CN101643511B - Fusion protein for inhibiting telomerase activity, preparation and application thereof - Google Patents

Abstract

The invention discloses fusion protein. The fusion protein comprises telomerase activity telomerase inhibitory protein LPTS and trans-activation protein TAT. The invention also discloses nucleic acid for coding the fusion protein, a vector containing the nucleic acid and a host cell, and a composition containing the fusion protein. The firstly prepared fusion protein of the TAT and the LPTS is proved to be capable of penetrating the cell membrane and to have excellent effect of inhibiting the growth of tumor cells.

Description

Suppress fusion rotein, its preparation and the application of telomerase activation

Technical field

The invention belongs to biotechnology and biochemical engineering field.More particularly, the present invention relates to the telomerase activity inhibition protein that a kind of fusion has nexin transduction domain, and its preparation method and application.

Background technology

Telomerase (Telomerase) is a kind of ribonucleoprotein that synthesizes and extend the cell chromosome telomere, and it comprises two kinds of basal component: reversed transcriptive enzyme catalytic subunit hTERT and RNA component hTR.Telomerase can be template with self RNA, and telomere repeat sequence is synthesized in reverse transcription, is added to end of chromosome, and the losing of telomeric dna when remedying cell fission kept the length of telomere.

Studies show that, in the normal human cell telomerase activation almost detect less than, therefore, people's normal somatic cell division number of times is limited, the cell per minute splits once, and telomere is just lost 50-200bp, and the cell growth is suppressed when telomere shortens to a certain degree, namely be called cell aging, and deathward.

Yet, in most malignant cells (85%), telomerase activation can be detected and activity is stronger, Telomerase to the superimposing compensation again of telomere its continuing in the cell proliferation process lose, thereby make cell constantly to divide, this is an important mechanisms of cell immortalityization and canceration.

The experimental results has been summed up in analyses such as Kim, detected more than 100 kind of malignant tumour sample, the susceptibility of pointing out the Telomerase diagnosing tumour is 85%, specificity is 91%, positive predictive value is 91%, negative predictive value is 81%, fully show value (the Kim NW of Telomerase in diagnosing tumor, Piatyszek MA, Prowse KR, et al.Specific association of human telomerase activity with immortalcells and cancer.Science.1994Dec 23; 266 (5193): 2011-5.).Kim etc. think, it is one of principal element that takes place malignant tumour that Telomerase is activated, the generation of its activation and expression degree and tumour and shift closely related, suppress Telomerase and make telomere shorten a kind of mechanism that is considered to anticancer, so Telomerase becomes the desirable target spot of neoplasm targeted therapy.

At present, be the oncotherapy research of target spot with the Telomerase, mainly adopted antisense technology (the Kondo S. at the telomerase RNA component, Kondo Y., Li G., et al, Targeted therapy of humanmalignant glioma in a mouse model by 2-5A antisense directed against telomerase RNA.Oncogene, 1998,16:3323 3330.Ludwig A, Saretzki G, Holm PS, et al.Ribozyme cleavage of telomerase mRNA sensitizes breast epithelial cells toinhibitors of topoisomerase.Cancer Res, 2001,61:3053-3061; Feng J., Funk W.D., Wang S.S., et al.The RNA component of human telomerase, Science, 1995,269:12361241), gene therapy technology, ribozyme technology (the Ludwig A of cut end granzyme mRNA, Saretzki G, Holm PS, et al.Ribozyme cleavage of telomerase mRNA sensitizesbreast epithelial cells to inhibitors of topoisomerase.Cancer Res, 2001,61:3053-3061) with (Meyerson such as technology that suppress the telomerase gene transcriptional activity, M.Counter C.M., Eaton E.N., et al.hEST2, the putative human telomerase catalytic subunit gene, isup-regulated in tumor cells and during immortalization, Cell, 1997,90:785795; W.C.Hahn, S.A.Stewart, M.W.Brooks, S.G.York, E.Eaton, A.Kurachi, R.L.Beijersbergen, J.H.Knoll, MMeyerson, R.A.Weinberg, Inhibition of telomeraselimits the growth of human cancer cells, Nat.Med, 1999,5:1641170).These technology can shorten the telomere of tumour cell, and then make cell enter climacteric or death, and the tumorigenicity of tumour cell is significantly descended.

LPTS is a kind of albumen that suppresses the tumour cell telomerase activation that has, and is the new protein formulation of a class, and important application prospects is arranged.LPTS albumen is by LPTS (Liver putative tumor suppressor) genes encoding, this gene is that the relevant candidate of a liver that the inventor utilizes the method for positional cloning to obtain from people's normal hepatocytes cDNA library presses down the new gene of cancer (Liao C., Zhao M.J., Song H., Uchida K., Yokoyama K.K., Li T.P., Identification of the gene for a novel liver-related putativetumor suppressor at a high-frequency loss of heterozygosity region of chromosome8p23in human hepatocellular carcinoma.Hepatology 32 (2000) 721-727).The albumen of this genes encoding have the activity that suppresses the cell Telomerase (Zhou X.Z., Lu K.P..ThePin2/TRF 1-interacting protein PinXl is a potent telomerase inhibitor.Cell, 2001,107,347-359).The LPTS assignment of genes gene mapping is in No. 8 karyomit(e) 8p23 section of people, and this section lacks in multiple malignant cell medium-high frequency.Studies show that LPTS expression amount in liver cancer tissue and hepatoma cell line is extremely low or do not express, the rising of tumour cell Telomerase Activity may be relevant with disappearance or the down-regulated expression of LPTS gene.Bibliographical information is arranged, the LPTS gene is imported liver cancer cell, can suppress the growth, propagation of liver cancer cell, finally cause death (Liao C, Zhao MJ, Zhao J, et al.Mutation analysis of novelhuman liver-related putative tumor suppressor gene in hepatocellular carcinoma.World J Gastroenterol, 2003,9:89-93; Zhou X.Z., Lu K.P..The Pin2/TRF 1-interacting protein PinXl is a potent telomerase inhibitor.Cell, 2001,107,347-359.).Therefore, LPTS has the inhibition growth of tumour cell, and causes the effect of death of neoplastic cells.

Chinese patent ZL00115395.1 discloses the gene order of LPTS and the aminoacid sequence of proteins encoded thereof.In research report in the past, the function of LPTS or PinX1 gene is that the mode by the transfection plasmid obtains.LPTS albumen can not be striden film and be entered in the cell, and this has just limited with the research of albumen form and application.

In traditional experiment and clinical treatment, there have been many methods to be used for protein delivery is entered viable cell, these methods can be divided into virus vector and non-virus carrier two big classes.Than the virus vector method, non-viral delivery strategies has very big advantage aspect Biosafety and the convenient drug administration.The non-virus carrier method comprises: microinjection, electroporation, liposome method, bacteriotoxin, red corpuscle and receptor-mediated endocytosis etc.But the most efficient of these methods is not high or time-consuming, cause necrocytosis easily or form vesicle in the born of the same parents and can not make foreign protein effectively extend across film to enter cell.

Therefore, seek a kind of rapidly, effectively with LPTS albumen input cell and in cell, keep bioactive method to seem particularly important.

Summary of the invention

The object of the present invention is to provide a kind of isolated fusion protein, described fusion rotein comprises telomerase activity inhibition protein LPTS and trans-activator TAT.

Another object of the present invention is to provide the purposes of described fusion rotein, be used for suppressing cell telomerase activation or expression, and then can be used for suppressing the growth of Telomerase positive tumor cell.

