CN109182341B

CN109182341B - Anti-tumor protein and application thereof

Info

Publication number: CN109182341B
Application number: CN201811350826.5A
Authority: CN
Inventors: 程洋; 付海田; 石晓丹; 玄英花; 张馨心; 楚瑞林
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2018-11-14
Filing date: 2018-11-14
Publication date: 2020-09-04
Anticipated expiration: 2038-11-14
Also published as: CN109182341A

Abstract

The invention discloses an anti-tumor protein and application thereof, belonging to the technical field of biological medicines. The invention firstly screens and verifies the application of the PvTrag17 protein shown in SEQ ID NO.1 in the aspect of tumor resistance, and the CCK8 proliferation experiment result shows that the PvTrag17 protein can obviously inhibit the proliferation of liver cancer cell HepG2 cells, the inhibition rate is 63.1 percent, and the migration performance of the HepG2 cells is almost completely inhibited. The PvTrag17 protein can be used as an active ingredient or an anti-tumor medicament of a raw material, and has wide application prospect.

Description

Anti-tumor protein and application thereof

Technical Field

The invention relates to an anti-tumor protein and application thereof, belonging to the technical field of biological medicines.

Background

Malaria is the earliest disease in humans, and is still one of the most important infectious diseases worldwide to date. Most of the current researches on malaria focus on the invasion mechanism of plasmodium of different species and the research and development of malaria vaccines, and the research on the medicinal value or potential clinical application value of the plasmodium is less. Clinical data show that after tumor patients are infected with plasmodium, the tumor growth in the patients is inhibited, and the application possibility of the plasmodium in clinical tumor treatment is disclosed. Although plasmodium invades the body mainly through the binding of proteins carried on the surface or inside of the body with receptors on the surfaces of liver cells or erythrocytes, it is difficult to obtain proteins for tumor with high efficiency and accuracy because it is very difficult to extract proteins from merozoites of plasmodium.

Disclosure of Invention

The invention has the first aim of providing the application of the PvTrag17 protein in the preparation of anti-tumor drugs; the PvTrag17 protein contains an amino acid sequence shown in SEQ ID NO. 1.

In one embodiment of the present invention, the use includes, but is not limited to, the preparation of a medicament against lung cancer, liver cancer or prostate cancer.

In one embodiment of the invention, the medicament includes, but is not limited to, vaccines, inhibitors, immunomodulators.

The second purpose of the invention is to provide a method for preparing the PvTrag17 protein, which comprises the following steps:

1) amplifying a gene coding the PvTrag17 protein, and connecting the amplified target gene to an expression vector to obtain a recombinant plasmid;

2) the recombinant plasmid which successfully expresses the target gene is transformed into an expression cell to induce the expression of the target protein.

In an embodiment of the present invention, the method specifically includes the following steps:

1) designing primers shown as a primer SEQ ID NO.3 and a primer SEQ ID NO.4, amplifying a target gene, and connecting the amplified target gene to an expression vector;

2) and transforming the recombinant plasmid with the correct sequencing of the target gene into an expression cell, inducing the expression of the target protein by IPTG, and further preparing a purified target protein sample.

In one embodiment of the present invention, the expression vector may be a prokaryotic cell expression vector, a eukaryotic cell expression vector, or an insect cell expression vector.

In one embodiment of the present invention, the expression cell may be a prokaryotic expression cell, a eukaryotic expression cell or an insect cell.

In one embodiment of the invention, the expression vector is pET28a (+), and the expression cell is e.

The third purpose of the invention is to provide an anti-tumor drug, which contains the PvTrag17 protein shown in SEQ ID NO.1 or the active substance thereof, and a pharmaceutically acceptable carrier.

The invention also claims the application of the PvTrag17 protein in preparing products for non-medical use.

Has the advantages that: the applicant analyzes and screens plasmodium vivax protein to find that PvTrag17 is an output protein, the invention screens and verifies the application of PvTrag17 protein in the aspect of tumor resistance for the first time, and the result of a CCK8 proliferation experiment shows that the PvTrag17 protein can obviously inhibit the proliferation of liver cancer cell HepG2 cells, the inhibition rate is 63.1 percent, and the migration performance of the HepG2 cells is almost completely inhibited. The invention also aims to provide the application of the protein PvTrag17 prepared by the invention in preparing antitumor drugs, namely antitumor drugs taking the protein PvTrag17 as an active ingredient or raw material, in particular lung cancer, liver cancer and prostate cancer.

Drawings

FIG. 1 depicts a schematic representation of Coomassie brilliant blue staining of the PvTrag17 protein (A) and a detection scheme of Western blotting (B),

FIG. 2 is a CCK8 method for detecting the proliferation inhibition effect of PvTrag17 on HepG2 cells;

FIG. 3 is a Transwell cell migration assay to examine the migration inhibitory effect of PvTrag17 on HepG2 cells.

Detailed Description

Example 1 construction of PvTrag17 recombinant plasmid

Prokaryotic expression plasmid pET28a (+), host bacterium BL21(DE3) and IPTG for induction are all purchased from Beijing holotype gold Biotechnology GmbH; restriction enzymes, T4DNA ligase, pfu DNA polymerase and dNTPs were purchased from Takara. Primer synthesis and nucleotide sequence sequencing were performed by Soujin Weizhi Biotechnology, Inc. Agarose affinity media nickel columns (Ni) were purchased from QIAGEN corporation. His-Taq tag antibody was purchased from Cell Signaling Technology.

Designing primers to obtain a gene sequence of Plasmodium vivax PvTrag17 protein through PCR, wherein the primers are as follows: SEQ ID No. 3: GGATCCATGGAACTAAAAGCCAATATG, respectively; SEQ ID NO. 4: CTCGAGTGAGTCATTATCTGTGCTCAC, wherein GGATCC is the restriction enzyme cutting site BamH I of SEQ ID NO. 3; CTCGAG is the restriction site Xho I of SEQ ID NO. 4.

Obtaining PvTrag17 gene sequence by PCR amplification with plasmodium ovale genome as template, and the amplification program: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 10s, annealing at 50 deg.C for 30s, and extension at 72 deg.C for 90s, circulating for 35 times, and finally extension at 72 deg.C for 10 min.

And carrying out agarose gel electrophoresis on the PCR product to detect a target gene amplification band, carrying out gel recovery, carrying out restriction enzyme digestion on the PCR product and pET28a (+) at 37 ℃ for 2h by using BamH I and Xho I restriction enzymes, and connecting the target gene to a prokaryotic expression vector pET28a (+) overnight by using T4 ligase.

Transformation of the ligated recombinant plasmid into e.coli DH5 α competent cells: coli DH5 α cells were removed from-80 ℃. Immediately placing on ice, taking 4 μ L of the connected product, adding into 50 μ L of competent cells, mixing well, ice-cooling for 30min, heat-shocking for 90 at 42 ℃, taking out, and placing in ice-cooling for 2 min. To the tube, 1ml of nonresistant LB medium was added, and the tube was shake-cultured at 250rpm in a shaker at 37 ℃ for 1 hour. After centrifugation, 100. mu.l of the medium was used to resuspend the cells, spread on LB plates containing kanamycin (50. mu.g/ml), placed in an incubator at 37 ℃ for overnight inverted culture, and then the growth of colonies was observed. The single clone was picked, and the plasmid was extracted and sequenced. The sequencing result shows that the target gene sequence is correct.

EXAMPLE 2 expression of the recombinant protein PvTrag17

Inoculating positive monoclonal with correct sequencing into 5ml LB culture medium containing kanamycin, culturing at 37 deg.C overnight, inoculating bacterial liquid into 500ml LB culture medium containing kanamycin, and when OD is reached₆₀₀When the concentration is 0.6-0.8, 1mmol/L IPTG is added for induction for 8 h. The induced PvTrag17 was subjected to ultrasonication and resolved by 10% SDS-PAGE, indicating that the PvTrag17 protein was mainly localized in inclusion bodies and the molecular weight was as expected.

Dissolving the inclusion body by 8M urea to release PvTrag17 protein, wherein the protein is provided with His-tag label at the carbon terminal, therefore, a His-tag nickel column of GE company is adopted to carry out Ni according to the instruction of the kit²⁺And (5) affinity chromatography purification. Proteins were purified with different concentrations of imidazole, 20mM, 50mM, 100mM, 150mM and 250mM, respectively, and the 150mM imidazole-washed proteins were analyzed by 12% SDS-PAGE, confirmed by Coomassie blue staining. And further analyzing the purity of the target protein by using Western Blot.

Coomassie blue staining showed the purified product to be the protein of interest, with molecular weight sizes consistent with those expected (FIG. 1A). The Western Blot results show that the expressed protein has high purity and strong specificity (FIG. 1B).

Example 3 identification of the antitumor Activity of the PvTrag17 protein

(1) CCK8 method for detecting inhibition effect of PvTrag17 on proliferation performance of tumor cells

Logarithmic phase HepG2 was adjusted to a cell concentration of 5 × 10 in DMEM medium containing 10% FBS⁴Perml, 100. mu.L per well of the suspension was inoculated into a 96-well plate and 5% CO was added₂The samples are respectively added with 100 mu L of drugs with different concentrations (10, 50 and 100 mu g/mL), the blank group is added with an equal volume of culture medium, after the cells are attached, 10 mu L of LCCK8 solution is added into each hole, after the samples are continuously cultured for 24 hours, the samples are continuously placed in the incubator for 2 hours, the absorbance at 450nm is measured, the dose of the anti-tumor drug 5-Fu with 25 mu g/mL is used as a control, and the cell proliferation rate (%) (experiment group A450/control group A450 × 100) is equal to that of the experiment group A450.

As shown in FIG. 2, the inhibitory effect of PvTrag17 protein on the proliferation of HepG2 cells gradually increased with the increase in protein concentration. When the concentration is 100 mug/mL, the inhibition rate of the protein on the tumor cells reaches 63.1 percent, which is equivalent to the inhibition effect (67.2 percent) of the anti-tumor drug 5-Fu on the tumor cells with the dose of 25 mug/mL.

(2) Transwell migration method for detecting inhibition effect of PvTrag17 on migration performance of tumor cells

The effect of PvTrag17 on HepG2 migration was determined by the transwell migration method by adding 0.6mL of DMEM medium (containing 10% FBS) containing different PvTrg 17 samples to each well of a 24-well plate and adjusting the cell concentration of HepG2 to 5 × 10 using 1% FBS DMEM medium⁵Perml, 0.1mL was inoculated into a transwell chamber, and the chamber was then moved over the wells of the medium containing the sample, preventing the generation of air bubbles at the interface during the placement and during the culture. After 24h incubation, the transwell chamber was removed, the supernatant discarded, the cells on the upper chamber wall of the chamber wiped with a cotton swab and the cell debris removed by rinsing with PBS, and the chamber was fixed in 90% ethanol in PBS for 10 min. The air-dried chamber was placed in 0.1% crystal violet solution for 30min, where the crystal violet stock solution was 0.5% solution in methanol, diluted with normal saline or PBS immediately before use. After dyeing is finished, useExcess dye was removed by several PBS rinses and the cells were recorded for migration by microscopic photography.

As shown in FIG. 3, the number of tumor cells migrated to the lower chamber was gradually reduced, and the inhibition rate of PvTrag28 protein on the migration performance of HepG2 cells was found to be substantially 100% by counting the number of cells, which is equivalent to the effect of 5-Fu at a dose of 25. mu.g/mL. The result shows that the PvTrag17 protein has strong inhibiting effect on the migration performance of HepG2 cells.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> an antitumor protein and uses thereof

<160>4

<170>PatentIn version 3.3

<210>1

<211>315

<212>PRT

<213> Artificial sequence

<400>1

Met Glu Leu Lys Ala Asn Met Lys Gly Pro Ala Pro Gln Gln Lys Phe

1 5 10 15

Ser Pro Ala Lys Lys Thr Gln Asn Arg Asn Pro Lys Leu Ser Lys Met

20 25 30

Thr Ala Ile Phe Thr Val Ser Pro Leu Gln Ile Ile Leu Phe Ala Leu

35 40 45

Phe Ser Val Phe Ile Leu Asn Pro Ser His Ala Ala Ser Thr Glu Arg

50 55 60

Gly Ser Ile Lys Cys Tyr Leu Pro Asn Asn Leu Met Glu Phe Trp Lys

65 70 75 80

Asp Asp Val Asp Gln Ser Glu Gln Leu Lys Lys Cys Ala Trp Asn Asn

85 90 95

Trp Met Met Arg Leu Glu Ser Glu Trp Glu Asn Phe Asn Thr Ser Met

100 105 110

Lys Ser Lys Lys Asn Val Trp Leu Gln Glu Thr Glu Gln Glu Trp Thr

115 120 125

Glu Trp Ile Lys Gln Met Glu Asn Lys Trp Met Asn Cys Asn Glu Asn

130135 140

Ile Asn Asp Glu Tyr Lys Asp Tyr Leu Ile Ser Lys Ser Ala Thr Trp

145 150 155 160

Thr Asp Glu Glu Trp Lys Glu Trp Ile Lys Thr Glu Gly Lys Asn Phe

165 170 175

Met Lys Thr Asp Leu Glu Lys Trp Ile Lys Ala Lys Glu Thr Ser Leu

180 185 190

Asp Leu Leu Leu Leu Thr Glu Trp Val Gln Trp Lys Asn Glu Lys Ile

195 200 205

Met Ala Trp Leu Leu Ser Glu Trp Lys Thr Glu Glu Asp Thr Tyr Trp

210 215 220

Ser Gln Trp Glu His Ser Thr Trp Leu Lys Trp Leu Asn Leu Thr Gln

225 230 235 240

Lys Lys His Trp Leu Lys Trp Lys Glu Arg Asn His Arg Glu Gly Glu

245 250 255

Gln Trp Ser Thr Trp Leu His Val Lys Glu Asn Val Tyr Ile Phe Ser

260 265 270

Glu Trp Asn Asn Trp Ser Ile Trp Lys Asn Glu Lys Glu Glu Phe Phe

275 280 285

Tyr Lys Trp Met Glu Asp Thr Ile Asn Glu Trp Ile Asn Glu Lys Arg

290 295 300

Trp Asn Thr Leu Val Ser Thr Asp Asn Asp Ser

305 310 315

<210>2

<211>948

<212>DNA

<213> Artificial sequence

<400>2

atggaactaa aagccaatat gaagggtcca gcaccccagc aaaagttctc ccctgctaag 60

aaaacacaaa atagaaatcc caagttatcc aaaatgacgg caattttcac agtttctcct 120

ttacagatta tcttatttgc tctattttca gttttcatct taaatccctc ccatgctgca 180

agcaccgaaa ggggaagtat caagtgttat cttccaaaca atttaatgga attttggaaa 240

gatgacgtag atcaatcaga acaattaaaa aaatgtgcgt ggaataactg gatgatgagg 300

ttggaatcag aatgggaaaa cttcaacaca tccatgaaga gcaaaaagaa cgtatggctc 360

caagaaacag aacaagaatg gaccgaatgg attaaacaaa tggaaaataa atggatgaat 420

tgtaatgaga atattaatga tgaatataag gattatctta tatcaaaatc tgctacatgg 480

actgatgaag aatggaaaga atggataaaa acagaaggga aaaactttat gaaaacagat 540

ttagaaaaat ggattaaagc aaaagaaaca tcattggatt tgttactatt aacagaatgg 600

gtccagtgga aaaatgaaaa gatcatggca tggctattga gcgaatggaa aactgaagaa 660

gacacctact ggtcacaatg ggaacactca acatggctta agtggctcaa cttgacccag 720

aaaaaacatt ggctcaaatg gaaagaaaga aatcataggg aaggtgaaca atggtctact 780

tggttgcacg ttaaagaaaa tgtttatata tttagcgagt ggaataattg gtcaatatgg 840

aaaaatgaaa aagaagaatt cttctacaaa tggatggaag atacaattaa cgagtggata 900

aatgagaaga ggtggaacac cttggtgagc acagataatg actcataa 948

<210>3

<211>27

<212>DNA

<213> Artificial sequence

<400>3

ggatccatgg aactaaaagc caatatg 27

<210>4

<211>27

<212>DNA

<213> Artificial sequence

<400>4

ctcgagtgag tcattatctg tgctcac 27

Claims

1. The application of the protein in preparing the anti-liver cancer medicine is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 1.

2. The use of claim 1, wherein the medicament includes, but is not limited to, vaccines, inhibitors, immunomodulators.