CN111218452B - Recombinant human TSG-6 gene, recombinant human TSG-6 protein standard, and preparation methods and applications thereof - Google Patents
Recombinant human TSG-6 gene, recombinant human TSG-6 protein standard, and preparation methods and applications thereof Download PDFInfo
- Publication number
- CN111218452B CN111218452B CN202010116879.1A CN202010116879A CN111218452B CN 111218452 B CN111218452 B CN 111218452B CN 202010116879 A CN202010116879 A CN 202010116879A CN 111218452 B CN111218452 B CN 111218452B
- Authority
- CN
- China
- Prior art keywords
- recombinant human
- human tsg
- protein
- tsg
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Animal Behavior & Ethology (AREA)
- Physics & Mathematics (AREA)
- Oncology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a recombinant human TSG-6 gene, a recombinant human TSG-6 protein standard substance, a preparation method and an application thereof, wherein the recombinant human TSG-6 gene is optimized, cloned into a pET-32a expression vector and transformed into escherichia coli, induced expression is carried out after culture, a recombinant human TSG-6 protein crude product can be obtained by washing, denaturation and renaturation of expressed thalli, the recombinant human TSG-6 protein pure product is obtained after separation and purification, and the recombinant human TSG-6 protein standard substance is prepared by freeze drying after being mixed with a freeze-drying protective agent; compared with the prior art, the invention realizes the high-efficiency expression of the recombinant human TSG-6 protein through codon optimization, realizes the batch preparation of the recombinant human TSG-6 protein standard substance, and can ensure that the titer detection result of the recombinant human TSG-6 protein measured in different batches is more reliable and credible by taking the standard substance as a standard.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a recombinant human TSG-6 gene, a recombinant human TSG-6 protein standard substance, and a preparation method and application thereof.
Background
Tumor necrosis factor alpha-stimulated gene 6 (TSG-6) is an inflammation-related secretory protein, is generated by mesenchymal stem cells or stromal cells (MSCs) in response to inflammatory signals, and is highly expressed in various inflammatory diseases or inflammatory-like pathological processes. It is known that TSG-6 mediates many immune regulation and tissue repair processes, has anti-inflammatory and tissue protective effects, and is a functional protein that is upregulated.
TSG-6 is encoded by TNFAIP6 (tumor necrosis factor-induced gene 6 protein, TNFAIP 6) gene, and is a novel gene discovered by Lee et al in screening human diploid FS-4 fibroblast cDNA library interfered by tumor necrosis factor alpha.
The TSG-6 gene mainly comprises two adjacent components, namely a Link component and a CUB component, wherein the Link component is responsible for recognition of signal molecules and is combined with Hyaluronic Acid (HA), chondroitin sulfate, proteoglycan, G1 chain of proteoglycan and the like, and the CUB plays a biological role as a functional region. The promoter sequence of the TSG-6 gene has binding sites of activator protein 1 (AP-1) and nuclear factor interleukin (NF-IL 6), and when stimulated by inflammatory factors such as TNF-alpha and interleukin-1 (IL-1), the gene is remarkably increased in the fibroblast, so that the gene is considered to be a gene regulated by the inflammatory factors such as TNF-alpha. The TSG-6 gene is located in human chromosome 2q23, mRNA overall length 1440bp, and the coded protein contains 277 amino acid residues, belongs to a hyaluronic acid binding protein family, has multiple functions, comprises the functions of inhibiting neutrophil migration, regulating a protein network and the like, is a gene induced by TNF-alpha and involved in various inflammatory reactions, is highly expressed in various inflammatory diseases or diseases similar to inflammation, mediates the migration and adhesion of inflammatory cells by combining hyaluronic acid and an inter-alpha-protease inhibitor, is involved in extracellular matrix remodeling and regulation of a protease network, is a positive regulation functional protein, and plays an important role in various pathological and physiological processes, inflammatory reactions and tissue remodeling.
A large number of researches show that TSG-6 is an anti-inflammatory factor with obvious effect, and in the inflammation processes of hepatitis, arthritis, retinitis, tissue injury, keloid and the like, TSG-6 can inhibit the expression of inflammatory factors TNF-alpha, IL-1 beta, IL-6 and the like, has the functions of inhibiting neutrophil infiltration and the like, and plays a strong anti-inflammatory role. When the body is infected, wounded and the like, the proper inflammatory reaction is beneficial to the body to eliminate pathogens and repair the injury. While if the inflammatory reaction lasts for a long time and is severe, it is harmful to the body.
Although the research of TSG-6 and the biological function thereof are increasingly regarded, reports that the recombinant protein has antiviral activity and a preparation method for preparing a standard product thereof on a large scale are not found so far. The invention discovers for the first time that recombinant human TSG-6 (recombinant human TSG-6, rhTSG-6) has antiviral activity in vitro and in vivo. Filling the blank of the field.