In a first aspect of the present invention, a kind of isolated fusion protein is provided, described fusion rotein comprises:

(1) telomerase activity inhibition protein LPTS;

(2) trans-activator TAT; With

(3) be positioned at the connection peptides by 0-20 (preferable is that 0-15 is individual, and better is 0-10, best 1-4, individual as 2-3) amino acid formation between (1) and (2).

In another preference, described fusion rotein is connected and is constituted by (1), (3), (2) basically.More preferably, described fusion rotein is connected and is constituted by (1), (3), (2).

In another preference, described telomerase activity inhibition protein LPTS is:

(a) albumen of the aminoacid sequence shown in the SEQ ID NO:4;

(b) albumen of aminoacid sequence shown in the 16-211 position among the SEQ ID NO:2; Or

(c) replacement, disappearance or the interpolation through one or more amino-acid residues of the aminoacid sequence of (a) or the albumen that (b) limits formed, and have (a) or the protein function that (b) limits by (a) or the albumen of (b) deriving;

Perhaps

Described trans-activator TAT has the albumen of aminoacid sequence shown in the 2-12 position among the SEQ ID NO:2.

In another preference, described telomerase activity inhibition protein LPTS is:

(a1) albumen of aminoacid sequence shown in the 16-211 position among the SEQ ID NO:2; Or

(b1) aminoacid sequence of the albumen that (a1) limited is through 1-10 (preferable 1-6; Better 1-3) replacement, disappearance or the interpolation of amino-acid residue form, and have the albumen of being derived by (a1) of protein function that (a1) limit.

Preferable, described trans-activator TAT is positioned at the aminoterminal of fusion rotein; Described telomerase activity inhibition protein LPTS is positioned at the carboxyl terminal of fusion rotein.

In a second aspect of the present invention, provide a kind of nucleic acid molecule, the described fusion rotein of described nucleic acid molecule encoding.

In a third aspect of the present invention, a kind of carrier is provided, it contains described nucleic acid molecule.

In a fourth aspect of the present invention, a kind of genetically engineered cell is provided, described cell contains described carrier; Or

Be integrated with described nucleic acid molecule in the described cellular genome.

In a fifth aspect of the present invention, a kind of method that produces described fusion rotein is provided, described method comprises: under the condition that is fit to the described fusion rotein of expression, cultivate described cell, express and isolate described fusion rotein.

In a sixth aspect of the present invention, provide the purposes of described fusion rotein, for the preparation of the composition that suppresses the growth of Telomerase positive cell.

In another preference, described cell is the tumour cell of the Telomerase positive.

In another preference, described Telomerase positive cell comprises: liver cancer BEL-7404 cell, liver cancer HepG2 cell or s.

In another preference, described composition also is used for prevention or treatment tumour.

In a seventh aspect of the present invention, a kind of composition that suppresses tumour is provided, described composition contains:

(i) the described fusion rotein of significant quantity; With

(ii) pharmaceutically acceptable carrier.

In a eighth aspect of the present invention, a kind of method with telomerase activity inhibition protein LPTS transfered cell (external non-therapeutic ground) is provided, said method comprising the steps of:

(a) trans-activator TAT and telomerase activity inhibition protein LPTS are merged, obtain fusion rotein;

(b) fusion rotein and the cell of (a) are hatched altogether, thereby telomerase activity inhibition protein LPTS is imported in the cell.

In another preference, described cell is the Telomerase positive cells.

In another preference, described cell is the tumour cell of the Telomerase positive.

In another preference, the method for described acquisition fusion rotein comprises:

(i) provide a construction, contain an expression casette in the described construction, described expression casette contains the element that following operability links to each other: trans-activator TAT encoding gene and telomerase activity inhibition protein LPTS encoding gene;

(ii) with the construction transfered cell expression system of (i), thereby express and purifying obtains described fusion rotein.

In another preference, described trans-activator TAT is positioned at the aminoterminal of fusion rotein; Described telomerase activity inhibition protein LPTS is positioned at the carboxyl terminal of fusion rotein.

On the other hand, also provide the method for a kind of inhibition (as vitro inhibition) growth of tumour cell, described method comprises utilizes described fusion rotein to handle tumour cell.

Other side of the present invention is because the disclosure of this paper is apparent to those skilled in the art.

Description of drawings

Fig. 1 shows the structural representation of T-LPGENE fusion rotein.

Fig. 2 shows the structural map of recombinant expression vector pET24a (+)-T-LPGENE.

Fig. 3 show T-LPGENE in colibacillus abduction delivering and the result after the separation and purification.Wherein, 1: albumen Maker; Before 2:IPTG induces; After 3:IPTG induces; 4: the centrifugal supernatant after the ultrasonication; T-LPGENE albumen behind the 5:SP-sephorose purifying; T-LPGENE albumen behind 6:Superdex 75 purifying.

Fig. 4 shows that the T-LPGENE albumen behind the purifying has the activity of extracorporeal suppression tumor cell Telomerase.Wherein, 1-5: the concentration (nmol) that adds T-LPGENE albumen is respectively: 20,40,80,160,320; 6: blank.

Fig. 5 is presented at T-LPGENE albumen under the mediation of TAT to have and strides film and enter activity in the tumour cell.Wherein,

A: immunofluorescence experiment result, ANTI-LPTS, red fluorescence; DAPI: nucleus; PHASE: cellular form;

The B:Western-blot experimental result, Control: blank cell; 2hr, 6hr, 24hr: albumen is hatched 2hr, 6hr, 24hr.

Fig. 6 shows that the T-LPGENE albumen behind the purifying has the activity (mtt assay) of vitro inhibition Telomerase positive cell growth.Wherein,

Fig. 6 A is for respectively organizing the result of the growing state of cell respectively with the mtt assay detection in the 0th week (W0) and the 6th week (W6).

Fig. 6 B handles the cell growth rate (%) of cell with respect to PBS through the cell of respective handling for each group.

Fig. 7 A has shown each cell (BEL-7404, HepG2 and Saos-2) after the processing of T-LPGENE albumen and control treatment (PBS and TAT-GFP handle), and the cell telomere shortens situation.

Fig. 7 B has shown that the death condition of each cell (BEL-7404, HepG2, Saos-2 and L02) cell after the processing of T-LPGENE albumen and control treatment (PBS and TAT-GFP handle) compares, and wherein arrow indication place is the dead cell place.

Fig. 7 C has shown that each cell (BEL-7404, HepG2, Saos-2 and L02) after the processing of T-LPGENE albumen and control treatment (PBS and TAT-GFP handle), adopts flow cytometer to detect the dna content situation.

Fig. 8 shows that the T-LPGENE albumen behind the purifying has the activity that body reduces Telomerase positive cell BEL-7404 tumorigenicity.Wherein,

Fig. 8 A shows that the T-LPGENE albumen behind the purifying has the activity that body reduces Telomerase positive cell BEL-7404 tumorigenicity.

Fig. 8 B be after the transplantation tumor mouse through T-LPGENE albumen handle with control treatment (PBS and TAT-GFP handle) after, tumor size changes;

Fig. 8 C be after the transplantation tumor mouse through T-LPGENE albumen handle with control treatment (PBS and TAT-GFP handle) after, tumour is the photo of growing state in animal body;

Fig. 8 D be after the transplantation tumor mouse through T-LPGENE albumen handle with control treatment (PBS and TAT-GFP handle) after, the changes in weight of tumour.

Embodiment

The inventor is through long term studies and test, be surprised to find that fusion rotein that telomerase activity inhibition protein LPTS and trans-activator TAT merge formation has not only kept the Telomerase restraining effect of telomerase activity inhibition protein LPTS well, significantly improved the ability that telomerase activity inhibition protein LPTS enters cell again, thereby improved the lethal effect to the Telomerase positive cell greatly, and the cell of Telomerase feminine gender has not been had significant toxic side effect.

