining.

The invention has the following advantages:

1. the high-efficiency expression of the recombinant human TSG-6 protein is realized by codon optimization and deletion of a signal peptide sequence with 16 amino acid residues at the N end, and the prokaryotic expression yield of the recombinant human TSG-6 protein is improved by 100 times compared with that of the domestic known prokaryotic expression of the recombinant human TSG-6 protein.

2. The invention discovers for the first time that the prepared recombinant human TSG-6 protein standard has activity against VSV virus on an in vitro MDBK/VSV titer determination system.

3. The recombinant human TSG-6 protein standard substance has higher purity than that of a recombinant protein prepared by common escherichia coli through affinity chromatography and anion exchange chromatography, and the purity reaches more than 90%.

4. The recombinant Escherichia coli BL21/pET32a-rhTSG-6 is used as an expression strain, has the advantages of low production cost, high yield and the like, and is suitable for large-scale industrial production.

Drawings

FIG. 1 shows the result of PCR identification of the optimized recombinant human TSG-6 gene, wherein the ratio of lane M: DNA MarkerDL 2000; lane 1: negative control; lanes 2-5: the PCR identification result of the optimized recombinant human TSG-6 gene;

FIG. 2 shows the results of the double restriction enzyme identification of the recombinant plasmid pET32 a-rhTSG-6; wherein M is DNA MarkerDL 2000; lane 1 shows the results of double digestion with BamHI and HindIII on the recombinant plasmid pET32a-rhTSG-6,

lanes

2 and 3 show the results of single digestion with BamHI and HindIII on the recombinant plasmid pET32a-rhTSG-6, respectively, and lane 4 shows the negative control of recombinant plasmid pET32 a-rhTSG-6;

FIG. 3 shows SDS-PAGE results of recombinant human TSG-6 protein induced by expression using 1.0mM IPTG at 30 ℃; wherein M is a protein marker, a lane 1 is empty carrier thallus total protein obtained by induction under the same condition, and a lane 2 is total protein expressed by thallus after the recombinant human TSG-6 engineering bacteria are induced for 5 hours; lane 3 is the precipitate after the thallus is broken after being induced by the recombinant human TSG-6 engineering bacteria for 5h, and lane 4 is the supernatant after the thallus is broken after being induced by the recombinant human TSG-6 engineering bacteria for 5 h.

FIG. 4 shows the result of detecting the expression of recombinant human TSG-6 protein, wherein M is protein marker, Lane 1 is empty vector total protein obtained by induction under the same conditions, Lane 2 is the supernatant of disrupted recombinant human TSG-6 engineering bacteria after 5h induction, Lane 3 is the precipitate of disrupted recombinant human TSG-6 engineering bacteria after 5h induction;

FIG. 5 shows the result of identifying recombinant human TSG-6 protein by Western Blot; wherein M is a protein marker, a lane 1 is total protein obtained by crushing empty vector thalli, and a lane 2 is a recombinant human TSG-6 protein sample;

FIG. 6 shows the SDS-PAGE result after the purification of the recombinant human TSG-6 protein; wherein M is a protein marker, Lane 2 is a recombinant human TSG-6 protein solution before purification, Lane 3 is a purified recombinant human TSG-6 protein standard;

FIG. 7 shows titer titration results of recombinant human TSG-6 protein standard, in which A is recombinant human interferon α standard and B is recombinant human TSG-6 protein standard.

Detailed Description

The present invention will be described in detail with reference to examples.

Example 1

A preparation method of a recombinant human TSG-6 protein standard comprises the following steps:

(1) the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <1 > reported in Genebank is subjected to codon optimization, and the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <2 > is obtained by using a chemical synthesis method, wherein the Codon Adaptation Index (CAI) before optimization is 0.73, and the CAI after optimization is 0.97.