Disclosure of Invention
The invention provides a recombinant human TSG-6 gene, a recombinant human TSG-6 protein standard substance, and a preparation method and application thereof. The method specifically comprises the following steps: after the existing recombinant human TSG-6 gene is optimized, the gene is cloned into a pET-32a expression vector and is transformed into Escherichia coli. Inducing expression after culture; washing, denaturing and renaturing the expressed thallus to obtain recombinant human TSG-6 protein; and then the recombinant human TSG-6 protein pure product is obtained after separation and purification. And then mixing the protein with a freeze-drying protective agent, and freeze-drying to prepare the recombinant human TSG-6 protein standard. The invention realizes the high-efficiency expression of the recombinant human TSG-6 protein through codon optimization and realizes the batch preparation of the recombinant human TSG-6 protein standard substance. Meanwhile, the invention provides a detection result system which is based on the phenomenon that rhTSG-6 can protect MDBK cells but not limited to the cells from VSV virus, but not limited to the invasion effect of the virus, namely, a method for detecting the antiviral activity of rhTSG-6 in vitro by adopting a cytopathic inhibition method. The method can accurately and objectively observe and detect the antiviral activity of the TSG-6, and has high repeatability and accuracy. The rhTSG-6 standard substance has the titer against VSV virus as high as about 1000.00U/mL through the verification of the method.
The rhTSG-6 standard substance detected by the cytopathic effect inhibition method can inhibit the cytopathic effect of cells infected with VSV virus, and the detection result of the titer of the recombinant human TSG-6 protein measured in different batches can be more reliable and credible by taking the standard substance as the standard of the evaluation result.
The technical scheme adopted by the invention is as follows:
a recombinant human TSG-6 gene, the SEQUENCE of said recombinant human TSG-6 gene is shown in SEQUENCE testing 400 (2).
The amino acid SEQUENCE of the recombinant human TSG-6 protein coded by the recombinant human TSG-6 gene is shown in SEQUENCE testing 400 (3). The N-terminal 16 amino acid residues are deleted from the amino acid residue sequence, the partial sequence is a signal peptide sequence which is not beneficial to the expression of rhTSG-6 in a prokaryotic system, and the expression quantity of the recombinant human TSG-6 provided by the invention is 100 times higher than that of the prior art.
The invention also provides a preparation method of the recombinant human TSG-6 protein standard substance, which comprises the following steps:
(1) Carrying out codon optimization on rare codons such as AGG, AGA, ATA, CTA, CGA, CGG, CCC, UCG and the like in the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <1 > to obtain the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <2 >, and improving the codon adaptation index and the expression level of the target protein through optimization;
(2) Subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector, converting the subcloned recombinant human TSG-6 gene into BL21 (DE 3) escherichia coli, and culturing the escherichia coli with an LB plate coated with ampicillin overnight to obtain recombinant human TSG-6 recombinant bacteria BL21/pET32a-rhTSG-6;
(3) Carrying out amplification culture on the recombinant human TSG-6 recombinant bacteria, carrying out IPTG induced expression, and then collecting thalli;
(4) Crushing the thalli collected in the step (3), centrifuging, collecting precipitate, washing, denaturing and renaturing the precipitate to obtain a crude product of the recombinant human TSG-6 protein;
(5) Separating and purifying the recombinant human TSG-6 protein crude product to obtain a recombinant human TSG-6 protein pure product;
(6) And mixing the pure recombinant human TSG-6 protein with a freeze-drying protective agent, and freeze-drying to obtain the recombinant human TSG-6 protein standard substance.
Further, the step (2) further comprises the step of carrying out PCR and BamH I and HindIII double enzyme digestion identification on a single colony obtained by culturing on an LB plate, and the successful construction of the recombinant human TSG-6 recombinant bacterium is indicated if the identification result is positive.
Designing head and tail primers by using Primer Premier 5 software according to a target gene sequence, wherein the primers during PCR identification are as follows:
F1：GGATCCTGGGGTTTTAAAGATGGC；
R1：AAGCTTTTACAGATGACTAAAGCGAC。
in the step (3), the culture medium used for the amplification culture is an LB culture medium containing 100 mu g/mL ampicillin; culturing to OD value of 0.6-0.8, and inducing expression at 30 deg.C for 5h with IPTG having final concentration of 1.0 mM.
In the step (5), the separation and purification method comprises the following steps: filtering the recombinant human TSG-6 protein crude product, purifying the filtered recombinant human TSG-6 protein crude product by a His-tag affinity chromatographic column, collecting the purified recombinant human TSG-6 protein, dialyzing, and then adjusting the pH value to 5.0; and purifying by an anion exchange chromatography column to obtain the recombinant human TSG-6 protein.
In the step (5), the eluent used for the His-tag affinity chromatography column purification is a mixture consisting of 50mM Tris-Cl and 500mM imidazole, and the pH value is 8.0.
In the step (6), the lyoprotectant is PBS mixed liquor with the final concentration of 100mL/L of glycerin, 0.12g/mL of mannitol and 0.025g/mL of sucrose.
The invention also provides a recombinant human TSG-6 protein standard substance prepared by the preparation method.