LPTS albumen itself does not possess basically strides the ability that film enters cell interior, and Telomerase is positioned at nucleus, thereby does not obviously act on the growth to cell behind the LPTS albumen end for process granzyme positive cell.For telomerase activity inhibition protein LPTS can permeates cell membranes be entered in the cell, the inventor has attempted employing liposome transfection method LPTS has been transported in the cell, but the transfection effect is bad; The inventor has also attempted adopting multiple membrane-spanning protein (cell-penetrating albumen) to be connected with LPTS and has tested and wear the film effect, found that trans-activator TAT is best suited for being connected with LPTS and improving the albumen that LPTS enters cell ability.More preferably, about 190-200 the amino acid whose albumen that contains C-terminal in the LPTS full length sequence is suitable for merging with TAT most, and the fusion rotein of its formation is easy to be transferred in the Telomerase positive cells most, the Telomerase inhibition that performance is excellent.

As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by constituting ", " basically by constituting " and " by constituting "; " mainly by constituting ", " basically by constituting " and " by constituting " belong to the subordinate concept of " containing ", " having " or " comprising ".

Trans-activator TAT

Known membrane-spanning protein has many kinds, comprising: trans-activator TAT, Penetratin, the peptide based on signal sequence, pVEC, Transportan, Amphiphilic model peptide and Arg9 etc.Utilized TAT to carry the precedent that some albumen enters cell although have in the past, and do not enter into cell interior yet TAT is the albumen that is suitable for mediating all kinds, suitable albumen is subjected to the restriction of factors such as length protein, character, space structure; And experience is in the past also found, after TAT and activated protein merge, may influence the folding of the latter, and then influences the latter's biological activity.Through studying repeatedly and comparing, the inventor finds that TAT is particularly suitable for merging with LPTS, and the fusion rotein of formation is easy to enter into cell, and can enter in the nucleus.

Preferable, described trans-activator has the aminoacid sequence shown in the 2-12 position among the SEQ ID NO:2.

Telomerase activity inhibition protein LPTS

LPTS is a kind of albumen that suppresses the tumour cell telomerase activation that has, and it is positioned No. 8 karyomit(e) 8p23 section of people, and this section lacks in multiple malignant cell medium-high frequency.Studies show that LPTS expression amount in liver cancer tissue and hepatoma cell line is extremely low or do not express, the rising of tumour cell Telomerase Activity may be relevant with disappearance or the down-regulated expression of LPTS gene.

The present invention can use full-length proteins or its bioactive fragment of LPTS.The bioactive fragment of any LPTS albumen can be applied among the present invention.Here, the implication of the bioactive fragment of LPTS albumen refers to as a kind of protein fragments, the all or part of function of the LPTS albumen that it still can be kept perfectly (biological activity as at least 50%, preferable at least 70% activity, better at least 90% activity).The aminoacid sequence of the LPTS that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form is also included among the present invention.Replacement, disappearance or the interpolation of the one or more amino-acid residues of described process and the LPTS albumen that forms also has penetration cell and has the function that suppresses cell telomerase activation or expression after merging with TAT.The present invention also can adopt LPTS albumen modified or improvement, such as, can adopt in order to prolong its transformation period, to improve its stability and the LPTS albumen of improvement.

The inventor is surprised to find that in test, about 190-200 the amino acid whose albumen that contains C-terminal in the LPTS full length sequence is suitable for merging with TAT most, the fusion rotein of its formation is easy to be transferred in the Telomerase positive cells most, the Telomerase inhibition that performance is excellent.

As a kind of optimal way of the present invention, the aminoacid sequence of described LPTS can be substantially the same with the sequence shown in the SEQ ID NO:4.The aminoacid sequence of preferred LPTS can be substantially the same with sequence shown in the 16-211 position among the SEQ ID NO:2.

Fusion rotein

The invention provides a kind of fusion rotein, this albumen comprises TAT albumen and LPTS albumen or its bioactive fragment.Term " fusion rotein of trans-activator and telomerase activity inhibition protein ", " TAT-LPTS fusion rotein ", " T-LPTS " or " T-LPGENE " etc. are used interchangeably, all refer to merge the albumen that forms by TAT aminoacid sequence and LPTS aminoacid sequence, wherein between can have or not have the connection peptides sequence.

Described fusion rotein can be used for suppressing cell telomerase activation or expression.Preferred, described fusion rotein is a kind of albumen of separation, does not have with other albumen, polypeptide or molecule to contact, and is the purified product cultivated of recombinant host cell or as a kind of extract of purifying.

Can directly be connected between described TAT polypeptide and LPTS albumen or its active fragments, perhaps connect by polypeptide connexon (connection peptides).As a kind of preferred mode of the present invention, described TAT is connected by polypeptide connexon (connection peptides) with LPTS or its active fragments, thereby forms fusion rotein.Described connexon comprises 0-20 amino acid; Preferably being 0-15 amino acid, more preferably is 0-10 amino acid, and best is 1-4 amino acid, as 2-3.

As a kind of preferred mode, described TAT polypeptide is positioned at the aminoterminal (N end) of fusion rotein; Described LPTS albumen or its active fragments are positioned at the carboxyl terminal (C end) of fusion rotein.Selectively, also interchangeable two kinds of residing positions of albumen.

In addition, selectively, the aminoterminal of described fusion rotein (or carboxyl terminal) also can contain one or more polypeptide fragments, as the albumen label.Any suitable label may be used to the present invention.For example, described label can be FLAG, HA, HA1, c-Myc, 6-His etc.These labels can be used for fusion rotein is carried out purifying.Concrete example is that the C-terminal at fusion rotein is connected with the 6-His structure.Those skilled in the art should be understood that can but enzyme be set between albumen label aminoacid sequence and TAT-LPTS fusion rotein aminoacid sequence cuts structure, thereby label can be separated from fusion rotein.

Fusion rotein of the present invention can either suppress telomerase activation, can enter cell interior again, has so just solved the restriction in the LPTS application.For the research of LPTS endocellular function, former research is carried out at gene level, belongs to basic research, and it need introduce foreign gene in cellular genome, is difficult to carry out practical application.Play a role in the cell and the present invention proposes on the protein level LPTS is incorporated into, thereby make LPTS to be employed clinically.

On the other hand, the present invention also provides the nucleic acid of the separation of the described fusion rotein of encoding, and also can be its complementary strand.

The dna sequence dna of code book invention fusion rotein can the complete sequence synthetic, and also the method for available pcr amplification obtain respectively to encode TAT and the amino acid whose dna sequence dna of LPTS is stitched together it then, forms the dna sequence dna of code book invention fusion rotein.

After the dna sequence dna that has obtained code book invention fusion rotein, it is connected into suitable expression vector, change proper host cell again over to.By cultivating the host cell after transforming, obtain fusion rotein of the present invention by separation and purification at last.

Therefore, the present invention also provides the carrier of the nucleic acid molecule that comprises encoding said fusion protein.Described carrier also can comprise the expression regulation sequence that links to each other with the series of operations of described nucleic acid molecule, so that described Expression of Fusion Protein.

As used herein, " operability links to each other " or " operationally being connected in " refer to a kind of like this situation, and namely some part of linear DNA sequence can influence the activity of same linear DNA sequence other parts.For example, if the transcribing of promotor control sequence, it is exactly operationally to be connected in encoding sequence so.