(2) Subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector, converting the expression vector into BL21 escherichia coli, coating an LB plate containing ampicillin for overnight culture, selecting a single colony on the LB plate to perform PCR and BamH I and HindIII double enzyme digestion identification, and if the result is positive, indicating that the construction of the expression vector is successful, obtaining recombinant human TSG-6 recombinant bacteria; the PCR amplification and double digestion products show a single band near 800bp by agarose gel electrophoresis of lane No. 1, as shown in FIGS. 1 and 2;

the PCR identification primer is:

F1：GGATCCTGGGGTTTTAAAGATGGC(BamH Ⅰ)；

R1：AAGCTTTTACAGATGACTAAAGCGAC(Hind Ⅲ)。

(3) selecting recombinant human TSG-6 recombinant bacteria, carrying out shake culture in an LB culture medium containing 100 mu g/mL ampicillin, carrying out amplification culture in the LB culture medium containing 100 mu g/mL ampicillin for 2-3 h, adding 1.0mM IPTG (isopropyl-beta-thiogalactoside) with final concentration when OD (OD) value is measured to be 0.6-0.8, carrying out induced expression at 30 ℃ for 5h, and collecting bacteria; through SDS-PAGE electrophoretic analysis, as shown in figure 3, the mycoprotein after IPTG induced expression for 5h can see a dominant expression band at the position of 45.0kD, and the expression amount reaches 60 percent; through Western blot identification, as shown in figure 5, the mycoprotein after IPTG induced expression for 5h can perform specific reaction with rabbit anti-human TSG-6 polyclonal antibody, a specific band appears at about 45kD, and the specificity is high;

the Western blot identification method comprises the following steps: rabbit anti-human TSG-6 polyclonal antibody of Abcam company is used as a primary antibody (diluted 1: 500), and goat anti-rabbit IgG labeled by HRP of China fir Jinqiao company is used as a secondary antibody (diluted 1: 50000).

(4) Resuspending the thallus collected in the step (3) by using 200mL of PBS, and ultrasonically breaking the bacterial precipitate at 4 ℃, wherein the ultrasonic conditions are as follows: power: 400W, working for 3S, performing ultrasonic treatment at intervals of 3S for 6min, and repeating for 3-4 times; centrifuging at 12000r/min for 20min to separate supernatant and precipitate, and subjecting the separated inclusion body precipitate to inclusion, washing, denaturation and renaturation to obtain renaturated product, i.e. crude product of recombinant human TSG-6 protein. The precipitate, supernatant and thallus were separately collected and examined by SDS-PAGE electrophoresis, as shown in FIG. 4. The recombinant protein is expressed as inclusion body through SDS-PAGE electrophoretic analysis.

The method for washing, denaturation and renaturation comprises the following steps:

washing, namely using a washing buffer solution (50mmol/L Tris, 100mmol/L NaCl, 2mol/L urea, 1mmol/LEDTA, 0.5 percent TritonX-100 and pH8.0) to carry out heavy suspension on the inclusion body (10g) at a wet-weight-volume ratio of 1: 20, washing for 2h, centrifuging at 12000r/min for 20min, taking the precipitate, and repeating the washing once again;

② denaturation, namely weighing the wet weight (4.8g) of the washed precipitate, then re-suspending the precipitate (240ml) by a dissolving buffer solution (50mmol/L Tris, 100mmol/L NaCl, 7mol/L guanidine hydrochloride, 0.1 percent β -mercaptoethanol and pH of 8.45) according to the wet weight-to-volume ratio of 1: 50, placing the precipitate on a magnetic stirrer overnight, and fully dissolving the precipitate;

and thirdly, diluting and renaturing, namely preparing a renaturation buffer solution (50mmol/L Tris, 100mmol/L NaCl, 1mmol/L GSH, 0.2mmol/L GSSG and pH8.0) for renaturation, taking the dissolved protein solution, centrifuging at 12000r/min for 20min, taking supernatant, adding the renaturation buffer solution (250 ml renaturation buffer solution) with the same volume, standing for 3h at 4 ℃, adding the renaturation buffer solution for diluting to 4 times of the original volume (500 ml renaturation buffer solution is added), standing for 3h at 4 ℃, finally adding the renaturation buffer solution for diluting to 5 times of the original volume (250 ml renaturation buffer solution is added), and standing for 3h at 4 ℃.