The invention also provides the application of the recombinant human TSG-6 protein standard substance in antiviral drugs, the antiviral activity of the recombinant human TSG-6 protein standard substance is determined on the basis of an MDBK/VSV titer determination system, and the result shows that the recombinant human TSG-6 protein standard substance can inhibit the cytopathy of VSV virus infected cells, and the recombinant human TSG-6 protein standard substance has the activity of resisting the VSV virus, and the titer of the recombinant human TSG-6 protein standard substance is 1.59 multiplied by 10 3 IU/mL。
The invention discovers for the first time that recombinant human TSG-6 (recombinant human TSG-6, rhTSG-6) has antiviral activity in vitro and in vivo. The rhTSG-6 antiviral activity phenomenon is detected by taking the phenomenon that rhTSG-6 inhibits virus cytopathic effect (CPE) as a result of detecting the activity of the rhTSG-6, namely, the reciprocal of the dilution which can still protect half of cells (50%) from the attack of virus by the highest dilution of a rhTSG-6 test sample per milliliter is defined as rhTSG-6 unit (or titer), and is often expressed by unit (U). The result is observed by staining the survival MDBK cells with crystal violet, and the antiviral activity of the rhTSG-6 is calculated according to the Reed-Muench formula according to the shade of the staining.
The invention has the following advantages:
1. the high-efficiency expression of the recombinant human TSG-6 protein is realized by codon optimization and deletion of a signal peptide sequence with 16 amino acid residues at the N end, and the prokaryotic expression yield of the recombinant human TSG-6 protein is improved by 100 times compared with that of the domestic known prokaryotic expression of the recombinant human TSG-6 protein.
2. The invention discovers for the first time that the prepared recombinant human TSG-6 protein standard has activity against VSV virus on an in vitro MDBK/VSV titer determination system.
3. The recombinant human TSG-6 protein standard substance has higher purity than that of a recombinant protein prepared by common escherichia coli through affinity chromatography and anion exchange chromatography, and the purity reaches more than 90 percent.
4. The recombinant Escherichia coli BL21/pET32a-rhTSG-6 is used as an expression strain, has the advantages of low production cost, high yield and the like, and is suitable for large-scale industrial production.
Drawings
FIG. 1 shows the result of PCR identification of the optimized recombinant human TSG-6 gene, wherein the ratio of lane M: DNA Marker DL2000; lane 1: negative control; lanes 2-5: the PCR identification result of the optimized recombinant human TSG-6 gene is obtained;
FIG. 2 shows the results of the double restriction enzyme identification of the recombinant plasmid pET32a-rhTSG-6; wherein M is DNA Marker DL2000; lane 1 shows the results of BamHI and HindIII double digestion of the recombinant plasmid pET32a-rhTSG-6, lanes 2 and 3 show the results of single digestion of the recombinant plasmid pET32a-rhTSG-6 with BamHI and HindIII respectively, and lane 4 shows the negative control of the recombinant plasmid pET32a-rhTSG-6;
FIG. 3 shows SDS-PAGE results of recombinant human TSG-6 protein induced by expression using 1.0mM IPTG at 30 ℃; wherein M is a protein marker, a lane 1 is empty carrier thallus total protein obtained by induction under the same condition, and a lane 2 is total protein expressed by thallus after the recombinant human TSG-6 engineering bacteria are induced for 5 hours; lane 3 is the precipitate after the thallus is broken after being induced by the recombinant human TSG-6 engineering bacteria for 5h, and lane 4 is the supernatant after the thallus is broken after being induced by the recombinant human TSG-6 engineering bacteria for 5h.
FIG. 4 shows the result of detecting the expression of recombinant human TSG-6 protein, wherein M is protein marker, lane 1 is empty vector total protein obtained by induction under the same conditions, lane 2 is the supernatant of disrupted recombinant human TSG-6 engineering bacteria after 5h induction, lane 3 is the precipitate of disrupted recombinant human TSG-6 engineering bacteria after 5h induction;
FIG. 5 shows the result of Western Blot to identify recombinant human TSG-6 protein; wherein M is a protein marker, a lane 1 is total protein obtained by crushing empty vector thalli, and a lane 2 is a recombinant human TSG-6 protein sample;
FIG. 6 shows the SDS-PAGE result after the purification of the recombinant human TSG-6 protein; wherein M is a protein marker, lane 2 is a recombinant human TSG-6 protein solution before purification, lane 3 is a purified recombinant human TSG-6 protein standard;
FIG. 7 shows titer titration results of recombinant human TSG-6 protein standard, in which A is recombinant human interferon alpha standard and B is recombinant human TSG-6 protein standard.
Detailed Description
The present invention will be described in detail with reference to examples.
Example 1
A preparation method of a recombinant human TSG-6 protein standard substance comprises the following steps:
(1) The recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <1 > reported in Genebank is subjected to codon optimization, and the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <2 > is obtained by using a chemical synthesis method, wherein the Codon Adaptation Index (CAI) before optimization is 0.73, and the CAI after optimization is 0.97.