In the present invention, any suitable carriers can be used, and is used for bacterium, fungi, yeast and the clone of mammalian cell and the carrier of expression such as some, as Pouwels etc., and cloning vector: described in the laboratory manual (Elsevier latest edition).Can select various carrier known in the art such as commercially available carrier for use.Such as, select commercially available carrier for use, the nucleotide sequence of then code book being invented new fusion rotein operationally is connected in expression regulation sequence, forms protein expression vector.In one embodiment of the invention, described carrier is prokaryotic vector, as the pET carrier.

In addition, the reconstitution cell that contains the nucleotide sequence of encoding said fusion protein is also included among the present invention.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.; For example can be Bacillus coli cells (E.coli), as intestinal bacteria HMS174 (DE3) or BL21 (DE3).Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.

In preferred implementation of the present invention, adopt prokaryotic cell prokaryocyte as host cell, behind expression, purifying, obtain to have kept good inhibition telomerase activation and the good fusion rotein of cytolemma penetrance.

The method of producing fusion rotein also comprises in the present invention.Described method comprises cultivates the reconstitution cell that contains the fusion rotein coding nucleic acid.Described fusion rotein comprises TAT polypeptide and LPTS albumen or its active fragments.Described method can comprise the fusion rotein that allows cell expressing encode, and the renaturation that makes the fusion rotein of expression.In an example, described method also can comprise separation and/or the purifying of the fusion rotein of renaturation.

Can be the character of basic homogeneous with the above-mentioned fusion rotein purifying for preparing, for example be single band at the SDS-PAGE electrophoresis.For example, when recombinant protein is secreting, expressing, can adopt commercial ultra-filtration membrane to separate described albumen, for example company's products such as Millipore, Amicon, Pellicon at first will be expressed supernatant and be concentrated.The method that concentrated solution can adopt gel chromatography is purifying in addition further, or adopts the method purifying of ion exchange chromatography.For example anion-exchange chromatography (DEAE etc.) or cation-exchange chromatography.Gel matrix can be the matrix that agarose, dextran, polymeric amide etc. are usually used in protein purification.The SP group is comparatively desirable ion-exchange group.At last, also available RPLC methods such as (RP-HPLC) is further made with extra care purifying to above-mentioned purified product.Above-mentioned all purification steps can utilize different combinations, finally make purity of protein reach basic homogeneous.

Can utilize the affinity column of the specific antibody, acceptor or the part that contain TAT or LPTS that the amalgamation albumen of expressing is carried out purifying.According to the characteristic of employed affinity column, can utilize conventional method, as the amalgamation polypeptide of method elution of bound on affinity column such as high-salt buffer, change pH.

Fusion rotein of the present invention can be used for preparing the composition that suppresses cell telomerase activation or expression, thereby is used for suppressing the growth of Telomerase positive cell, reduces its tumorigenicity.Fusion rotein of the present invention has the excellent ability that enters cell (as tumour cell), and enters the function that can suppress cell telomerase activation or expression behind the cell well.Thereby fusion rotein of the present invention has the extremely tumor effect more excellent than LPTS, thereby can be used for developing the effective antitumour medicine.

" tumour " of the present invention can be polytype, as long as tumour cell is the Telomerase positive, for example can include, but is not limited to: liver cancer BEL-7404 cell, liver cancer HepG2 cell, s etc.

Composition

The present invention also provides a kind of composition that suppresses cell telomerase activation or expression, and described composition contains: (i) significant quantity is (as 0.0001-50wt%; 0.001-20wt% more preferably) TAT of the present invention and the fusion rotein of LPTS; (ii) pharmaceutically acceptable carrier.

As used herein, the composition of " pharmaceutically acceptable " is applicable to people and/or Mammals and does not have excessive bad side reaction (as toxicity, stimulation and transformation reactions), namely has the material of rational benefit/risk ratio.Term " pharmaceutically acceptable carrier " refers to be used for the treatment of the carrier of agent administration, comprises various vehicle and thinner.This term refers to some medicament carriers like this: they itself are not necessary activeconstituents, and do not have undue toxicity after using.Suitable carriers is well known to those of ordinary skill in the art.(Mack Pub.Co. can find proving absolutely about pharmaceutically acceptable carrier in N.J.1991) at Remington ' s Pharmaceutical Sciences.Acceptable carrier can contain liquid on combination of traditional Chinese medicine is learned, as water, salt solution, glycerine and sorbyl alcohol.In addition, also may there be complementary material in these carriers, as lubricant, glidant, wetting agent or emulsifying agent, pH buffer substance and stablizer, as albumin etc.

Described composition can be made the various formulations that are suitable for the Mammals administration, described formulation includes but not limited to: injection, capsule, tablet, emulsion, suppository.

In use, be that fusion rotein of the present invention with safe and effective amount is applied to Mammals (as the people), wherein this safe and effective amount is usually at least about 0.1 microgram/kg body weight, and in most of the cases be no more than about 50 mg/kg body weight, preferably this dosage is about 1 microgram/kg body weight-Yue 10 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.

When being used for suppressing mammal tumor, but described fusion rotein general is used perhaps topical application, the decision of factors such as the kind of concrete visual tumour, growth site, progress degree.

Composition of the present invention can be directly used in killing tumor cell.In addition, also can unite use with other therapeutical agent or assistant agent simultaneously.

Major advantage of the present invention is:

(1) provide and prepare the fusion rotein of TAT and LPTS first, the fusion of verified LPTS and TAT does not influence the inhibition cell telomerase activation of LPTS when promoting the LPTS permeates cell membranes.

(2) fusion rotein of the present invention has significantly more excellent anti-tumor activity than single with LPTS, and all available for many tumours.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Embodiment 1. contains the structure of T-LPGENE (T-LPTS-C) fusion rotein of LPTS fragment and the preparation of recombination engineering bacteria

It is as follows to make up T-LPGENE engineering bacteria concrete grammar:

(1) makes up the pET24-TAT plasmid

The TAT template with and primer obtain by synthetic, concrete sequence is as follows:

Template:

5-AGTTT CATATGTACGGGCGCAAGAAACGCCGCCAGCGCCGCCGCGGTGGATCCTAGAAG-3(SEQ ID NO：5)；

P1 (upstream primer):

5-AGTTT CATATGTACGGGC-3(SEQ ID NO：6)；

P2 (downstream primer):

5-CGCCA CCTAGGATCTTC-3(SEQ ID NO：7)。

By the PCR reaction, obtain the dna sequence dna that contains coding TAT polypeptide (11 amino acid) that two ends have restriction enzyme site Nde I and BamH I; The PCR reaction conditions is: PCR is reflected in the 50 μ l systems and carries out, and comprises 1 μ l template, 1 μ l dNTP mix (10mM), each 1 μ l of upstream and downstream primer (20 μ M), 5 μ l10 * PYROBEST damping fluid, 0.5 μ l PYROBEST enzyme is added deionized water to 50 μ l.Reaction conditions is: 94 ℃ 3 minutes; Carry out 30 circulations afterwards altogether, every circulation comprise 94 ℃ 20 seconds, 50 ℃ 20 seconds, 72 ℃ 20 seconds; At last again 72 ℃ extended 4 ℃ of insulations 5 minutes.

With the PCR product that as above obtains, behind Nde I and BamHI double digestion, insert pET24 (a) (available from the Novagen company) plasmid through same double digestion, obtain the pET24-TAT plasmid.

(2) make up the pET24-T-LPGENE plasmid

Be template with the pT-LPTSCDS plasmid, this plasmid contain total length LPTS gene (referring to Hepatology, 32 (2000), 721-727), primer is as follows:

P1 (upstream primer):

5-AAA GGATCCAAGGATCTGTCATCTCGG-3’(SEQ ID NO：8)；

P2 (downstream primer):

5-AAA CTCGAGTTTGGAATCTTTCTTCTT-3(SEQ ID NO：9)。

By the PCR reaction, obtain the dna sequence dna that contains coding LPTS PROTEIN C end 196 amino acid (LPTS-C) that two ends have restriction enzyme site BamHI and XhoI, sequence is seen aminoacid sequence shown in the 16-211 position among the SEQ ID NO:2; The PCR reaction conditions is: PCR is reflected in the 50 μ l systems and carries out, and comprises 1 μ l template, 1 μ l dNTP mix (10mM), each 1 μ l of upstream and downstream primer (20 μ M), 5 μ l10 * PYROBEST damping fluid, 0.5 μ l PYROBEST enzyme is added deionized water to 50 μ l.Reaction conditions is: 94 ℃ 3 minutes, carry out 30 circulations afterwards altogether, every circulation comprise 94 ℃ 30 seconds, 56 ℃ 40 seconds, 72 ℃ 60 seconds; 72 ℃ were extended 4 ℃ of insulations 5 minutes again.

PCR product with the LPGENE gene that as above obtains, behind BamH I and Xho I double digestion, insert the pET24-TAT plasmid through BamH I and Xho I double digestion, obtain the pET24-T-LPGENE plasmid at last, the dna sequence dna that coding T-LPGENE is arranged on this plasmid, sequence is seen SEQID NO:1, and structural representation is seen Fig. 1.The structure of pET24-T-LPGENE expression plasmid is seen Fig. 2.After the sequence verification sequence is errorless, transform host bacterium E.coli BL-21, obtain to express the engineering bacteria of T-LPGENE.

The abduction delivering of embodiment 2.T-LPGENE and separation and purification

The inventor has adopted separation methods such as ion-exchange, has obtained highly purified T-LPGENE albumen, can simply be divided into following step:

(1) ordinary method abduction delivering T-LPGENE albumen;

(2) ultrasonic disruption thalline;

(3) cation-exchange chromatography (SP-Sepharose);

(4) ultrafiltration and concentration;

(5) sieve chromatography (Superdex 75);

Experiment is carried out under 4 ℃ of conditions.SDS-PAGE detects T-LPGENE purity and concentration, the results are shown in Figure 3 (swimming lanes 6), and the purity of T-LPGENE albumen can reach more than 90%.

The detection of embodiment 3.T-LPGENE vitro inhibition telomerase activation

T-LPGENE is a kind of very strong telomerase activation inhibitor.The inventor adopts the TPAP method to measure the biologic activity of the T-LPGENE of purifying.Telomerase is from SMMC-7721 liver cancer cell lysate, and concrete preparation method is as follows:

SMMC-7721 liver cancer cell (available from ATCC) is seeded in the 10ml culturing bottle, and substratum is 1640,37 ℃ of RPMI, 5%CO ₂Adherent culture under the condition, full bottle back collecting cell.Be about to substratum and blot, with cell of PBS rinsing, use trypsin digestion cell, PBS washes cell, sucks centrifuge tube, the 4000rpm centrifugal collecting cell.Use lavation buffer solution (10mM Hepes-KOH (pH7.5), 1.5mMMgCl again ₂, 10mM KCl, 1mM DTT (dithionthreitoll)) and wash cell one time, centrifugal.With precooling lysis buffer (10mM Tris-HCl (pH7.5), 1mM MgCl ₂, 1mM EGTA, 0.1mMPMSF, 5mM mercaptoethanol, 0.5%CHAPS, 10% glycerine) and 500 μ l re-suspended cells, put 30 minutes on ice, 4 ℃, centrifugal 30 minutes of 12,000rpm obtains supernatant and can be used to measure telomerase activation.Supernatant liquor can be kept at-70 ℃, moltenly still can keep stable telomerase activation through repeatedly freezing.

The TPAP method is determined in the 500 μ l Eppendorf pipes carries out, and reaction volume is 50 μ l, contains conventional reaction buffer 45.25 μ l, and 0.8 μ l contains the tumour cell lysate of Telomerase, 0.25 μ l dNTP, 1 μ l purifying protein (dilution as requested).After reacting 10min on ice, add 1 μ l Ts primer (0.1 μ g/ μ l, primer sequence is 5-AATCCGTCGAGCAGAGTT-3 (SEQ ID NO:10)), 1 μ l Taq enzyme, 25 ℃ are extended 30min, and 95 ℃ of deactivation 5min add Taq enzyme (0.5 μ l), Acx primer (1 μ l again, 0.1 μ g/ μ l, primer sequence are 5-(CCCTTA) ₃CCCTAA-3 (SEQ ID NO:11)), carry out PCR reaction (94 ℃ of 30s, 50 ℃ of 40s, 72 ℃ of 40s, 33 circulations; 72 ℃ of 2min).Adopt 10% polyacrylamide gel electrophoresis that the PCR reaction product is identified, the electrophoresis system is tbe buffer liquid, electrophoresis (120 volts, 2hr) after, silver dyes colour developing.

The TRAP experimental result shows, purifying gained T-LPGENE albumen of the present invention has a very high inhibition of telomerase external, and when being about 320nmol/L, T-LPGENE just can suppress the activity of Telomerase fully, referring to Fig. 4.

Embodiment 4.TAT mediation LPGENE albumen is striden film and is entered the interior activity detection of tumour cell

At first, the inventor has adopted conventional liposome transfection method that LPTS-C albumen is carried in each tumour cell.Test-results shows, does not detect LPTS-C albumen basically and enter cell.Therefore, liposome method is not suitable for transporting LPTS-C albumen.

In order to verify whether TAT can mediate LPGENE albumen and enter in the cell, and the inventor has selected two kinds of experimental techniques for use: immunofluorescence experiment and Western-blot experiment.The immunofluorescence experiment concrete operation method is as follows:

(1) BEL-7404 cell (available from the biochemical cell in Shanghai institute cell bank) and Saos-2 cell (the biochemical cell in Shanghai institute cell bank) are seeded in six orifice plates that are covered with cover glass, substratum is respectively DMEM (containing 10% newborn calf serum) and Mccoy ' s 5A (containing 15% foetal calf serum), 37 ℃, 5%CO ₂Adherent culture under the condition.Behind the cell attachment, add T-LPGENE (100mg/L) albumen (3 skies are hatched 2hr respectively, 6hr and 24hr) of PBS solution (two skies) and purifying respectively:

(2) hatch after, with PBS washing once, every hole adds the methyl alcohol of 1mL-20 ℃ of precooling, fixedly 3min; Discard methyl alcohol, with PBS washing twice, follow every hole and add 1mL PBS (containing 1% newborn lowlenthal serum) again, sealing 10min;

(3) closed container is put in the slide taking-up that fixes, drip the primary antibodie (the tame rabbit anti-serum of LPGENE protein immunization) of suitably diluting with PBS (containing 1% newborn lowlenthal serum), room temperature reaction 2hr, one of them is cultivated the slide of handling with PBS and only drips PBS (containing 1% newborn lowlenthal serum), as blank;

(4) with PBS (containing 1% newborn lowlenthal serum) washing 3 times, each 5min;

(5) drip two anti-(the anti-rabbit anteserums of FITC labelled goat) that suitably dilute with PBS (containing 1% newborn lowlenthal serum), room temperature lucifuge reaction 1hr; With PBS (containing 1% newborn lowlenthal serum) washing 3 times, each 5min;

(6) slide is put back to 6 orifice plates, and every hole adds 33258 reagent of 1mL PBS (containing 1% newborn lowlenthal serum) and 10 μ L, dyes nuclear 10min;

(7) with PBS washing 3 times, each 5min;

(8) get a clean glass slide, Dropwise 50 μ L cat oil has one of cell to face down the cover glass of handling well and places on the slide glass, does not have bubble between cover glass and cat oil, room temperature lucifuge 4hr or spend the night.

Western-blot experiment concrete operation method is as follows:

(1) substratum in the 6cm culture dish is respectively DMEM (containing 10% newborn calf serum) and Mccoy ' s 5A (containing 15% foetal calf serum), 37 ℃, 5%CO with BEL-7404 cell and Saos-2 cell inoculation ₂Adherent culture under the condition.After cell density surpasses 30%, T-LPGENE (100mg/L) albumen (3 holes that add LPGENE (100mg/L) albumen (2hr is hatched in 3 holes respectively, 6hr and 24hr) and the purifying of PBS solution (two skies), purifying respectively, hatch 2hr respectively, 6hr and 24hr):

(2) after the PBS washed twice, use trysinization 10min;

(3) centrifugal collecting cell is by per 10 ⁶Cell adds 100 μ L SDS-PAGE electrophoresis sample-loading buffers;

(4) detect each sample with Western Blotting method, be that sample is behind the SDS-PAGE electrophoresis, electroporation with Bio-Rad company goes to albumen on the nitrocellulose filter, hybridizes with special anti-LPGENE antibody (the tame rabbit anti-serum of LPGENE protein immunization).Two anti-be the goat anti-rabbit igg of horseradish peroxidase (HRP) mark.

Immunofluorescence experiment and western-blot experimental result are seen Fig. 5, and the result shows that TAT can mediate LPGENE albumen extremely well and enter in BEL-7404 cell and the Saos-2 cell, and can enter in the nucleus.

T-LPGENE albumen behind embodiment 5. purifying has the activity of vitro inhibition Telomerase positive cell growth

Mtt assay is analyzed

(1) with BEL-7404 cell and Saos-2 cell inoculation in being covered with 6 orifice plates of cover glass, substratum is respectively DMEM (containing 10% newborn calf serum) and Mccoy ' s 5A (containing 15% foetal calf serum), 37 ℃, 5%CO ₂Adherent culture under the condition; HepG2 cell (available from the biochemical cell in Shanghai institute cell bank) and L02 cell (available from the biochemical cell in Shanghai institute cell bank) also are seeded in 6 orifice plates that are covered with cover glass, and used substratum is respectively DMEM+10%FBS (foetal calf serum) and RPMI1640+10%NBS (newborn calf serum).Add in 6 orifice plates respectively the T-LPGENE (40mg/L) of PBS solution and aforementioned purifying and TAT-GFP (40mg/L) (T-GFP) (employing GFP full length sequence, the GFP protein sequence is referring to GenBank accession number: DQ768212; The C end of TAT is connected with the N end of GFP) albumen;

(2) cultured continuously detects the growth activity of respectively organizing cell with mtt assay after 6 weeks, and concrete experimental technique is referring to document (Si Tuzhenqiang, Wu Junzheng chief editor; Cell cultures [M]; Xi'an: world book is published Xi'an company, 2004,250).During detection, each is organized cell and continues the interpolation corresponding protein, and the detection wavelength is 570nm.

Experimental result is seen Fig. 6, and the result shows that T-LPGENE albumen can suppress the growth of Telomerase positive cell BEL-7404 and HepG2, and the growth that reduces Telomerase negative cells Saos-2 and immortalized cells L02 is not had obvious restraining effect.

Southern-blot analyzes

Collect the cell of cultured continuously after 8 weeks, with Southern-blot methods analyst telomere length, concrete experimental technique is referring to document (Damm K.et al., A highly selective telomerase inhibitor limitinghuman cancer cell proliferation; EMBO J 2001; 20:6958-6968).Simple process is: isolation of genomic DNA, with restriction endonuclease HinfI and Afa I double digestion, use 0.8% sepharose separating digesting product then, and behind the commentaries on classics film, analyze hybridization signal with ImageQuant at last with the probe hybridization that indicates γ-32P.

Experimental result is seen Fig. 7 A, the result shows, after T-LPGENE albumen handled for 8 weeks, compares with control group (PBS handles with TAT-GFP), the telomere of Telomerase positive tumor cell BEL-7404 and HepG2 obviously shortens, and the weak point of the concentration group of the telomere of high density protein groups ratio.And the negative tumour cell Saos-2 of Telomerase telomere does not significantly shorten.

Cellular form detects

The cell cultured continuously was taken pictures with inverted microscope after 6 weeks, the results are shown in Figure 7B; the result shows; through the Telomerase positive tumor cell BEL-7404 of T-LPGENE albumen processing and the adherent ability variation of HepG2, it is flat and big that cell becomes, and this is typical crisis (crisis) form.

People's normal somatic cell per minute splits once, and telomere is just lost 50-200bp, and the cell growth is suppressed when telomere shortens to a certain degree, namely is called cell aging, and deathward.Yet, in most malignant cells (85%), telomerase activation can be detected and activity is stronger, Telomerase to the superimposing compensation again of telomere its continuing in the cell proliferation process lose, thereby make cell constantly to divide, this is an important mechanisms of cell immortalityization and canceration.T-LPGENE albumen can suppress telomerase activation in the cell, and the telomere of Telomerase positive tumor cell is shortened gradually along with cell proliferation, enters climacteric (aging), is the crisis form in form.And the negative tumour cell Saos-2 of Telomerase and immortalized cells L02 are not having considerable change in form.

Flow cytometer detects dna content

The cell cultured continuously is after 6 weeks, sampling carry out flow cytometry analysis (FACSCalibur, BectonDickinson, USA).Cell dyes with Propidium Iodide (PI), different signal representation DNA sizes.Normal cell DNA is diploid, and G2/M phase cell DNA is tetraploid, and dead or the cell of being at death's door DNA rupture, the streaming signal is less than diplontic zone (sub-G1 district).

Experimental result is seen Fig. 7 C, and the result shows that after T-LPGENE albumen handled for 6 weeks continuously, the sub-G1 district content of Telomerase positive tumor cell BEL-7404 and HepG2 significantly increased, and namely dead the or quantity of being at death's door of cell significantly increases; And the sub-G1 district of the negative tumour cell Saos-2 of Telomerase and immortalized cells L02 does not have considerable change.

The antitumor activity of embodiment 6.T-LPGENE albumen and the research of reduction Telomerase positive cell tumorigenicity

1. the T-LPGENE albumen behind the purifying can reduce Telomerase positive cell tumorigenicity

(1) with BEL-7404 cell and Saos-2 cell inoculation in being covered with six orifice plates of cover glass, substratum is respectively DMEM (containing 10% newborn calf serum) and Mccoy ' s 5A (containing 15% foetal calf serum), 37 ℃, 5%CO ₂Adherent culture under the condition.The T-LPGENE (final concentration in substratum is 40mg/L) and TAT-GFP (40mg/L) albumen that add PBS solution and described purifying respectively:

(2) cultured continuously is after 6 weeks, and collecting cell is by 8 * 10 ⁶It is subcutaneous to be inoculated into nude mice;

(3) after the inoculation, observe the tumor growth situation weekly, and measure the tumour size;

(4) after 6 weeks of inoculation, take pictures, take out tumour and weigh.

Experimental result is seen Fig. 8 A, table 1, and the result shows that T-LPGENE albumen can reduce the tumorigenicity of Telomerase positive cell BEL-7404, and the tumorigenicity that reduces Telomerase negative cells Saos-2 is not had restraining effect.And the fusion rotein TAT-GFP albumen of TAT and green fluorescent protein does not have influence substantially to the tumorigenicity of Telomerase positive cell BEL-7404.

Table 1

2. the antitumor activity of the T-LPGENE albumen behind the purifying

Liver cancer cell BEL-7404 inoculation (5 * 10 ⁶/ only) subcutaneous to nude mice (4 ages in week, female) right side waist, after 4 weeks, take out tumour, be cut into 2mm ³Size, it is subcutaneous to inoculate nude mice (4 week ages, female) right side waist, and nude mice is divided into 4 groups at random.Every other day, beginning subcutaneous injection T-LPGENE albumen (100 μ g/ only, 400 μ g/ only, experimental group), the position near tumour, control group injection PBS and TAT-GFP albumen (400 μ g/ are only).2 per 2 days of weeks of beginning inject once, and 3 per 3 days of weeks injection is subsequently once injected 14 times altogether.Record tumour size (using vernier caliper measurement) weekly, inoculation takes pictures for all nude mices after 7 weeks, puts to death nude mice, takes out tumour and weighs.

Experimental result is seen Fig. 8 B-D, and the result shows, T-LPGENE albumen can suppress the growth of BEL-7404 tumour cell in the nude mouse, and this have certain dosage effect.The tumor weight of every injection 100 μ gT-LPGENE protein groups has only 57% (P＜0.05) of PBS group, and the tumor weight of 400 μ g T-LPGENE protein groups has only 36% (P＜0.01) of PBS group.And the tumor weight of TAT-GFP group and PBS group do not have significant difference, but obviously overweight (P＜0.05) of two experimental group.The tumor weight of high dosage experimental group also is significantly less than low dosage experimental group (P＜0.05).

Embodiment 7. contains preparation and the test cell line of the fusion rotein of total length LPTS

Similar method according to record among the embodiment 1 prepares expression TAT-total length LPTS (TAT-LPTS), at first makes up the pET24-TAT plasmid.Be template with the pT-LPTSCDS plasmid, pcr amplification obtains the full-length gene order (seeing SEQ ID NO:3) of LPTS, restriction enzyme site BamH I and Xho I are set at two ends, with the pET24-TAT plasmid that inserts behind these two kinds of enzyme double digestions through same double digestion, obtain the pET24-T-LPTS plasmid, the dna sequence dna of coding TAT-LPTS is arranged on this plasmid.After the sequence verification sequence is errorless, transform host bacterium E.coli BL-21, obtain the engineering bacteria of expressing.

Adopt embodiment 2 described method abduction delivering and separation and purification as described above, obtain purity 80% above TAT-LPTS albumen.

In vitro tests (as embodiment 3) finds that ability and the T-LPGENE of TAT-LPTS inhibition telomerase activation are basic identical.

Adopt as described above embodiment 4 described methods to carry out immunofluorescence experiment and western-blot experiment, detect the situation that TAT-LPTS enters cell.The result shows that TAT-LPTS can enter in BEL-7404 cell and the Saos-2 cell, and can enter in the nucleus.Sxemiquantitative test finds, with the situation contrast that T-LPGENE albumen enters cell, it is the about about 70% of the T-LPGENE albumen amount that enters cell that TAT-LPTS enters nuclear amount, visible T-LPGENE albumen to change effect over to even more ideal.

Embodiment 8. pharmaceutical compositions

The fusion rotein 100mg that purifying among the embodiment 3 is obtained is formulated in the conventional physiological saline of 100ml, and obtaining concentration is the composition that contains fusion rotein of 1mg/ml.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉fusion rotein, its preparation and the application of inhibition telomerase activation

<130>083394

<160>11

<170>PatentIn version 3.3

<210>1

<211>633

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉fusion gene

<400>1

atgtacgggc gcaagaaacg ccgccagcgc cgccgcggtg gatccaagga tctgtcatct 60

cggagcaaaa cagatcttga ctgcattttt gggaaaagac agagtaagaa gactcccgag 120

ggcgatgcca gtccctccac tccagaggag aacgaaacca cgacaaccag cgccttcacc 180

atccaggagt actttgccaa gcggatggca gctctgaaga acaagcccca ggttccagtt 240

ccagggtctg acatttctga gacgcaggtg gaacgtaaaa gggggaagaa aagaaataaa 300

gaggccacag gtaaagatgt ggaaagttac ctccagccta aggccaagag gcacacggag 360

ggaaagcccg agagggccga ggcccaggag cgagtggcca agaagaagag cgcgccagca 420

gaagagcagc tcagaggccc ctgctgggac cagagttcca aggcctctgc tcaggatgca 480

ggggaccatg tgcagccgcc tgagggccgg gacttcaccc tgaagcccaa aaagaggaga 540

gggaagaaaa agctgcaaaa accagtagag atagcagagg acgctacact agaagaaacg 600

ctagtgaaaa agaagaagaa gaaagattcc aaa 633

<210>2

<211>211

<212>PRT

＜213〉artificial sequence

<220>

<221>MISC_FEATURE

＜223〉fusion rotein

<400>2

Met Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Gly Ser Lys

1 5 10 15

Asp Leu Ser Ser Arg Ser Lys Thr Asp Leu Asp Cys Ile Phe Gly Lys

20 25 30

Arg Gln Ser Lys Lys Thr Pro Glu Gly Asp Ala Ser Pro Ser Thr Pro

35 40 45

Glu Glu Asn Glu Thr Thr Thr Thr Ser Ala Phe Thr Ile Gln Glu Tyr

50 55 60

Phe Ala Lys Arg Met Ala Ala Leu Lys Asn Lys Pro Gln Val Pro Val

65 70 75 80

Pro Gly Ser Asp Ile Ser Glu Thr Gln Val Glu Arg Lys Arg Gly Lys

85 90 95

Lys Arg Asn Lys Glu Ala Thr Gly Lys Asp Val Glu Ser Tyr Leu Gln

100 105 110

Pro Lys Ala Lys Arg His Thr Glu Gly Lys Pro Glu Arg Ala Glu Ala

115 120 125

Gln Glu Arg Val Ala Lys Lys Lys Ser Ala Pro Ala Glu Glu Gln Leu

130 135 140

Arg Gly Pro Cys Trp Asp Gln Ser Ser Lys Ala Ser Ala Gln Asp Ala

145 150 155 160

Gly Asp His Val Gln Pro Pro Glu Gly Arg Asp Phe Thr Leu Lys Pro

165 170 175

Lys Lys Arg Arg Gly Lys Lys Lys Leu Gln Lys Pro Val Glu Ile Ala

180 185 190

Glu Asp Ala Thr Leu Glu Glu Thr Leu Val Lys Lys Lys Lys Lys Lys

195 200 205

Asp Ser Lys

210

<210>3

<211>984

<212>DNA

＜213〉homo sapiens (Homo Sapiens)

<400>3

atgtctatgc tggctgaacg tcggcggaag cagaagtggg ctgtggatcc tcagaacact 60

gcctggagta atgacgattc caagtttggc cagcggatgc tagagaagat ggggtggtct 120

aaaggaaagg gtttaggggc tcaggagcaa ggagccacag atcatattaa agttcaagtg 180

aaaaataacc acctgggact cggagctacc atcaataatg aagacaactg gattgcccat 240

caggatgatt ttaaccagct tctggccgaa ctgaacactt gccatgggca ggaaaccaca 300

gattcctcgg acaagaagga aaagaaatct tttagccttg aggaaaagtc caaaatctcc 360

aaaaaccgtg ttcactatat gaaattcaca aaagggaagg atctgtcatc tcggagcaaa 420

acagatcttg actgcatttt tgggaaaaga cagagtaaga agactcccga gggcgatgcc 480

agtccctcca ctccagagga gaacgaaacc acgacaacca gcgccttcac catccaggag 540

tactttgcca agcggatggc agctctgaag aacaagcccc aggttccagt tccagggtct 600

gacatttctg agacgcaggt ggaacgtaaa agggggaaga aaagaaataa agaggccaca 660

ggtaaagatg tggaaagtta cctccagcct aaggccaaga ggcacacgga gggaaagccc 720

gagagggccg aggcccagga gcgagtggcc aagaagaaga gcgcgccagc agaagagcag 780

ctcagaggcc cctgctggga ccagagttcc aaggcctctg ctcaggatgc aggggaccat 840

gtgcagccgc ctgagggccg ggacttcacc ctgaagccca aaaagaggag agggaagaaa 900

aagctgcaaa aaccagtaga gatagcagag gacgctacac tagaagaaac gctagtgaaa 960

aagaagaaga agaaagattc caaa 984

<210>4

<211>328

<212>PRT

＜213〉homo sapiens (Homo Sapiens)

<400>4

Met Ser Met Leu Ala Glu Arg Arg Arg Lys Gln Lys Trp Ala Val Asp

1 5 10 15

Pro Gln Asn Thr Ala Trp Ser Asn Asp Asp Ser Lys Phe Gly Gln Arg

20 25 30

Met Leu Glu Lys Met Gly Trp Ser Lys Gly Lys Gly Leu Gly Ala Gln

35 40 45

Glu Gln Gly Ala Thr Asp His Ile Lys Val Gln Val Lys Asn Asn His

50 55 60

Leu Gly Leu Gly Ala Thr Ile Asn Asn Glu Asp Asn Trp Ile Ala His

65 70 75 80

Gln Asp Asp Phe Asn Gln Leu Leu Ala Glu Leu Asn Thr Cys His Gly

85 90 95

Gln Glu Thr Thr Asp Ser Ser Asp Lys Lys Glu Lys Lys Ser Phe Ser

100 105 110

Leu Glu Glu Lys Ser Lys Ile Ser Lys Asn Arg Val His Tyr Met Lys

115 120 125

Phe Thr Lys Gly Lys Asp Leu Ser Ser Arg Ser Lys Thr Asp Leu Asp

130 135 140

Cys Ile Phe Gly Lys Arg Gln Ser Lys Lys Thr Pro Glu Gly Asp Ala

145 150 155 160

Ser Pro Ser Thr Pro Glu Glu Asn Glu Thr Thr Thr Thr Ser Ala Phe

165 170 175

Thr Ile Gln Glu Tyr Phe Ala Lys Arg Met Ala Ala Leu Lys Asn Lys

180 185 190

Pro Gln Val Pro Val Pro Gly Ser Asp Ile Ser Glu Thr Gln Val Glu

195 200 205

Arg Lys Arg Gly Lys Lys Arg Asn Lys Glu Ala Thr Gly Lys Asp Val

210 215 220

Glu Ser Tyr Leu Gln Pro Lys Ala Lys Arg His Thr Glu Gly Lys Pro

225 230 235 240

Glu Arg Ala Glu Ala Gln Glu Arg Val Ala Lys Lys Lys Ser Ala Pro

245 250 255

Ala Glu Glu Gln Leu Arg Gly Pro Cys Trp Asp Gln Ser Ser Lys Ala

260 265 270

Ser Ala Gln Asp Ala Gly Asp His Val Gln Pro Pro Glu Gly Arg Asp

275 280 285

Phe Thr Leu Lys Pro Lys Lys Arg Arg Gly Lys Lys Lys Leu Gln Lys

290 295 300

Pro Val Glu Ile Ala Glu Asp Ala Thr Leu Glu Glu Thr Leu Val Lys

305 310 315 320

Lys Lys Lys Lys Lys Asp Ser Lys

325

<210>5

<211>59

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>5

agtttcatat gtacgggcgc aagaaacgcc gccagcgccg ccgcggtgga tcctagaag 59

<210>6

<211>18

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>6

agtttcatat gtacgggc 18

<210>7

<211>17

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>7

cgccacctag gatcttc 17

<210>8

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>8

aaaggatcca aggatctgtc atctcgg 27

<210>9

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>9

aaactcgagt ttggaatctt tcttctt 27

<210>10

<211>18

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>10

aatccgtcga gcagagtt 18

<210>11

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>11

cccttaccct tacccttacc ctaa 24

Claims (13)

1. an isolated fusion protein is characterized in that, described fusion rotein comprises:

(1) telomerase activity inhibition protein LPTS;

(2) trans-activator TAT; With

(3) be positioned at the connection peptides that is constituted by 0-20 amino acid between (1) and (2);

Wherein, described telomerase activity inhibition protein LPTS is:

(a) albumen of the aminoacid sequence shown in the SEQ ID NO:4; Or

(b) albumen of aminoacid sequence shown in the 16-211 position among the SEQ ID NO:2;

Described trans-activator TAT has the albumen of aminoacid sequence shown in the 2-12 position among the SEQ ID NO:2;

Described trans-activator TAT is positioned at the aminoterminal of fusion rotein; Described telomerase activity inhibition protein LPTS is positioned at the carboxyl terminal of fusion rotein.

2. fusion rotein as claimed in claim 1 is characterized in that, described connection peptides is the connection peptides that 0-10 amino acid constitutes.

3. fusion rotein as claimed in claim 2 is characterized in that, described connection peptides is the connection peptides that 1-4 amino acid constitutes.

4. fusion rotein as claimed in claim 1 is characterized in that, aminoacid sequence is shown in SEQ ID NO:2.

5. a nucleic acid molecule is characterized in that, the arbitrary described fusion rotein of described nucleic acid molecule encoding claim 1-4.

6. a carrier is characterized in that, it contains the described nucleic acid molecule of claim 5.

7. a genetically engineered cell is characterized in that,

Described cell contains the described carrier of claim 6; Or

Be integrated with the described nucleic acid molecule of claim 5 in the described cellular genome.

8. a method that produces the described fusion rotein of claim 1 is characterized in that, described method comprises: being fit to express under the condition of described fusion rotein, cultivate the described cell of claim 7, express and isolate described fusion rotein.

9. the purposes of the arbitrary described fusion rotein of claim 1-4 is characterized in that, for the preparation of the composition that suppresses the growth of Telomerase positive cell.

10. purposes as claimed in claim 9 is characterized in that, described cell is the tumour cell of the Telomerase positive.

11. purposes as claimed in claim 9 is characterized in that, described Telomerase positive cell comprises: liver cancer BEL-7404 cell, liver cancer HepG2 cell.

12. a composition that suppresses tumour is characterized in that, described composition contains:

(i) the arbitrary described fusion rotein of the claim 1-4 of significant quantity; With

(ii) pharmaceutically acceptable carrier.

13. the method with telomerase activity inhibition protein LPTS transfered cell is characterized in that, said method comprising the steps of:

(a) trans-activator TAT and telomerase activity inhibition protein LPTS are merged, obtain fusion rotein;

(b) fusion rotein and the cell of (a) are hatched altogether, thereby telomerase activity inhibition protein LPTS is imported in the cell;

Wherein, described telomerase activity inhibition protein LPTS is:

(a) albumen of the aminoacid sequence shown in the SEQ ID NO:4; Or

(b) albumen of aminoacid sequence shown in the 16-211 position among the SEQ ID NO:2;

Described trans-activator TAT has the albumen of aminoacid sequence shown in the 2-12 position among the SEQ ID NO:2;

Described trans-activator TAT is positioned at the aminoterminal of fusion rotein; Described telomerase activity inhibition protein LPTS is positioned at the carboxyl terminal of fusion rotein.

Images