(5) Filtering the crude product of the recombinant human TSG-6 protein, passing the crude product through a His-tag affinity chromatographic column, performing gradient elution by using Elutionbuffer (50mM Tris-Cl and 500mM imidazole, pH8.0), collecting the protein showing the ultraviolet absorption peak of the recombinant human TSG-6 protein, dialyzing the protein in 10 times volume of Tris-HCl buffer solution at 4 ℃ for more than 6 hours, dialyzing twice to remove high-concentration imidazole, adjusting the pH to 5.0, passing 1M NaCl eluent through an anion exchange chromatographic column to collect flow-through liquid, namely a pure product of the recombinant human TSG-6 protein, and detecting the purity of the prepared target protein by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) with the result shown in figure 6.

(6) Mixing the pure recombinant human TSG-6 protein obtained in the step (5) with a freeze-drying protective agent according to the equal volume of 1: 1, and then carrying out freeze drying to obtain the recombinant human TSG-6 protein standard product with the specification of 40 mu g/unit (namely, the amount of rhTSG-6 complete antigen contained in each recombinant human TSG-6 protein standard product is 40 mu g); the lyoprotectant is PBS mixed solution of glycerol, mannitol and sucrose, and the final concentrations of the three in 10mmol/L PBS buffer solution are 100mL/L of glycerol, 0.12g/mL of mannitol and 0.025g/mL of sucrose.

Example 2

Antiviral activity titer determination of recombinant human TSG-6 protein standard

a. Experimental materials:

the titer of the recombinant human interferon α standard product is 3.0 multiplied by 10⁶IU/mL as known positive control purchased from Beijing China food and drug identification research institute, national interferon alpha Standard, lot number 97/04, hereinafter called nominal interferon;

recombinant human TSG-6 protein standard: prepared from example 1 as a test article;

cell lines: bovine kidney cells (MDBK), purchased from ATCC;

virus strain: the challenge virus was Vesicular Stomatitis Virus (VSV), a gift from the clinical virus institute of university of medical, anhui.

b. Experimental methods

the method comprises the steps of operating under the aseptic condition, adding 1 count of recombinant human TSG-6 protein standard into 1mL of injection water for dissolving, then diluting the recombinant human TSG-6 protein standard by 100 times through DMEM cell nutrient solution containing 10% newborn calf serum in a reagent bottle, adding the diluted recombinant human TSG-6 protein standard into a 96-well cell culture plate for continuous two-time incremental serial dilution, wherein 10 dilution degrees are provided for each dilution degree, each dilution degree is 2 wells, then taking the recombinant human interferon α standard, after redissolving according to an instruction, diluting the recombinant human interferon α standard by 100000 times through DMEM cell nutrient solution containing 10% newborn calf serum to 30IU contained in each milliliter, adding the diluted recombinant human TSG-6 protein standard into the 96-well cell culture plate for two-time incremental serial dilution, and setting 2 wells for each dilution degree, and operating under the aseptic condition, and simultaneously setting a cell control group and a virus control group.

And (3) forming a monolayer after the MDBK cells in the logarithmic growth phase are passaged for 36-48 hours, and observing under a mirror to find that the cells are fully paved into the monolayer and can be used for preparing a single cell suspension when the transparency is high. Adjusting the number of cells to 5X 10⁵Perml, 100. mu.L/well of the above-mentioned 96-well plate, and then placed at 37 ℃ in 5% CO₂The electric heating constant temperature incubator cultures for about 24 hours. When cell growth was observed to be confluent with a monolayer and the growth was good, the culture medium in each well was discarded, and the VSV virus suspension was diluted to 100TCID per ml by adding freshly prepared DMEM cell maintenance medium containing 2% newborn bovine serum₅₀Added to each well in an amount of 100. mu.L per well; however, only an equal amount of maintenance solution was added to the cell control group. Then placing at 37 ℃ and 5% CO₂Culturing for 24h in an electric heating constant temperature incubator.