(2) Subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector and converting the expression vector into BL21 escherichia coli, coating an LB plate containing ampicillin for overnight culture, selecting a single colony on the LB plate for PCR and BamHI and HindIII double enzyme digestion identification, wherein a positive result indicates that the construction of the expression vector is successful, and the recombinant human TSG-6 recombinant bacteria are obtained; the PCR amplification and double digestion products show a single band near 800bp by agarose gel electrophoresis No. 1 lane, as shown in FIGS. 1 and 2;
the PCR identification primer is:
F1：GGATCCTGGGGTTTTAAAGATGGC(BamH Ⅰ)；
R1：AAGCTTTTACAGATGACTAAAGCGAC(Hind Ⅲ)。
(3) Selecting recombinant human TSG-6 recombinant bacteria, performing shake culture in an LB culture medium containing 100 mu g/mL ampicillin, performing amplification culture in the LB culture medium containing 100 mu g/mL ampicillin for 2-3 h, adding 1.0mM IPTG (isopropyl-beta-thiogalactoside) with final concentration when OD (OD) value is measured to be 0.6-0.8, performing induced expression for 5h at 30 ℃, and collecting bacteria; through SDS-PAGE electrophoretic analysis, as shown in figure 3, the mycoprotein after IPTG induced expression for 5h can see a dominant expression band at the position of 45.0kD, and the expression amount reaches 60 percent; through Western blot identification, as shown in figure 5, the mycoprotein after IPTG induced expression for 5h can perform specific reaction with rabbit anti-human TSG-6 polyclonal antibody, a specific band appears at about 45kD, and the specificity is high;
the Western blot identification method comprises the following steps: rabbit anti-human TSG-6 polyclonal antibody (Abcam) was used as a primary antibody (1.
(4) Resuspending the thallus collected in the step (3) by using 200mL of PBS, and ultrasonically breaking the bacterial precipitate at 4 ℃, wherein the ultrasonic conditions are as follows: power: 400W, 3S of work, 3S of interval, 6min of ultrasound, and 3-4 times of repetition; centrifuging at 12000r/min for 20min to separate supernatant and precipitate, and subjecting the separated inclusion body precipitate to inclusion, washing, denaturation and renaturation to obtain renaturated product, i.e. crude product of recombinant human TSG-6 protein. The precipitate, supernatant and thallus were separately collected and examined by SDS-PAGE electrophoresis, as shown in FIG. 4. The recombinant protein is expressed as inclusion body through SDS-PAGE electrophoretic analysis.
The method for washing, denaturation and renaturation comprises the following steps:
(1) washing: resuspending the inclusion bodies (10 g) in a 1: 20 wet weight to volume ratio using a wash buffer (50 mmol/L Tris,100mmol/L NaCl,2mol/L urea, 1mmol/L EDTA,0.5% Triton X-100, pH 8.0), washing for 2h, centrifuging at 12000r/min for 20min to take the pellet, and repeating the washing once more;
(2) denaturation: weighing the washed precipitate (4.8 g), re-suspending the precipitate (240 ml) with a dissolution buffer (50 mmol/L Tris,100mmol/L NaCl,7mol/L guanidine hydrochloride, 0.1% beta-mercaptoethanol, pH 8.45) at a wet weight to volume ratio of 1:50, placing on a magnetic stirrer overnight, and fully dissolving;
(3) and (3) dilution renaturation: renaturation buffer (50 mmol/L Tris,100mmol/L NaCl,1mmol/L GSH,0.2mmol/L GSSG, pH8.0) is prepared for renaturation. Taking the dissolved protein solution, centrifuging at 12000r/min for 20min, taking the supernatant, adding an isovolumetric renaturation buffer solution (adding 250ml renaturation buffer solution), and standing for 3h at 4 ℃; then adding renaturation buffer solution to dilute to 4 times of the original volume (adding 500ml of renaturation buffer solution), and standing for 3h at 4 ℃; finally, renaturation buffer is added to dilute the solution to 5 times of the original volume (250 ml of renaturation buffer is added), and the solution is kept stand for 3 hours at 4 ℃.
(5) Filtering the crude product of the recombinant human TSG-6 protein, passing the crude product through a His-tag affinity chromatographic column, performing gradient Elution by using an Elution buffer (50 mM Tris-Cl and 500mM imidazole, pH 8.0), collecting the protein showing the ultraviolet absorption peak of the recombinant human TSG-6 protein, dialyzing the protein in a Tris-HCl buffer solution with the volume of 10 times at the temperature of 4 ℃ for more than 6 hours, dialyzing twice to remove high-concentration imidazole, adjusting the pH to 5.0, passing a 1M NaCl eluent through an anion exchange chromatographic column to collect a flow-through solution, namely a pure product of the recombinant human TSG-6 protein, and detecting the purity of the prepared target protein by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) with the result shown in figure 6.
