WO2020182768A1

WO2020182768A1 - Methods for bioactive lectin production with improved yield

Info

Publication number: WO2020182768A1
Application number: PCT/EP2020/056264
Authority: WO
Inventors: Konstantinos Efthymiopoulos; Anastasia MANTALIDI
Original assignee: Syndermix Ag
Priority date: 2019-03-08
Filing date: 2020-03-09
Publication date: 2020-09-17
Also published as: GB201903244D0

Abstract

Methods for the production of recombinant lectin proteins in yeast are provided. The methods comprise transforming a Pichia pastoris yeast culture with a nucleic acid expression vector that comprises a gene encoding a PHA polypeptide, wherein the PHA gene is fused to a nucleic acid sequence that encodes a Saccharomyces α-factor prepro- peptide, and wherein the expression of the PHA polypeptide is under the control of an inducible promoter present in the expression vector; maintaining the yeast culture under conditions that support expression of the PHA polypeptide; and isolating the recombinant tetrameric PHA protein from the yeast culture. The methods are suitable for production of recombinant phytohaemagglutinin (PHA) lectin production, particularly PHA-L and PHA-E.

Description

METHODS FOR BIOACTIVE LECTIN PRODUCTION WITH IMPROVED YIELD

FIELD OF THE INVENTION

The invention relates to the recombinant production of plant proteins, especially lectins, in yeast. BACKGROUND OF THE INVENTION

Lectins are proteins are found in a diversity of organisms and are highly specific for the reversible binding of carbohydrate moieties which explains the diversity of reactions caused by Lectins - including the agglutination of erythrocytes and the activation of lymphocytes and other cells.

Plants represent a common source of lectins with the richest abundance occurring in the seeds. The full diversity of biological functions of lectins in plants is not yet fully understood to this date but they are believed to offer protection to the plants from bacterial and fungal invasion, assist in plant growth and modulate plant metabolism. Plant lectins are also toxic to mammals - a feature that may be protective for the plant against ingestion.

The lectin carbohydrate reaction finds multiple applications for example as a biological assay tool as well as a potential therapeutic agent. More specifically, lectins could be used anticancer drugs as they have been shown to lead to apoptosis in different cancer cell lines. Examples may include Korean mistletoe lectin which has been shown to lead to apoptosis of human A253 cancer cells (Choi et al. 2004, Arch Pharm Res. 2004 Jan; 27(1):68-76.), Sophora flavescens lectin which has been shown to inhibit the growth of HeLa cells (Liu et al. 2008, Phytomedicine. 2008 Oct; 15(10):867-75.) and French bean hemagglutinin which has been shown to kill breast cancer MCF-7 cells (Lam et al. 2010, Acta Biochim Pol. 2009; 56(4) .649-54.). The pathways leading to cell death are different but usually involve the activation of caspases, a family of protease enzymes involved in programmed cell death and inflammation.

Lectins could also find application as antiviral drugs. Amongst many examples gold coral lectin was reported to prevent infection of H9 cells with human immunodeficiency virus (HIV-1 ; Miiller et al. 1988, J Acquir Immune Defic Syndr. 1988; 1(5):453-8.). The sugar binding lectins are believed to inhibit fusion of HIV-infected cells with CD4 cells by a carbohydrate-specific interaction with the HIV- infected cells (Hansen et al.1989, AIDS. 1989 Oct; 3(10): 635-41.). Similarly Griffithsin, a lectin which can be isolated from red algae may be used in the treatment of the viral infections such as Zika. The lectin appears to inhibit flaviviral entry as it can crosslink mannose oligosaccharides found on the viral E glycoproteins (Alexandre et al. 201 1 , J Virol. 201 1 Sep; 85(17): 9039-9050). Lectins have also been used in the cosmeceutical context. For example, International Patent Application No. WO-96/38162-A describes a method of using various lectins for prevention and treatment of skin diseases and disorders caused by bacteria, fungi, and viruses.

However, cosmetic compositions as well as pharmaceuticals based on active substances extracted from plants are difficult to standardise and can be prone to large batch to batch variations in the starting materials. Therefore, there is a need for biotechnological derived ingredients which ensure that safety and efficacy can be guaranteed in the cosmetic product. The Common bean, Phaseolus vulgaris contains genes encoding a number of different proteins belonging to the legume lectin family. The proteins expressed by the legume lectin family genes in P. vulgaris have differing functional activities, including inhibition of amylases as well as carbohydrate binding. The most characterised lectin protein of Phaseolus vulgaris products are the major seed lectins, which are derived from two genes, died and dlec2. These genes produce polypeptides designated PHA-E and PHA-L (from "phytohaemagglutinin"; PHA) respectively, in approximately equal amounts. PHA-E and PHA-L polypeptides form a tetrameric protein and are sufficiently similar that they can assemble with each other into the tetramers. Hence, the native PHA lectin purified from P. vulgaris seeds contains a mixture of five diverse isoforms, which can be written as [(PHA-E)₄], [(PHA-E^PHA-L)_!], [(PHA- E)₂(PHA-L)₂], [(PHA-E)1 (PHA-L)₃] and [(PHA-L)₄].

PHA-E and PHA-L differ in their specificity of binding to carbohydrates. For example, there is a known difference in specificity of binding to the complex carbohydrates present on the surface of blood cells, such that PHA-E binds specifically to erythrocytes (red blood cells) whereas PHA-L binds poorly to erythrocytes but much more strongly to leucocytes (white blood cells). Consequently, a tetrameric isoform consisting of [(PHA-E)₄], will agglutinate erythrocytes but not leucocytes, whereas a corresponding isoform consisting of [(PHA-L)₄] agglutinates leucocytes but not erythrocytes; the other isoforms show a mixed agglutination specificity. Hence, variation in the naturally derived material has a profound effect upon the properties of the end product. It is presumed that these homologous genes presumably arose through duplication and divergence of an ancestral PHA gene. The diversity in the biological properties may enable the native tetrameric complexes to exhibit diverse plant defence properties, thereby contributing to improved resistance to herbivores and pests. Hence, the heterogeneity of the PHA complex in P. vulgaris may be the result of positive selective pressure which favours the formation of heterotetramers over homotetramers.