The culture in the electric heating constant temperature incubator is observed under an inverted microscope. First, "cell control wells" and "virus control wells" were observed, and the appearance of CPE in each well was indicated by a "+". When the virus control hole appears "+++ or ++++", namely 75-100% of obvious lesions and death and shedding appear in the cells in the virus control hole, and the basic growth state of the cells in the cell control hole is good, the test control system is qualified, otherwise, the redo operation is discarded. At this time, the result can be determined. Adding 50 mu L/hole of crystal violet staining solution, decoloring after 3-5 min, and recording the result, wherein the crystal violet staining result is shown in figure 7.

+ + + + + indicates total cytopathy;

+ + + indicates 75% cytopathy;

+ indicates 50% cytopathic effect;

+ indicates 25% cytopathic effect;

the result is recorded by visual observation, and the plate hole is completely and well colored and is in a purple full-coverage state, if the plate hole is in a cell control hole C, the plate hole is judged to be CPE (-); the result of the plate holes of the interferon-protected holes is purple full coverage (-), 100% of diseased cells are completely dropped and colorless, and if the virus control holes and the plate holes without interferon protection are colorless, the plate holes are judged to be CPE (++++).

According to Reed-Munch formula

Logarithm of dilution: lg (1/2) ═ 0.3;

log of dilution of inhibition of cytopathic effect above 50% of lesions: lg (1/8) ═ -0.9;

lg (highest dilution that inhibits 50% of cytopathic events) — log from this example × dilution + dilution above 50% lesion rate + fold of dilution-0.38 × (-0.3) + (-0.9) + (-2) — 3.01;

the highest dilution that inhibited 50% of cytopathic effects was 10^-3.01；

That is, the interferon standard is diluted to 10^-3.01(1: 1023) can protect half of cells from attack of virus. Namely, the working titer of the recombinant human TSG-6 protein standard is 1.02 multiplied by 10³U/mL, the working titer of the recombinant human interferon α can be calculated to be 2.89 multiplied by 10⁶IU/mL。

Correcting a working unit: r1: r2 ═ X1: x2

As indicated above: r1 ═ 3.0 × 10⁶IU/mL，R2＝2.89×10⁶IU/mL，X2＝1.02×10³IU/mL；

R1: standard work units for interferon standards; r2: working units of interferon standards determined under the same conditions; x2: a working unit for determining a recombinant human TSG-6 protein standard to be detected; x1: and (4) correcting the working unit of the recombinant human TSG-6 protein standard substance to be detected.

The titer obtained after correction: x1 ═ 1.59 × 10³IU/mL is the final titer calibration result of the recombinant human TSG-6 protein standard product.

From this example, it can also be seen that the recombinant human TSG-6 protein standard provided by the present invention can inhibit cytopathy in MDBK cells infected with VSV virus. Therefore, the compound can be used as a medicine for resisting VSV virus.

The above detailed descriptions of a recombinant human TSG-6 gene, a preparation method of a recombinant human TSG-6 protein standard and applications thereof with reference to examples are illustrative and not restrictive, and several examples can be cited within the scope of the present invention, so that variations and modifications thereof without departing from the general concept of the present invention are within the scope of the present invention.