(6) Mixing the pure recombinant human TSG-6 protein obtained in the step (5) with a freeze-drying protective agent according to the equal volume of 1: 1, and then carrying out freeze drying to obtain the recombinant human TSG-6 protein standard product with the specification of 40 mu g/unit (namely, the amount of rhTSG-6 complete antigen contained in each recombinant human TSG-6 protein standard product is 40 mu g); the lyoprotectant is PBS mixed solution of glycerol, mannitol and sucrose, and the final concentrations of the three in 10mmol/L PBS buffer solution are 100mL/L of glycerol, 0.12g/mL of mannitol and 0.025g/mL of sucrose.
Example 2
Antiviral activity titer determination of recombinant human TSG-6 protein standard
a. Experimental materials:
recombinant human interferon alpha standard: the potency is 3.0 × 10 6 IU/mL, as a known positive control purchased from beijing china food and drug identification institute, interferon alpha national standard, lot No.: 97/04, hereinafter termed nominal interferon;
recombinant human TSG-6 protein standard: prepared from example 1 as a test article;
cell lines: bovine kidney cells (MDBK), purchased from ATCC;
the virus strain: the challenge virus was Vesicular Stomatitis Virus (VSV) as a gift from the clinical virus institute at the university of medical, anhui.
b. Experimental methods
The method is operated under the aseptic condition, 1 recombinant human TSG-6 protein standard is taken and added into 1mL of water for injection to be dissolved, then the solution is diluted by 100 times by DMEM cell nutrient solution containing 10% newborn calf serum in a reagent bottle and then added into a 96-well cell culture plate to continuously carry out two-time incremental serial dilution, 10 dilutions are totally carried out, and each dilution is made into 2 wells. Taking the recombinant human interferon alpha standard, re-dissolving according to the instruction, firstly diluting 100000 times by using DMEM cell nutrient solution containing 10% newborn bovine serum to contain 30IU per milliliter, then adding the DMEM cell nutrient solution into a 96-hole cell culture plate, and performing two-time incremental serial dilution for 10 dilution degrees in total, wherein each dilution degree is 2 holes. Operating under aseptic conditions. A cell control group and a virus control group are simultaneously arranged.
And (3) forming a monolayer after MDBK cells in logarithmic growth phase are passaged for 36-48 h, and observing under a mirror to find that the cells are fully paved into the monolayer and can be used for preparing single cell suspension when the transparency is high. Adjusting the number of cells to 5X 10 5 mL, 100. Mu.L/well into the well of the above 96-well plate, 37 ℃ and 5% CO 2 The electric heating constant temperature incubator cultures for about 24 hours. Cells were observedWhen the monolayer is full and the growth state is good, the culture medium in each well is discarded, and a freshly prepared DMEM cell maintenance solution containing 2% newborn bovine serum is added to dilute the VSV virus suspension to 100TCID per ml 50 Added to each well in an amount of 100. Mu.L per well; however, only an equal amount of maintenance solution was added to the cell control group. Then placed at 37 ℃ and 5% CO 2 Culturing for 24h in an electric heating constant temperature incubator.
The culture in the electric heating constant temperature incubator is observed under an inverted microscope. First, "cell control wells" and "virus control wells" were observed, and the appearance of CPE in each well was indicated by a "+". When the virus control hole appears "+++ or ++++", namely 75-100% of obvious lesions and death and shedding appear in the cells in the virus control hole, and the basic growth state of the cells in the cell control hole is good, the test control system is qualified, otherwise, the redo operation is discarded. At this time, the result can be determined. Adding 50 mu L of crystal violet staining solution into the well, and recording the result after decolorizing for 3-5 min, wherein the crystal violet staining result is shown in figure 7.
+ + + ++ indicates total cytopathy;
+ + + indicates 75% cytopathy;
+ indicates 50% cytopathic effect;
+ indicates 25% cytopathic effect;
the result is recorded by visual observation, and the plate hole is completely and well colored and is in a purple full-coverage state, if the plate hole is in a cell control hole C, the plate hole is judged to be CPE (-); the result of the plate holes of the interferon-protected holes is purple full coverage (-), 100% of diseased cells are completely dropped and colorless, and if the virus control holes and the plate holes without interferon protection are colorless, the plate holes are judged to be CPE (++++).
According to Reed-Munch formula
Logarithm of dilution: lg (1/2) = -0.3;
log of dilution of inhibition of cytopathic effect above 50% of lesions: lg (1/8) = -0.9;
lg (highest dilution that inhibits 50% of cytopathic events) = log of dilution from this case x log of dilution + log of dilution above 50% pathology + dilution multiple =0.38 × (-0.3) + (-0.9) + (-2) = -3.01;
highest dilution that inhibited cytopathic effects by 50% =10 -3.01 ；
That is, the interferon standard is diluted to 10 -3.01 (1: 1023) can protect half of cells from attack of virus. Namely, the working titer of the recombinant human TSG-6 protein standard substance is 1.02 multiplied by 10 3 U/mL. The same way can calculate the working titer of the recombinant human interferon alpha to be 2.89 multiplied by 10 6 IU/mL。
Correcting a working unit: r1: r2= X1: x2
As indicated above: r1=3.0 × 10 6 IU/mL，R2＝2.89×10 6 IU/mL，X2＝1.02×10 3 IU/mL；
R1: standard work units for interferon standards; r2: working units of interferon standards determined under the same conditions; x2: a working unit for determining a recombinant human TSG-6 protein standard to be detected; x1: and correcting the working unit of the recombinant human TSG-6 protein standard substance to be detected.