PHA-L has been shown to have some useful therapeutic properties. International Patent application No. WO-97/49420 describes chemoprotective effects upon small intestine issue in rats when PHA-L is administered orally in combination with a high dose of the anti-cancer chemotherapeutic agent 5- fluorouracil. In WO-97/49420 the PHA-L was purified from native P. vulgaris plant material via a complex process requiring multiple steps of affinity chromatography and HPLC. Recovery yield of PHA-L from kidney bean meal starting material was barely over 0.6%.

Hence, due to technical difficulties, purification of [(PHA-L)4] from P. vulgaris is non-viable on anything but a very limited laboratory scale - usually microgram (pg) levels of production - even though the starting material is abundant. Recombinant expression for many eukaryotic lectins in a bacterial host such as E. coli is known to be unsuitable. Plant lectin products often do not fold correctly and are not glycosylated. Plant lectins have been expressed as soluble functional proteins using the yeast Pichia pastohs as an expression host (Raemaekers et al., 1999, Eur. J Biochem. 265: 394-403), however, expression of lectin proteins, such as PHA at true commercially viable yields consistently at sufficiently high grade still remains a challenge. In addition, difficulties persist even when protein is produced recombinantly in terms of ensuring the protein exhibits functional properties that are consistent with extracts of lectins obtained from natural sources.

It is desirable to provide an improved process for the manufacture of high quality pure functional recombinant lectin at commercial yields. It is an object of the present invention to overcome the disadvantages observed in the prior art.

These and other uses, features and advantages of the invention should be apparent to those skilled in the art from the teachings provided herein.

SUMMARY OF THE INVENTION

In a first aspect the invention provides a method for the production of recombinant tetrameric PHA-L protein comprising: a. transforming a Pichia pastoris yeast culture with an expression vector that comprises a gene encoding a PHA polypeptide, wherein the PHA gene is fused to a nucleic acid sequence that encodes a Saccharomyces a-factor prepro- peptide, and wherein the expression of the PHA polypeptide is under the control of an inducible promoter present in the expression vector; b. maintaining the yeast culture under conditions that support expression of the PHA polypeptide; and c. isolating the recombinant tetrameric PHA protein from the yeast culture.

In specific embodiments the inducible promoter is selected from the group consisting of: AOX, AOX core variants, P_GI , PG6 PDC, PGI/2, Peat or synthetic inducible promoters.

In another embodiment the PHA polypeptide is selected from the group consisting of: PHA-L; PHA-E or homologues or derivatives thereof.

In further embodiments the PHA lectin may be selected from the group consisting of: [(PHA-E)₄], [(PHA-EMPHA-L)_!], [(PHA-E)₂(PHA-L)₂], [(PHA-EMPHA-L)₃] and [(PHA-L)₄j.

Suitably, the PHA-L gene is obtained or derived from Phaseolus vulgaris.

In particular embodiments of the invention the recombinant tetrameric PHA protein is isolated from either a supernatant of the yeast culture, and/or a cellular extract obtained from the yeast culture. Suitably the isolated recombinant tetrameric PHA protein can be characterised as biologically functional by demonstrating mitogenic activity towards lymphocytes, suitably Xenopus laevis lymphocytes. Typically, the isolated recombinant tetrameric PHA protein demonstrates a level of mitogenic activity that is comparable to, or even greater than, that demonstrated for plant-derived native PHA protein.

A second aspect of the invention provides an expression vector for use in P. pastohs yeast culture, wherein the expression vector comprises a fusion gene encoding a PHA polypeptide, wherein the PHA gene is fused to a nucleic acid sequence that encodes a Saccharomyces a-factor prepropeptide, and wherein the expression of the fusion gene is under the operative control of an inducible promoter present in the expression vector selected from: AOX, AOX core variants, P_GI , PG6 PDC, PGI/2, P_eat or synthetic inducible promoters.

A third aspect of the invention provides a recombinant tetrameric PHA polypeptide, wherein the polypeptide comprises a Saccharomyces a-factor prepro- peptide, suitably the PHA polypeptide is PHA-L.

A fourth aspect of the invention provides a recombinant tetrameric PHA protein.

In embodiments the PHA-L polypeptide or protein shows biologically comparability to naturally produced PHA-L in accordance with Toll receptor assays and transcriptomics studies.

A fifth aspect of the invention provides a pharmaceutical composition, wherein the composition comprises recombinant PHA protein, suitably the PHA protein is PHA-L.

A sixth aspect of the invention provides a skincare composition, wherein the composition comprises recombinant PHA protein, suitably the PHA protein is PHA-L.

It will be appreciated that the above statements are to be read in conjunction with the embodiments described in further detail below. Each embodiment of the invention may be utilised in isolation or in combination with other embodiments, unless otherwise specified.

BRIEF DESCRIPTION OF THE DRAWINGS

The invention is further illustrated with reference to the following drawings in which

Fig. 1 is a map of a pAVE1308 expression vector of an embodiment of the present invention, showing the main features including the location of the inducible promoter (AOX), the prepro sequence and polycloning site.

Fig. 2 shows the Labchip output displaying elution fractions from culture supernatants obtained from the pAVE1308 expression system.

Fig. 3 shows the Labchip output displaying elution fractions from culture supernatants obtained from the pAVE1309 expression system. Figure 4 a chart of clonal protein expression productivity using the above described expression system.

Figure 5 shows the Labchip output displaying elution fractions from small scale proteins purifications obtained from the pAVE1308 expression system.

Figure 6 shows PHA-L peptide mapping results derived from mass spectrometric data.

Figure 7 shows a UPLC trace of the intact and deglycosylated PHA-L protein product recombinantly obtained by the methods described in the Examples.

Figure 8 shows the full mass spectrum associated with the LC PHA-L protein product peak of intact and deglycosylated samples at an elution time of 4.5 to 6 minutes.

Figure 9 shows an enlarged mass spectrum associated with the LC PHA-L protein product peak of an intact sample at an elution time of 4.5 to 6 minutes.

Figure 10 are bar graphs and associated data that show (A) in vivo PHA-L (natural extract) and (B) SDX-13 (recombinant protein) stimulation of TLR (Toll-Receptor) expressing cell lines.

DETAILED DESCRIPTION OF THE INVENTION

Unless otherwise indicated, the practice of the present invention employs conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA technology, and chemical methods, which are within the capabilities of a person of ordinary skill in the art. Such techniques are also explained in the literature, for example, M.R. Green, J. Sambrook, 2012, Molecular Cloning: A Laboratory Manual, Fourth Edition, Books 1 -3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N. Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridisation: Principles and Practice, Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, IRL Press; and D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts, as well as the others cited herein, are incorporated by reference. Prior to setting forth the invention, a number of definitions are provided that will assist in the understanding of the invention.

As used herein, the term‘comprising’ means any of the recited elements are necessarily included and other elements may optionally be included as well. ‘Consisting essentially of means any recited elements are necessarily included, elements that would materially affect the basic and novel characteristics of the listed elements are excluded, and other elements may optionally be included. ‘Consisting of means that all elements other than those listed are excluded. Embodiments defined by each of these terms are within the scope of this invention.

The term‘isolated’, when applied to a polynucleotide sequence, denotes that the sequence has been removed from its natural organism of origin and is, thus, free of extraneous or unwanted coding or regulatory sequences. The isolated sequence is suitable for use in recombinant DNA processes and within genetically engineered protein synthesis systems. Such isolated sequences include cDNAs, mRNAs and genomic clones. The isolated sequences may be limited to a protein encoding sequence only, or can also include 5’ and 3’ regulatory sequences such as promoters and transcriptional terminators. Prior to further setting forth the invention, a number of definitions are provided that will assist in the understanding of the invention.

A‘polynucleotide’ is a single or double stranded covalently-linked sequence of nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides include DNA and RNA, and may be manufactured synthetically in vitro or isolated from natural sources. Sizes of polynucleotides are typically expressed as the number of base pairs (bp) for double stranded polynucleotides, or in the case of single stranded polynucleotides as the number of nucleotides (nt). One thousand bp or nt equal a kilobase (kb). Polynucleotides of less than around 40 nucleotides in length are typically called‘oligonucleotides’. The term‘nucleic acid sequence’ as used herein, is a single or double stranded covalently-linked sequence of nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Nucleic acid sequences may include DNA and RNA, and may be manufactured synthetically in vitro or isolated from natural sources. Sizes of nucleic acid sequences, also referred to herein as‘polynucleotides’ are typically expressed as the number of base pairs (bp) for double stranded polynucleotides, or in the case of single stranded polynucleotides as the number of nucleotides (nt). One thousand bp or nt equal a kilobase (kb). Polynucleotides of less than around 40 nucleotides in length are typically called‘oligonucleotides’ and may comprise primers for use in manipulation of DNA such as via polymerase chain reaction (PCR).

The term‘nucleic acid’ as used herein, is a single or double stranded covalently-linked sequence of nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Nucleic acids may include DNA and RNA, and may be manufactured synthetically in vitro or isolated from natural sources. Nucleic acids may further include modified DNA or RNA, for example DNA or RNA that has been methylated, or RNA that has been subject to post-translational modification, for example 5’- capping with 7-methylguanosine, 3’-processing such as cleavage and polyadenylation, and splicing. Nucleic acids may also include synthetic nucleic acids (XNA), such as hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), threose nucleic acid (TNA), glycerol nucleic acid (GNA), locked nucleic acid (LNA) and peptide nucleic acid (PNA). Sizes of nucleic acids, also referred to herein as ‘polynucleotides’ are typically expressed as the number of base pairs (bp) for double stranded polynucleotides, or in the case of single stranded polynucleotides as the number of nucleotides (nt). One thousand bp or nt equal a kilobase (kb). Polynucleotides of less than around 100 nucleotides in length are typically called‘oligonucleotides’ and may comprise primers for use in manipulation of DNA such as via polymerase chain reaction (PCR). In specific embodiments of the present invention the nucleic acid sequence comprises messenger RNA (mRNA).

The present invention also refers to homologues and homology. The term‘homology’ as used herein refers in general terms to the existence of a shared ancestry between two polypeptides or proteins based on the amino acid/nucleotide sequence. Homology is inferred from the amino acid/nucleotide sequence similarity between the wild type polypeptide and another protein e.g. homologue.

Proteins are referred to as homologues if they have substantially similar sequence identity or homology to that of lectin proteins described herein. The term“substantially similar sequence identity” is used herein to denote a level of sequence similarity of from about 50%, 60%, 70%, 80%, 90%, 95% to about 99% identity. Percent sequence identity can be determined using conventional methods (Henikoff and Henikoff Proc. Natl. Acad. Sci. USA 1992; 89:10915, and Altschul et al. Nucleic Acids Res. 1997; 25:3389-3402).

According to the present invention, homology to the nucleic acid sequences described herein is not limited simply to 100% sequence identity. Many nucleic acid sequences can demonstrate biochemical equivalence to each other despite having apparently low sequence identity. In the present invention homologous nucleic acid sequences are considered to be those that will hybridise to each other under conditions of low stringency (Sambrook J. et al, supra).The term‘operatively linked’, when applied to nucleic acid sequences, for example in an expression construct, indicates that the sequences are arranged so that they function cooperatively in order to achieve their intended purposes. By way of example, in a DNA vector a promoter sequence allows for initiation of transcription that proceeds through a linked coding sequence as far as a termination sequence. In the case of RNA sequences, one or more UTRs may be arranged in relation to a linked protein coding sequence or open reading frame (ORF). A UTR may be located 5’ or 3’ in relation to an operatively linked ORF.

The term‘operatively linked’, when applied to nucleic acid sequences, for example in an expression construct, indicates that the sequences are arranged so that they function cooperatively in order to achieve their intended purposes. By way of example, in a DNA vector a promoter sequence allows for initiation of transcription that proceeds through a linked coding sequence as far as a termination sequence. In the case of RNA sequences, one or more UTRs may be arranged in relation to a linked protein coding sequence or open reading frame (ORF). A UTR may be located 5’ or 3’ in relation to an operatively linked ORF.

The term‘promoter’ as used herein denotes a site on DNA to which RNA polymerase will bind and initiate transcription. Promoters are commonly, but not always, located in the 5’ non-coding regions of genes. In the present invention‘inducible’ promoters are those whose activity - i.e. ability to direct transcription of an operably linked ORF - is dependent upon the presence of a triggering chemical or physical factor. Typically, triggering chemical factors may include nutrients, alcohols, antibiotic compounds, signalling molecules and metal ions. Physical triggering factors may include presence or absence of light (photostimulation) or a change in temperature (thermo-/cryo- stimulation). An alternative to inducible promoters are‘constitutive’ promoters which are generally non-inducible and are permanently active. The relative strength of constitutive promoters may vary and can be dependent upon cell culture conditions including nutrient status and cell density.

The term‘polypeptide’ as used herein is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or in vitro by synthetic means. Polypeptides of less than around 12 amino acid residues in length are typically referred to as‘peptides’ and those between about 12 and about 30 amino acid residues in length may be referred to as‘oligopeptides’. The term‘polypeptide’ as used herein denotes the product of a naturally occurring polypeptide, precursor form or proprotein. Polypeptides can also undergo maturation or post-translational modification processes that may include, but are not limited to: glycosylation, proteolytic cleavage, lipidization, signal peptide cleavage, propeptide cleavage, phosphorylation, and such like. The term‘protein’ is used herein to refer to a macromolecule comprising one or more polypeptide chains, such as a multimer.

The term‘amino acid’ in the context of the present invention is used in its broadest sense and is meant to include naturally occurring L a-amino acids or residues. The commonly used one and three letter abbreviations for naturally occurring amino acids are used herein: A=Ala; C=Cys; D=Asp; E=Glu; F=Phe; G=Gly; H=His; l=lle; K=Lys; L=Leu; M=Met; N=Asn; P=Pro; Q=Gln; R=Arg; S=Ser; T=Thr; V=Val; W=Trp; and Y=Tyr (Lehninger, A. L., (1975) Biochemistry, 2d ed., pp. 71-92, Worth Publishers, New York). In conventional notation X=any amino acid, although is used herein also to refer to an absence or insertion of an amino acid residue in a specified sequence. The general term ‘amino acid’ further includes D-amino acids, retro-inverso amino acids as well as chemically modified amino acids such as amino acid analogues, naturally occurring amino acids that are not usually incorporated into proteins such as norleucine, and chemically synthesised compounds having properties known in the art to be characteristic of an amino acid, such as b-amino acids. For example, analogues or mimetics of phenylalanine or proline, which allow the same conformational restriction of the peptide compounds as do natural Phe or Pro, are included within the definition of amino acid. Such analogues and mimetics are referred to herein as‘functional equivalents’ of the respective amino acid. Other examples of amino acids are listed by Roberts and Vellaccio (The Peptides: Analysis, Synthesis, Biology, Gross and Meiehofer, eds., Vol. 5 p. 341 , Academic Press, Inc., N.Y. 1983). Such modifications may be particularly advantageous for increasing the stability of domains and/or for improving or modifying solubility, bioavailability and delivery characteristics (e.g. for in vivo applications).

The term‘gene product’ as used herein refers to the product of the coding sequence or ORF. The gene product may comprise a polypeptide or protein.

The term‘lectin’ as used herein refers to any protein with carbohydrate recognition property which may be of plant, animal, fungal, bacterial, or viral origin. The lectin may be the wild type protein or genetically engineered. In the context of this disclosure the term 'PHA protein’ is to be understood to refer to PHA-L, PHA-E and homologues or derivatives thereof. More particularly, a PHA protein may be selected from tetrameric [(PHA-E)₄], [(PHA-E)₃(PHA-L)₁], [(PHA-E)₂(PHA-L)₂], [(PHA-E)_! (PHA-L)₃] and [(PHA-L)_4]

The term‘PHA homologue’ is understood to refer to a polypeptide with common ancestry to the PHA polypeptide determined by sequence similarity.

The term‘derivative’ is understood to refer to polypeptide variants, of lectins described herein, which may be modified when compared to the wild type polypeptide by:

(i) N-terminal and/or C-terminal substitution and/or truncation of up to eight amino acid residues of the amino acid sequence of the polypeptide; and/or

(ii) protein engineering to include mutations, optionally point mutations, or larger substitutions, truncations, deletions or insertions, at one or more ends or within in solvent exposed loops or structural motifs comprised within the polypeptide; and/or

(ii) fusion with other proteins or polypeptides, either of lectin or non-lectin origin, including fluorophores (such as GFP or RFP), antibodies, affimers, aptamers, or polypeptides with an enzymatic activity.

The resulting derivative may have up to 50, 60, 70, 80, 90, 95, 99% sequence identity with the wild type PHA polypeptide.

The term ‘fusion protein or polypeptide’ as used herein refers to chimaeric proteins which are produced through joining of two of more polypeptide coding sequences (e.g. ORFs) originating from separate genes. When such a fusion gene is translated a single polypeptide is created which has functional properties derived from each of the original proteins. Fusion proteins are created by recombinant DNA technology as understood by the skilled person.

The term‘transformation’ as used herein refers to the process by which exogenous DNA is introduced into a cell, resulting in a genetic modification.

The present invention is based in part upon the observation by the inventors that unexpectedly high yields of recombinant PHA protein are obtained in the methylotrophic yeast Pichia pastohs when the Saccharomyces a-factor prepro- peptide is used to direct secretion of the recombinant PHA into the culture medium. To achieve this, the inventors have pursued a strategy in which the yeast prepropeptide is fused to mature PHA coding sequences. In addition, whilst production of recombinant PHA from Pichia pastoris transformed with expression constructs has been described previously in Raemaekers et al. 1999 (supra), it has been found presently that the previous choice of expression system using the inducible alcohol oxidase 1 gene (AOX1) promoter system actually contributes to lower yields. In embodiments of the invention, the lectin may be selected from the group suitably consisting of: PHA; arcelin; GNA (Galanthus nivalis lectin); NICTBABA ( Nicotiana tabacum lectin); MOL ( Mornininga oleiflora lectin); frutalin lectins (Jacalin lectin, helianthus lectins); EUL (Euonymus lectin - e.g. rice and the spindle tree lectins); monocot lectins (tulip crocus narcissus lectin) and tomato lectins.

The present invention, therefore, provides a recombinant protein expression system that advantageously expresses biologically active PHA at high levels, under an inducible promoter, and in a form that allows for simple recovery of protein from culture medium. The expression system is readily scaled up and facilitates commercial levels of biologically active recombinant PHA production that hitherto were not considered possible.

In the past PHA lectin has been predominantly extracted from natural sources, which causes batch to batch variation due to impurities or seasonal fluctuations of active ingredients in the natural extract. Advantageously recombinantly expressed PHA exhibits a consistent biological profile when compared to natural extract obtained from natural material, such as beans, with the additional benefit of allowing for production of GMP quality protein with properties comparable to that of the wild type extract in large quantities. The use of the term“comparable” in relation to biological activity is intended to indicate that the biological activity of the recombinant lectin protein is substantially similar to or at least not significantly worse than the naturally derived protein obtained from plant extracts. In embodiments of the invention, the recombinant lectin demonstrates comparable activity that is within at least 25%, at least 20%, at least 15%, at least 10%, and at least 5% of the comparable activity +/- when compared to the natural extract protein. Suitably the comparable activity is not more than one order of magnitude different from the wild type extracted protein activity in any given assay of biological activity. As described in more detail below, one suitable cellular assay of biological activity a Toll receptor (TLR) reporter assay carried out in HEK-Blue NF-KB cells. It will be understood that alternative in vitro and in vivo assays may be used to assess comparable biological activity in lectins, particularly PHA lectins.

According to an embodiment of the present invention there is provided a PHA- expression system that comprises the use of a P. pastoris expression vector in which expression of the native PHA gene is fused, typically in frame, to Saccharomyces a-factor prepro- peptide and, wherein expression of the protein is placed under the control of a promoter that functions inducibly in P. pastoris. In one embodiment of the invention the system comprises an expression vector that comprises a P. pastoris Alcohol-Oxidase Promoter (AOX). Alternative embodiments permit for the use of other inducible promoters from control genes.

In a further alternative embodiment it is envisaged that synthetic inducible promoters may be utilised in the system of the invention.

In embodiments the lectin to be expressed by the aforementioned expression system may be selected from the group consisting of: PHA, PHA homologues and PHA derivatives.

In embodiments PHA polypeptides may be modified by: (i) N-terminally and/or C-terminally substitution and/or truncation of up to eight amino acids of the amino acid sequence of the protein; and/or

(ii) protein engineering to include mutations; and/or

(ii) fusion with other proteins or polypeptides, lectin or non-lectin,

The resulting polypeptide may have up to 50, 60, 70, 80, 90, 95, 99% sequence identity with the wild type PHA polypeptide.

In embodiments the lectin may be selected from the group consisting of: PHA-E, arcelin; GNA (_' Galanthus nivalis lectin); NICTBABA (Nicotians tabacum lectin); MOL ( Momininga oleiflora lectin); frutalin lectins (Jacalin lectin, helianthus lectins); EUL (Euonymus lectin - e.g. rice and the spindle tree lectins); monocot lectins (tulip crocus narcissus lectin) and tomato lectins.

In a further alternative embodiment it is envisaged that synthetic inducible promoters may be utilised in the system of the invention. Such inducible promoters may include core promoters comprising a core promoter nucleotide sequence which suitably may be flanked by variable nucleotide flanking regions at the 5’ and/or 3’ position of the core promoter nucleotide sequence.

Core promoter systems may employ synthetic transcription factors (sTFs) and engineered promoters depending on sTFs to control the expression of genes. The sTF-dependent promoters may comprise a variable number of sTF- binding sites linked to a core promoter (for example, see US 2018/371468 A1).

The operative components of a plasmid vector of an embodiment of the invention used for lectin protein production may comprise a constitutive promoter which is located upstream of the gene encoding the lectin polypeptide; and transcriptional termination region (terminator), which is located downstream of the gene and assists with the stability of mRNA.

Further the vector may comprise additional sequences such as one or more an antibiotic-resistance genes which allows for selection of yeast cultures that harbour the plasmid vector within the cells. Multiple cloning sites (MCSs), which contain the specific position for restriction enzyme to cut and clone genes into the plasmid vector, are also included. Another optional part is a gene that encodes the signal peptide or secretion signal (a-factor secretion signal) allowing for secretion of the protein to the outside of the cell into the culture medium which assists with purification and isolation of the polypetide/protein product.

Further, the target protein may be tagged, suitably with a polyhistidine tag, or equivalent, at the N- terminus and/or C-terminus to assist with purification.

It has been found by the inventors that the expression system described is particularly advantageous for generating commercial quantities of PHA protein under conditions that support high levels of heterologous recombinant protein expression, such as those described in Macau ley-Patrick et al. (Yeast, Volume 22, Issue 4, March 2005: 249-270).

According to embodiments of the invention, lectin produced by the described methods may be incorporated into pharmaceutical or cosmeceutical formulations suitable for administration to a subject. Such preparations of the invention are formulated to conform with regulatory standards and can be administered orally, intra-venously, topically, or via other standard routes. The pharmaceutical preparations may be in the form of tablets, pills, lotions, gels, liquids, powders, suppositories, suspensions, liposomes, microparticles or other suitable formulations known in the art.

The lectin proteins of the present invention may be comprised within pharmaceutical compositions in certain embodiments. Typically, a specified protein will be isolated from a library and characterised for its desired therapeutic potential. Suitably the isolated protein will be utilised in purified form together with one or more pharmacologically approved carriers. Typically, these carriers will include aqueous or alcoholic/aqueous solutions, emulsions or suspensions, any including saline and/or buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer's. Suitable physiologically-acceptable adjuvants, if necessary to keep a polypeptide complex in suspension, may be chosen from thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates. Intravenous vehicles include fluid and nutrient replenishers and electrolyte replenishers, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, may also be present. A variety of suitable formulations can be used, including extended release formulations where there is particular need for such a mode of administration.

In specific embodiments of the present invention, the lectin proteins of the present invention of the present invention are utilised as separately administered compositions or in conjunction with other therapeutic agents.

The route of administration of pharmaceutical compositions according to the invention may be any of those commonly known to those of ordinary skill in the art. For therapy, including without limitation immunotherapy, the selected ligands thereof of the invention can be administered to any patient in accordance with standard techniques. The administration can be by any appropriate mode, including parenterally, intravenously, intramuscularly, intraperitoneally, transdermally, via the pulmonary route, or also, appropriately, by direct infusion with a catheter. The dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counterindications and other parameters to be taken into account by the clinician. Administration can be local (e.g., local delivery to the lung by pulmonary administration, e.g., intranasal administration) or systemic as indicated.

The proteins of the invention will be suitably preserved in order to be in a form appropriate for administration to human or animal patients. Preservation may also involve chemical or other modification so as to stabilise the polypeptides for in-vivo use. Stabilisation may include PEGylation or other appropriate chemical processing. In addition, the lectin proteins can be lyophilised for storage and reconstituted in a suitable carrier prior to use.

Pharmaceutical compositions containing the present modified polypeptides or a combination thereof with other drugs or biologicals can be administered for prophylactic and/or therapeutic treatments. In certain therapeutic applications, an adequate amount to accomplish at least partial inhibition, suppression, modulation, killing, or some other measurable parameter, of a population of selected cells is defined as a therapeutically-effective dose.

The invention is further illustrated by the following non-limiting examples.

EXAMPLES

Materials

Except where stated otherwise specifically, materials used in the research were as follows:

Molecular biology reagents were from a variety of suppliers including, New England Biolabs (www.neb.com), expression vectors and Pichia pastohs strain were supplied by FUJIFILM Diosynth Biotechnologies. Other reagents were of laboratory grade or better

Example 1 - Construction of expression vector

The Fujfilm Diosynth Biotechnology Alcohol Oxidase (AOX) expression plasmid was constructed from synthetic DNA and named pAVE5223.

Example 2 - Expression construct for PHA-L

Expression of PHA-L using the yeast MFa factor prepro sequence to direct secretion.

The DNA sequence of Phaseolus vulgaris was obtained from Genbank Database accession number K03289.1 SEQ ID NO:1. Two expression cassettes were synthesised by Geneart Thermofisher.

Gene Cunard C was made using SEQ ID NO:1 and the FUJIFILM Diosynth Biotechnologies Translation Initiation/Secretion Leader operably linked to the 5^' end of mature PHA-L gene. The complete expression cassette DNA sequence is shown in SEQ ID NO:2 including translational stop codons and restriction sites.

Gene Cunard D was made using SEQ ID NO :1 and the industry standard Translation Initiation/Secretion Leader from Thermofisher/Life Technologies pGAP expression plasmid operably linked to the 5^' end of the mature PHA-L gene. The complete expression cassette DNA sequence is shown in SEQ ID NO:3

Cunard C and Cunard D genes were cloned into expression plasmid pAVE522 by means of Mfel and Notl restriction sites to create expression plasmids pAVE1308 (Cunard C) and pAVE1309 (Cunard D). Expression plasmids were confirmed by DNA sequencing. The features of pAVE1308 are shown in Figure 1.

Example 3

3.1 Transformation of Pichia pastoris

Pichia pastoris (strain NRRLY11430) cells were made competent and were then transformed with linearised plasmid DNA containing the expression construct described above via electroporation.

The pAVE1308 & pAVE1309/PHA-L expression constructs amplified in E. coli were used to prepare plasmid DNA, using a proprietary DNA purification kit (Qiagen). Plasmid DNA were linearised with Pmel (New England Biolabs), and checked for correct linearisation by agarose gel electrophoresis. The linearised DNA (40pg) was used to transform Pichia pastoris strain NRRLY11430 using electroporation. Transformants for both plasmids were selected by plating yeast cells on media containing zeocin concentrations ranging from 100pg/ml to 1000 pg/ml. Yeast colonies growing on selective media were transferred to streak plates under the 100 pg/ml zeocin selection after 4 days, and formed the primary bank of transformed P. pastoris clones.

Selected P. pastoris clones were then screened for expression of recombinant PHA-L. Twenty three individual clones were grown as 2ml cultures in deep well microtitre plates in BMGLY +methanol medium for 5 days. Culture supernatants were isolated by centrifugation, and were screened for the presence of PHA-L by analysis of samples by Labchip Capillary electrophoresis. The productivity of pAVE1308 and pAVE1309 is shown in Figures 2 and 3.

Clones 11-2, 11-3, 11-4, 11-12 and 11 -22 were selected for fermentation evaluation using

ambr™250. Strains were grown to an OD600 of 8 and centrifuged and resuspended in 40% glycerol prior to storage at -70°C.

A vial of each strain was thawed and inoculated into a shake flask with the parameters shown in table 1 using the media in table 2. The fermentation vessels were filled with the basal media shown in table 8 and inoculated with cells to the parameters shown in table 3. Feed composition is shown in tables 4, 5, 6 and 7. Two bioreactors were run per strain. One set of fermentations received the defined feed shown in table 6. The other set of fermentations received the complex yeast extract feed shown in table 7. Table 1 Inoculation Flask parameters

Table 2 Inoculation Flask Media

Table 3 ambr®250 Fermentation parameters

Table 4 d-Biotin Solution

Table 5 Methanol Feed

Table 6 Trace Metal Solution

Table 7 Glycerol Feed Solution

Table 8 Yeast Extract Feed Solution

Table 9 AOX Fermenter Medium

Example 4

4.1 A small-scale purification of recombinant PHA-L (SDX-13) produced by Pichia pastohs clone Pp(PHA-L)

Small scale purifications of the most productive four bioreactors was performed using Capto S Robocolumn screening. The columns were flushed with 5 column volumes (CV) water, cleaned with 3CV 1 M NaOH and then flushed with 5CV water. The columns were then equilibrated with 50mM Sodium Acetate pH3.6 before loading of with 20ml of culture supernatant adjusted to pH3.6 and diluted 3 fold in water to conductivity below 15mS/cm. The columns were then subjected to 5CV post load wash of 50mM Sodium Acetate pH3.6. The product was eluted over a 12CV cycle of 50mM Sodium Acetate with a gradient of 0-1 M NaCL pH3.6. A column strip was performed with 4CV 1 M NaCI pH3.6. These results are shown in Figure 5

Example 5

5.1 Determining Molecular Weight

The protein eluate obtained from the small scale purification was analysed by peptide mapping using Liquid Chromatography Mass Spectrometry (LC-MS) to confirm identity. The parameters used are shown in table 9. A Waters Acquity Protein BEH C18, 1.7pm, 2.1 x 75 mm column was used for initial chromatography. Mobile Phase A was 0.1 % Trifluoroacetic Acid in water. Mobile Phase B was 0.1 % Trifluoroacetic acid in acetonitrile. Seal wash was performed with 20% methanol.