SEQUENCE LISTING

<110> Wu lake Tianming Biotechnology Limited

<120> recombinant human TSG-6 gene, recombinant human TSG-6 protein standard substance, preparation method and application thereof

<130>1

<160>3

<170>PatentIn version 3.3

<210>1

<211>780

<212>DNA

<213> TSG-6 Gene before optimization

<400>1

tggggattca aggatggaat ttttcataac tccatatggc ttgaacgagc agccggtgtg 60

taccacagag aagcacggtc tggcaaatac aagctcacct acgcagaagc taaggcggtg 120

tgtgaatttg aaggcggcca tctcgcaact tacaagcagc tagaggcagc cagaaaaatt 180

ggatttcatg tctgtgctgc tggatggatg gctaagggca gagttggata ccccattgtg 240

aagccagggc ccaactgtgg atttggaaaa actggcatta ttgattatgg aatccgtctc 300

aataggagtg aaagatggga tgcctattgc tacaacccac acgcaaagga gtgtggtggc 360

gtctttacag atccaaagca aatttttaaa tctccaggct tcccaaatga gtacgaagat 420

aaccaaatct gctactggca cattagactc aagtatggtc agcgtattca cctgagtttt 480

ttagattttg accttgaaga tgacccaggt tgcttggctg attatgttga aatatatgac 540

agttacgatg atgtccatgg ctttgtggga agatactgtg gagatgagct tccagatgac 600

atcatcagta caggaaatgt catgaccttg aagtttctaa gtgatgcttc agtgacagct 660

ggaggtttcc aaatcaaata tgttgcaatg gatcctgtat ccaaatccag tcaaggaaaa 720

aatacaagta ctacttctac tggaaataaa aactttttag ctggaagatt tagccactta 780

<210>2

<211>783

<212>DNA

<213> optimized TSG-6 Gene

<400>2

tggggtttta aagatggcat ttttcataat agcatctggc tggaacgcgc cgccggcgtt 60

tatcatcgtg aagcccgtag tggcaaatat aaactgacct atgcagaagc caaagcagtg 120

tgcgaatttg aaggcggtca tctggcaacc tataaacagc tggaagcagc ccgtaaaatt 180

ggctttcatg tgtgcgcagc cggttggatg gccaaaggtc gcgtgggcta tccgattgtg 240

aaaccgggcc cgaattgcgg ttttggcaaa accggtatta ttgattatgg tattcgtctg 300

aatcgtagtg aacgttggga tgcctattgt tataatccgc atgcaaaaga atgcggtggc 360

gtttttaccg atccgaaaca gatttttaaa agcccgggct ttccgaatga atatgaagat 420

aatcagatct gctactggca tattcgtctg aaatatggtc agcgcattca tctgagtttt 480

ctggattttg atctggaaga tgatccgggc tgcctggcag attatgttga aatctatgat 540

agctatgacg atgttcatgg ttttgtgggt cgctattgtg gtgacgaact gccggatgat 600

attattagta ccggcaatgt gatgaccctg aaatttctga gtgatgccag cgtgaccgca 660

ggcggttttc agattaagta tgttgcaatg gaccctgtga gcaaaagcag ccagggcaaa 720

aataccagta ccaccagtaccggtaataag aattttctgg ccggtcgctt tagtcatctg 780

taa 783

<210>3

<211>260

<212>PRT

<213> amino acid sequence of recombinant human TSG-6

<400>3

Trp Gly Phe Lys Asp Gly Ile Phe His Asn Ser Ile Trp Leu Glu Arg

1 5 10 15

Ala Ala Gly Val Tyr His Arg Glu Ala Arg Ser Gly Lys Tyr Lys Leu

20 25 30

Thr Tyr Ala Glu Ala Lys Ala Val Cys Glu Phe Glu Gly Gly His Leu

35 40 45

Ala Thr Tyr Lys Gln Leu Glu Ala Ala Arg Lys Ile Gly Phe His Val

50 55 60

Cys Ala Ala Gly Trp Met Ala Lys Gly Arg Val Gly Tyr Pro Ile Val

65 70 75 80

Lys Pro Gly Pro Asn Cys Gly Phe Gly Lys Thr Gly Ile Ile Asp Tyr

85 90 95

Gly Ile Arg Leu Asn Arg Ser Glu Arg Trp Asp Ala Tyr Cys Tyr Asn

100 105 110

Pro His Ala Lys Glu Cys Gly Gly Val Phe Thr Asp Pro Lys Gln Ile

115 120 125

Phe Lys Ser Pro Gly Phe Pro Asn Glu Tyr Glu Asp Asn Gln Ile Cys

130 135 140

Tyr Trp His Ile Arg Leu Lys Tyr Gly Gln Arg Ile His Leu Ser Phe

145 150 155 160

Leu Asp Phe Asp Leu Glu Asp Asp Pro Gly Cys Leu Ala Asp Tyr Val