Titer obtained after correction: x1=1.59 × 10 3 IU/mL is the final titer calibration result of the recombinant human TSG-6 protein standard product.
From this example, it can also be seen that the recombinant human TSG-6 protein standard provided by the present invention can inhibit cytopathy of MDBK cells infected with VSV virus. Therefore, the compound can be used as a medicine for resisting VSV virus.
The above detailed descriptions of a recombinant human TSG-6 gene, a preparation method of a recombinant human TSG-6 protein standard and applications thereof with reference to examples are illustrative and not restrictive, and several examples can be cited within the scope of the present invention, so that variations and modifications thereof without departing from the general concept of the present invention are within the scope of the present invention.
SEQUENCE LISTING
<110> Wu lake Tianming Biotechnology Limited
<120> recombinant human TSG-6 gene, recombinant human TSG-6 protein standard substance, preparation method and application thereof
<130> 1
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 780
<212> DNA
<213> TSG-6 Gene before optimization
<400> 1
tggggattca aggatggaat ttttcataac tccatatggc ttgaacgagc agccggtgtg 60
taccacagag aagcacggtc tggcaaatac aagctcacct acgcagaagc taaggcggtg 120
tgtgaatttg aaggcggcca tctcgcaact tacaagcagc tagaggcagc cagaaaaatt 180
ggatttcatg tctgtgctgc tggatggatg gctaagggca gagttggata ccccattgtg 240
aagccagggc ccaactgtgg atttggaaaa actggcatta ttgattatgg aatccgtctc 300
aataggagtg aaagatggga tgcctattgc tacaacccac acgcaaagga gtgtggtggc 360
gtctttacag atccaaagca aatttttaaa tctccaggct tcccaaatga gtacgaagat 420
aaccaaatct gctactggca cattagactc aagtatggtc agcgtattca cctgagtttt 480
ttagattttg accttgaaga tgacccaggt tgcttggctg attatgttga aatatatgac 540
agttacgatg atgtccatgg ctttgtggga agatactgtg gagatgagct tccagatgac 600
atcatcagta caggaaatgt catgaccttg aagtttctaa gtgatgcttc agtgacagct 660
ggaggtttcc aaatcaaata tgttgcaatg gatcctgtat ccaaatccag tcaaggaaaa 720
aatacaagta ctacttctac tggaaataaa aactttttag ctggaagatt tagccactta 780
<210> 2
<211> 783
<212> DNA
<213> optimized TSG-6 Gene
<400> 2
tggggtttta aagatggcat ttttcataat agcatctggc tggaacgcgc cgccggcgtt 60
tatcatcgtg aagcccgtag tggcaaatat aaactgacct atgcagaagc caaagcagtg 120
tgcgaatttg aaggcggtca tctggcaacc tataaacagc tggaagcagc ccgtaaaatt 180
ggctttcatg tgtgcgcagc cggttggatg gccaaaggtc gcgtgggcta tccgattgtg 240
aaaccgggcc cgaattgcgg ttttggcaaa accggtatta ttgattatgg tattcgtctg 300
aatcgtagtg aacgttggga tgcctattgt tataatccgc atgcaaaaga atgcggtggc 360
gtttttaccg atccgaaaca gatttttaaa agcccgggct ttccgaatga atatgaagat 420
aatcagatct gctactggca tattcgtctg aaatatggtc agcgcattca tctgagtttt 480
ctggattttg atctggaaga tgatccgggc tgcctggcag attatgttga aatctatgat 540
agctatgacg atgttcatgg ttttgtgggt cgctattgtg gtgacgaact gccggatgat 600
attattagta ccggcaatgt gatgaccctg aaatttctga gtgatgccag cgtgaccgca 660
ggcggttttc agattaagta tgttgcaatg gaccctgtga gcaaaagcag ccagggcaaa 720
aataccagta ccaccagtac cggtaataag aattttctgg ccggtcgctt tagtcatctg 780
taa 783
<210> 3
<211> 260
<212> PRT
<213> amino acid sequence of recombinant human TSG-6
<400> 3
Trp Gly Phe Lys Asp Gly Ile Phe His Asn Ser Ile Trp Leu Glu Arg
1 5 10 15
Ala Ala Gly Val Tyr His Arg Glu Ala Arg Ser Gly Lys Tyr Lys Leu
20 25 30
Thr Tyr Ala Glu Ala Lys Ala Val Cys Glu Phe Glu Gly Gly His Leu
35 40 45
Ala Thr Tyr Lys Gln Leu Glu Ala Ala Arg Lys Ile Gly Phe His Val
50 55 60
Cys Ala Ala Gly Trp Met Ala Lys Gly Arg Val Gly Tyr Pro Ile Val
65 70 75 80
Lys Pro Gly Pro Asn Cys Gly Phe Gly Lys Thr Gly Ile Ile Asp Tyr
85 90 95