Table 10 LC Parameters

UPLC Instrument Method (MSeR.acm) summary:

UPLC Gradient:

Table 11 MS Parameters

Figure 6 shows that the peptide mapping was able to positively identify 83% of the molecule confirming that the protein expressed and purified is PHA-L. The intact SDX-13 protein product as well as deglycosylated sample was analysed by ultraperformance liquid chromatography mass spectrometry. Mass spectrometric data was recorded at a product elution time of 4.5 to 6 min. The protein mass fingerprint was consistently reproducible for intact full protein samples as well as deglycosylated samples (Figures 7 to 9).

Example 6 6.1 TLR Cell Screen studies

The ability of SDX-13 and PHA-L to stimulate Toll-like Receptor mediated intracellular signalling which is a viable industry model of gut wall epidermal inflammatory response was determined using a panel of cell lines that over-express a given TLR protein and the reporter gene, secreted embryonic alkaline phosphatase (SEAP), under the control of a minimal promoter fused to five NF-KB and AP-1 binding sites. The cells also endogenously express TLR1 and TLR6 which can form heterodimers with TLR2.

Method

HEK-Blue NF-KB Reporter cells (50,000 cells per well) over-expressing TLR 2, 3, 4, 5, 7, 8 or 9 (Invivogen) and TLR negative control cells expressing reporter only, were stimulated for 18 hours with SDX-13 or PHA-L in duplicate at final assay concentrations of 0.5pg/ml, 5pg/ml, 50pg/ml in a total assay volume of 200pl. Positive TLR agonist controls were included for each cell line at the concentrations shown in Table 5. TNFa (100ng/ml) was used at a control for NF-KB activation in the TLR negative control cells. Levels of SEAP activity were assessed using HEK-Blue detection (Invivogen), a cell culture medium for real time detection of SEAP activity. Hydrolysis of the SEAP substrate in the medium was determined by measurement of optical density at 620-655nm. Results were expressed as mean optical density values (OD) after subtraction of the signal obtained in the absence of agonist. Table 14 Positive Agonist Controls used for TLR Reporter Cell Assays

Results

PHA-L and SDX-13 demonstrated the strongest agonist activity in the TLR2 and TLR4 reporter cell lines (Figure 12). Figure 12 shows human TLR reporter cell lines (hTLR2, hTLR3, hTLR4, hTLR5, hTLR7, hTLR9) and the TLR negative reporter cells (TLR-) were stimulated with 0.5, 5, 50pg/ml Compound A - PHA-L (A) or Compound B - SDX-13 (B) for 18 hours at 37°C. Specific TLR agonists as described in Table 5 were used as positive controls, TNFa was used as the positive control for NF- kB pathway activation in the TLR- cell line.

The PHA-L result is consistent with published data (Unitt and Hornigold, 201 1). Low levels of activation of TLR 7, 8 and 9 by PHA-L were also observed at the highest cone. Tested (50pg/ml), however it is difficult to conclude whether this represents a specific response. The specificity of the reporter gene responses for the over-expressed TLR was confirmed by the lack of activation observed for the TLR negative reporter cells with PHA-L and SDX-13. Reporter gene activity in these cells was activated by TNFa confirming the presence of a functional NF-kB signalling pathway.

The SDX-13 and PHA-L acted as specific agonists of TLR4 and TLR2 in the reporter gene assays. There was minimal or no agonist activity when other TLRs were expressed on the cell surface in this assay format. Whilst there did appear to be some difference in heterodimer preference between SDX- 13 (TLR1 -2) and PHA-L (TLR2-6) the data indicated that both lectins had the potential to activate intracellular signalling through either of the heterodimers.

Although particular embodiments of the invention have been disclosed herein in detail, this has been done by way of example and for the purposes of illustration only. The aforementioned embodiments are not intended to be limiting with respect to the scope of the appended claims, which follow. The choice of nucleic acid starting material, the clone of interest, or type of library used is believed to be a routine matter for the person of skill in the art with knowledge of the presently described embodiments. It is contemplated by the inventors that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims. SEQ ID NO:1 Mature PHA-L DNA sequence agcaacgatatctacttcaacttccaaaggttcaacgaaaccaaccttatcctccaacgcgatgcctccgtctcatcctccggccagttacgact aaccaatcttaatggcaacggagaacccagggtgggctctctgggccgcgccttctactccgcccccatccaaatctgggacaacaccaccg gcaccgtggccagcttcgccacctccttcacattcaatatacaggttcccaacaatgcaggacccgccgatggacttgcctttgctctcgtcccc gtgggctctcagcccaaagacaaagggggttttctaggtcttttcgacggcagcaacagcaatttccatactgtggctgtggagttcgacaccct ctacaacaaggactgggaccccacagagcgtcatattggcatcgacgtgaactccatcaggtctatcaaaacgacgcggtgggattttgtga acggagaaaacgccgaggttctgatcacctatgactcctccacgaatctcttggtggcttctctggtttacccttctcagaaaacgagcttcatcgt ctctgacacagtggacctgaagagcgttcttcccgagtgggtgagcgttgggttctctgccacaactgggattaataaagggaacgttgaaacg aacgacgtcctctcttggtcttttgcttccaagctctccgatggcaccacatctgaaggtttgaatctcgccaacttggtcctcaacaaaatcctcta

9

SEQ ID NO: 2 DNA sequence C

CAATTGgaaacgAtgagatttccttcaatttttactgcagttttattcgcagcatcctcCgcattagctgctccagtcaacactacaacagaag atgaaaCggcacaaattccggctgaagctgtcatcggttacttagatttaGaaggggatttcgatgttgctgttttgccattttccaacagcacaA ataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctttggataaaagagaggctgaagctagcaac gatatctacttcaacttccaaaggttcaacgaaaccaaccttatcctccaacgcgatgcctccgtctcatcctccggccagttacgactaaccaat cttaatggcaacggagaacccagggtgggctctctgggccgcgccttctactccgcccccatccaaatctgggacaacaccaccggcaccgt ggccagcttcgccacctccttcacattcaatatacaggttcccaacaatgcaggacccgccgatggacttgcctttgctctcgtccccgtgggctc tcagcccaaagacaaagggggttttctaggtcttttcgacggcagcaacagcaatttccatactgtggctgtggagttcgacaccctctacaaca aggactgggaccccacagagcgtcatattggcatcgacgtgaactccatcaggtctatcaaaacgacgcggtgggattttgtgaacggagaa aacgccgaggttctgatcacctatgactcctccacgaatctcttggtggcttctctggtttacccttctcagaaaacgagcttcatcgtctctgacac agtggacctgaagagcgttcttcccgagtgggtgagcgttgggttctctgccacaactgggattaataaagggaacgttgaaacgaacgacgt cctctcttggtcttttgcttccaagctctccgatggcaccacatctgaaggtttgaatctcgccaacttggtcctcaacaaaatcctctagtaaGCG

GCCGC

SEQ ID NO: 3 DNA Sequence D

CAATTGAACAACTATTTCGAAACGATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCAT

CCTCCGCATTAGCT GCTCCAGT CAACACT ACAACAG AAG AT GAAACGGCACAAATTCCGGCT GA

AGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAG

CACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGT

ATCTCTCGAGAAAAGAGAGGCTGAAGCTagcaacgatatctacttcaacttccaaaggttcaacgaaaccaaccttatcctc caacgcgatgcctccgtctcatcctccggccagttacgactaaccaatcttaatggcaacggagaacccagggtgggctctctgggccgcgc cttctactccgcccccatccaaatctgggacaacaccaccggcaccgtggccagcttcgccacctccttcacattcaatatacaggttcccaac aatgcaggacccgccgatggacttgcctttgctctcgtccccgtgggctctcagcccaaagacaaagggggttttctaggtcttttcgacggcag caacagcaatttccatactgtggctgtggagttcgacaccctctacaacaaggactgggaccccacagagcgtcatattggcatcgacgtgaa ctccatcaggtctatcaaaacgacgcggtgggattttgtgaacggagaaaacgccgaggttctgatcacctatgactcctccacgaatctcttgg tggcttctctggtttacccttctcagaaaacgagcttcatcgtctctgacacagtggacctgaagagcgttcttcccgagtgggtgagcgttgggttc tctgccacaactgggattaataaagggaacgttgaaacgaacgacgtcctctcttggtcttttgcttccaagctctccgatggcaccacatctgaa ggtttgaatctcgccaacttggtcctcaacaaaatcctctagtaaGCGGCCGC

Claims

WHAT IS CLAIMED IS:

1. A method for the production of recombinant PHA protein comprising: a. transforming a Pichia pastohs yeast culture with a nucleic acid expression vector that comprises a gene encoding a PHA polypeptide, wherein the PHA gene is fused to a nucleic acid sequence that encodes a Saccharomyces a-factor prepro- peptide, and wherein the expression of the PHA polypeptide is under the control of an inducible promoter present in the expression vector;

b. maintaining the yeast culture under conditions that support expression of the PHA polypeptide; and

c. isolating the recombinant tetrameric PHA protein from the yeast culture.

2. The method of claim 1 , wherein the inducible promoter is selected from the group consisting of: AOX, AOX core variants, P_GI ,PG6 PDC, PGI_/2, Peat-

3. The method of claims 1 or 2, wherein the PHA polypeptide is selected from the group consisting of: PHA-L; PHA-E or homologues or derivatives thereof.

4. The method of claim 3, wherein PHA-L gene is obtained or derived from Phaseolus vulgaris.

5. The method of any one of claims 1 or 4, wherein the recombinant PHA protein is isolated from a supernatant of the yeast culture.

6. The method of any one of claims 1 to 5, wherein the recombinant PHA protein is isolated from a cellular extract obtained from the yeast culture.

7. An expression vector for use in Pichia pastoris yeast culture, wherein the expression vector comprises a fusion gene encoding a PHA polypeptide, wherein the PHA gene is fused inframe to a nucleic acid sequence that encodes a Saccharomyces a-factor prepro- peptide, and wherein the expression of the fusion gene is under the operative control of a inducible promoter present in the expression vector selected from: AOX, AOX core variants, P_G1,P_G6 PDC, P G 1 /2₁ Peat or synthetic inducible promoters.

8. A recombinant tetrameric PHA polypeptide, wherein the polypeptide comprises a Saccharomyces a-factor prepro- peptide.

9. The recombinant tetrameric PHA polypeptide of claim 8, wherein the PHA polypeptide is PHA-L.

10. The PHA-L polypeptide of claim 9, wherein the PHA-L polypeptide shows comparable biological activity to wild type PHA-L comprised in an extract from natural material in a Toll receptor (TLR) reporter assay carried out in HEK-Blue NF-KB cells..

11. A recombinant tetrameric PHA-L protein, wherein the PHA-L protein shows comparable biological activity to wild type PHA-L comprised in an extract from natural material in a Toll receptor (TLR) reporter assay carried out in HEK-Blue NF-KB cells. .

12. A pharmaceutical composition, wherein the composition comprises a recombinant PHA protein and a pharmaceutically acceptable carrier.

13. The pharmaceutical composition of claim 12, wherein the PHA protein is PHA-L.

14. The pharmaceutical composition of claim 13, wherein the PHA-L is produced in Pichia pastohs.

15. The pharmaceutical composition of either one of claims 13 or 14, wherein the recombinant PHA-L shows comparable biological activity to wild type PHA-L comprised in an extract from natural material in a Toll receptor (TLR) reporter assay carried out in HEK-Blue NF-KB cells.

16. A skincare composition, wherein the composition comprises recombinant PHA protein, and a suitable carrier.

17. The skincare composition of claim 15, wherein the PHA protein is PHA-L.

18. The skincare composition of claim 17, wherein the PHA-L is produced in Pichia pastoris.

19. The skincare composition of claim 16, wherein the recombinant PHA-L shows comparable biological activity to wild type PHA-L comprised in an extract from natural material in a Toll receptor (TLR) reporter assay carried out in HEK-Blue NF-KB cells.

20. A recombinant PHA protein obtainable by the process of any one of claims 1 to 6.

21. The recombinant PHA protein of claim 20, wherein the PHA protein is PHA-L.