165 170 175

Glu Ile Tyr Asp Ser Tyr Asp Asp Val His Gly Phe Val Gly Arg Tyr

180 185 190

Cys Gly Asp Glu Leu Pro Asp Asp Ile Ile Ser Thr Gly Asn Val Met

195 200 205

Thr Leu Lys Phe Leu Ser Asp Ala Ser Val Thr Ala Gly Gly Phe Gln

210 215 220

Ile Lys Tyr Val Ala Met Asp Pro Ala Ser Lys Ser Ser Gln Gly Lys

225 230 235 240

Asn Thr Ser Thr Thr Ser Thr Gly Asn Tyr Asn Phe Leu Ala Gly Arg

245 250 255

Phe Ser His Leu

260

Claims

1. A recombinant human TSG-6 gene, wherein the sequence of the recombinant human TSG-6 gene is shown in SEQUENCELLING 400 (2).

2. A recombinant human TSG-6 protein encoded by the recombinant human TSG-6 gene of claim 1, wherein the amino acid SEQUENCE of the recombinant human TSG-6 protein is as shown in SEQUENCE testing 400 (3).

3. A preparation method of a recombinant human TSG-6 protein standard substance is characterized by comprising the following steps:

(1) performing codon optimization on the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 (1) to obtain the recombinant human TSG-6 gene of claim 1;

(2) subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector, converting the subcloned recombinant human TSG-6 gene into BL21(DE3) escherichia coli, and coating an LB (lysogeny broth) plate containing ampicillin for overnight culture to obtain recombinant human TSG-6 recombinant bacteria;

4. The method for preparing a recombinant human TSG-6 protein standard according to claim 3, wherein the step (2) further comprises the steps of performing PCR and BamHI and HindIII double digestion identification on a single colony obtained by cultivation on an LB plate, and a positive identification result indicates successful construction of the recombinant human TSG-6 recombinant bacterium.

5. The method of claim 3, wherein in the step (3), the culture medium used for the amplification culture is LB medium containing 100. mu.g/mL ampicillin; culturing to OD value of 0.6-0.8, and inducing expression with IPTG with final concentration of 1.0mM at 30 deg.C for 5 h.

6. The method for preparing a recombinant human TSG-6 protein standard according to claim 3, wherein the separation and purification in step (5) is performed by: filtering the crude product of the recombinant human TSG-6 protein, purifying the crude product by a His-tag affinity chromatography column, collecting the purified recombinant human TSG-6 protein, dialyzing, and then adjusting the pH value to 5.0; and purifying by an anion exchange chromatography column to obtain the recombinant human TSG-6 protein pure product.

7. The method of claim 6, wherein the His-tag affinity column is purified using a mixture of 50mM Tris-Cl and 500mM imidazole at pH8.0 in step (5).

8. The method of claim 3, wherein in the step (6), the lyoprotectant is a PBS mixture with a final concentration of 100mL/L glycerol, 0.12g/mL mannitol, and 0.025g/mL sucrose.

9. The recombinant human TSG-6 protein standard prepared by the preparation method according to any one of claims 2 to 8.

10. The recombinant human TSG-6 protein standard of claim 9, for use in an anti-viral medicament.