Gly Ile Arg Leu Asn Arg Ser Glu Arg Trp Asp Ala Tyr Cys Tyr Asn
100 105 110
Pro His Ala Lys Glu Cys Gly Gly Val Phe Thr Asp Pro Lys Gln Ile
115 120 125
Phe Lys Ser Pro Gly Phe Pro Asn Glu Tyr Glu Asp Asn Gln Ile Cys
130 135 140
Tyr Trp His Ile Arg Leu Lys Tyr Gly Gln Arg Ile His Leu Ser Phe
145 150 155 160
Leu Asp Phe Asp Leu Glu Asp Asp Pro Gly Cys Leu Ala Asp Tyr Val
165 170 175
Glu Ile Tyr Asp Ser Tyr Asp Asp Val His Gly Phe Val Gly Arg Tyr
180 185 190
Cys Gly Asp Glu Leu Pro Asp Asp Ile Ile Ser Thr Gly Asn Val Met
195 200 205
Thr Leu Lys Phe Leu Ser Asp Ala Ser Val Thr Ala Gly Gly Phe Gln
210 215 220
Ile Lys Tyr Val Ala Met Asp Pro Ala Ser Lys Ser Ser Gln Gly Lys
225 230 235 240
Asn Thr Ser Thr Thr Ser Thr Gly Asn Tyr Asn Phe Leu Ala Gly Arg
245 250 255
Phe Ser His Leu
260
Claims (7)
1. A recombinant human TSG-6 gene is characterized in that the SEQUENCE of the recombinant human TSG-6 gene is shown in SEQUENCE LISTING 400 <2 >; the titer of the recombinant human TSG-6 protein coded by the recombinant human TSG-6 gene is 1.59 multiplied by 10 3 IU/mL。
2. A preparation method of a recombinant human TSG-6 protein standard substance is characterized by comprising the following steps:
(1) Performing codon optimization on the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 (1) to obtain the recombinant human TSG-6 gene as claimed in claim 1;
(2) Subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector, converting the gene into BL21 (DE 3) Escherichia coli, and coating an LB (Lucilin) -containing plate for overnight culture to obtain a recombinant human TSG-6 recombinant strain;
(3) Carrying out amplification culture on the recombinant human TSG-6 recombinant bacteria, carrying out IPTG induced expression, and then collecting thalli;
(4) Crushing the thalli collected in the step (3), centrifuging, collecting precipitate, washing, denaturing and renaturing the precipitate to obtain a recombinant human TSG-6 protein crude product;
(5) Separating and purifying the recombinant human TSG-6 protein crude product to obtain a recombinant human TSG-6 protein pure product;
(6) And mixing the pure recombinant human TSG-6 protein with a freeze-drying protective agent, and freeze-drying to obtain the recombinant human TSG-6 protein standard substance.
3. The method of claim 2, wherein the step (2) further comprises performing PCR on a single colony obtained by culturing on an LB plate, and performing PCR on the single colonyBamHI andHinand d III, carrying out double enzyme digestion identification, wherein if the identification result is positive, the construction success of the recombinant human TSG-6 recombinant bacteria is indicated.
4. The method of claim 2, wherein in the step (3), the culture medium used for the amplification culture is LB culture medium containing 100 μ g/mL ampicillin; culturing to OD value of 0.6-0.8, and inducing expression with IPTG with final concentration of 1.0mM at 30 deg.C for 5h.
5. The method for preparing a recombinant human TSG-6 protein standard according to claim 2, wherein in step (5), the separation and purification method is: filtering the crude product of the recombinant human TSG-6 protein, purifying the crude product by a His-tag affinity chromatography column, collecting the purified recombinant human TSG-6 protein, dialyzing, and then adjusting the pH value to 5.0; and purifying by an anion exchange chromatography column to obtain the recombinant human TSG-6 protein pure product.
6. The method of claim 5, wherein the His-tag affinity column is purified using a mixture of 50mM Tris-Cl and 500mM imidazole at pH8.0 in step (5).
7. The method of claim 2, wherein in step (6), the lyoprotectant is a PBS mixture with a final concentration of 100mL/L glycerol, 0.12g/mL mannitol, and 0.025g/mL sucrose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010116879.1A CN111218452B (en) | 2020-02-25 | 2020-02-25 | Recombinant human TSG-6 gene, recombinant human TSG-6 protein standard, and preparation methods and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010116879.1A CN111218452B (en) | 2020-02-25 | 2020-02-25 | Recombinant human TSG-6 gene, recombinant human TSG-6 protein standard, and preparation methods and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111218452A CN111218452A (en) | 2020-06-02 |
| CN111218452B true CN111218452B (en) | 2022-11-15 |
Family
ID=70829739
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010116879.1A Active CN111218452B (en) | 2020-02-25 | 2020-02-25 | Recombinant human TSG-6 gene, recombinant human TSG-6 protein standard, and preparation methods and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111218452B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112876569B (en) * | 2021-02-08 | 2022-05-10 | 芜湖天明生物技术有限公司 | rhTSG6-FN III1-C fusion protein, application thereof in skin care composition and preparation method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5846763A (en) * | 1991-01-14 | 1998-12-08 | New York University | DNA encoding tumor necrosis factor stimulated gene 6 (TSG-6) |
| WO2000001841A2 (en) * | 1998-07-06 | 2000-01-13 | Prestwich Glenn D | Hyaluronic acid mimics and methods related thereto |
| CN104093415A (en) * | 2011-10-24 | 2014-10-08 | 哈洛齐梅公司 | Companion diagnostic for anti-hyaluronan agent therapy and methods of use thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9878003B2 (en) * | 2006-03-06 | 2018-01-30 | The University Of Manchester | Method of treating bone disorders using TSG-6 |
| CN108530528A (en) * | 2018-03-26 | 2018-09-14 | 芜湖天明生物技术有限公司 | A kind of recombined human TSG-6 albumen and preparation method thereof and the application in acute inflammatory disease |
-
2020
- 2020-02-25 CN CN202010116879.1A patent/CN111218452B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5846763A (en) * | 1991-01-14 | 1998-12-08 | New York University | DNA encoding tumor necrosis factor stimulated gene 6 (TSG-6) |
| WO2000001841A2 (en) * | 1998-07-06 | 2000-01-13 | Prestwich Glenn D | Hyaluronic acid mimics and methods related thereto |
| CN104093415A (en) * | 2011-10-24 | 2014-10-08 | 哈洛齐梅公司 | Companion diagnostic for anti-hyaluronan agent therapy and methods of use thereof |
Non-Patent Citations (2)
| Title |
|---|
| "Overexpression, Purification, and Refolding of Link Module from Human TSG-6 in Escherichia coli: Effect of Temperature, Media, and Mutagenesis on Lysine Misincorporation at Arginine AGA Codons";Anthony J. Day等;《PROTEIN EXPRESSION AND PURIFICATION》;19961231;第8卷;第1-16页 * |
| "TSG-6对HCMV感染引起的TNF-a和IL-6表达水平下调的研究";姚瑶;《中国知网硕士电子期刊》;20170215(第02期);第1-55页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111218452A (en) | 2020-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2515308B2 (en) | Human immune interferon | |
| JPS61224985A (en) | Oxidation resistant muton | |
| HU209152B (en) | Method for producing human interferon protein of high purity and pharmaceutical preparative containing it | |
| CN111848814B (en) | Recombinant porcine IL-29 fusion protein and preparation method and application thereof | |
| CN111218452B (en) | Recombinant human TSG-6 gene, recombinant human TSG-6 protein standard, and preparation methods and applications thereof | |
| CN112500472B (en) | Cat omega interferon mutant and preparation method and application thereof | |
| CN108840952A (en) | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and chicken interferon α | |
| CN109331171B (en) | Preparation method of plasmodium protein and application of plasmodium protein in anti-tumor aspect | |
| CN104610443A (en) | High-stability recombinant procalcitonin and preparation method and application thereof | |
| EP3266796B1 (en) | Trail membrane-penetrating peptide-like mutant mur5, preparation method therefor, and application thereof | |
| Song et al. | High-efficiency production of bioactive recombinant human fibroblast growth factor 18 in Escherichia coli and its effects on hair follicle growth | |
| CN111172326B (en) | Method for in vitro detection of rhTSG-6 antiviral activity and application of rhTSG-6 in antiviral drugs | |
| CN111172249B (en) | rhTSG-6 fluorescent quantitative RT-qPCR detection kit and application thereof | |
| CN109182341B (en) | Anti-tumor protein and application thereof | |
| CN114525294A (en) | Method for preparing porcine interferon delta 5 and application of porcine interferon delta 5 | |
| CN111825773B (en) | Recombinant human TSG6-IFN alpha fusion protein, preparation method thereof and application thereof as antiviral drug | |
| CN112079912A (en) | High-activity canine alpha interferon recombinant protein and preparation method and application thereof | |
| CN112521480A (en) | Human interferon-kappa mutant and preparation method thereof | |
| CN108864305A (en) | A kind of fusion protein and preparation method thereof being made of sheep albumin, sheep interferon gamma and sheep interferon-tau | |
| CN108586608A (en) | A kind of DHAV-1 2C protein polyclone antibodies, recombination fusion protein and preparation method thereof | |
| CN112661835B (en) | Preparation method of mink IFN-epsilon mature peptide | |
| CN113583107B (en) | CRIg functional region protein variants and uses thereof | |
| CN108840934A (en) | A kind of recombination sheep long-acting interferon τ and the fusion protein for preparing this long-acting interferon and preparation method thereof | |
| CN110592094B (en) | American cockroach fibroblast growth factor and expression and purification method thereof | |
| CN114133458B (en) | Method for fusing polypeptide in human serum albumin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |