CN109200271B

CN109200271B - Protein and application thereof in regulating and controlling macrophage immune function

Info

Publication number: CN109200271B
Application number: CN201811350901.8A
Authority: CN
Inventors: 程洋; 付海田; 石晓丹; 玄英花; 张馨心; 雷瑶
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2018-11-14
Filing date: 2018-11-14
Publication date: 2021-01-29
Anticipated expiration: 2038-11-14
Also published as: CN109200271A

Abstract

The invention discloses a protein and application thereof in regulating and controlling the immune function of macrophages, belonging to the technical field of biology. The amino acid sequence of the protein is shown in SEQ ID NO. 1. The invention screens and verifies the application of the PvTrag17 protein in regulating macrophage immunity for the first time, and the PvTrag17 protein acts on the unactivated RAW264.7 macrophage, so that the capability of the RAW264.7 macrophage in secreting NO, IL-2, IL-6 and TNF-alpha can be obviously enhanced, the mRNA levels of IL-6, TNF alpha, IL-2 and iNOS are respectively up-regulated by 6.9-11.89 times, and the application prospect is wide.

Description

Protein and application thereof in regulating and controlling macrophage immune function

Technical Field

The invention relates to a protein and application thereof in regulating and controlling the immune function of macrophages, belonging to the technical field of biology.

Background

Immunity is a physiological function of the human body, and the human body recognizes "self" and "non-self" components by virtue of the function, thereby destroying and rejecting antigen substances (such as germs and the like) entering the human body, or damaged cells and tumor cells generated by the human body per se, and the like, so as to maintain the health of the human body. To combat or prevent infection by microorganisms or parasites or other undesirable states of biological invasion. Thus, immunity is defined as the physiological response of the human body to recognize and eliminate the foreign component, and it is the immune system that performs this function in the body. In contemporary society, with the progress and development of society, the living pressure is further increased, and a large part of people are under high-amplitude pressure, which can lead to the reduction of the immune function of the organism, namely the reduction of the immunity for a long time. In this unhealthy state, the immune system cannot normally protect, and is very susceptible to infection by bacteria, viruses, fungi, etc. and diseases; the consumption of the body is increased, and the manifestations of physical weakness, malnutrition, listlessness, fatigue, weakness, appetite reduction, sleep disorder and the like are caused, so that the physical and intelligence development is poor in the past, and serious diseases are also easily induced. Therefore, enhancing the immune function of the body is a current situation which must be considered important in the present society.

Macrophages belong to immune cells, are a very heterogeneous cell population, are widely distributed in tissues and organs of a body, play an important role in inflammatory reaction, pathogen defense and damage repair, and can serve as antigen presenting cells to present antigens to activate immune response. Macrophages exist in a series of sequential functional states, whereas macrophages of the M1 and M2 types are at the two extremes of this already sequential state. Wherein M1 type macrophage participates in positive immune response by secreting proinflammatory cytokine and presenting antigen in a full-time manner, for example, M1 type macrophage can secrete proinflammatory factors such as NO, TNF alpha, IL-6 and IL-12 and participates in the clearance of pathogenic microorganism; on the other hand, M2 type has an important role in immune regulation by down-regulating immune response through secretion of inhibitory cytokines such as IL-10 and/or TGF-B, and for example, it secretes a large amount of anti-inflammatory factors such as IL-10 and TGF- β and participates in inflammation resolution, tissue remodeling, and angiogenesis. Therefore, the research and the control of the directional polarization target of the macrophage have very important significance in clinical treatment.

Malaria is the earliest disease in humans, and is still one of the most important infectious diseases worldwide to date. Most of the current researches on malaria focus on the invasion mechanism of plasmodium of different species and the research and development of malaria vaccines, and the research on the medicinal value or potential clinical application value of the plasmodium is less. Plasmodium invades into the body after being bound with a receptor on the surface of a liver cell or an erythrocyte mainly through proteins carried on the surface or inside of the body. The subject group analyzes and screens plasmodium vivax proteins to find that PvTrag28 is an output protein, and at present, the action of PvTrag17 on macrophages is not researched.

Disclosure of Invention

The first purpose of the invention is to provide the application of the recombinant PvTrag17 protein in preparing products for regulating macrophages.

In one embodiment of the invention, the use comprises the manufacture of a medicament for modulating macrophages.

In one embodiment of the invention, the use comprises promoting polarization of non-activated macrophages to M1 type.

In one embodiment of the invention, the drug includes, but is not limited to, an immunomodulator.

In one embodiment of the invention, the macrophage is an unactivated macrophage, including but not limited to RAW264.7 cells.

The second object of the present invention is to provide a method for preparing PvTrag17 recombinant protein by expressing PvTrag17 protein derived from Plasmodium in vitro.

In one embodiment of the invention, the method comprises the steps of:

(1) designing a primer, amplifying a gene encoding the PvTrag17 protein, and connecting the gene fragment to a vector to obtain a recombinant plasmid;

(2) and (3) transforming the recombinant plasmid into a corresponding expression cell to induce the expression of the target protein.

In an embodiment of the present invention, the method specifically includes the following steps:

(1) designing primers, amplifying a gene segment for coding the PvTrag17 protein by using the primers shown as SEQ ID NO.3 and SEQ ID NO. 4, connecting the amplified gene segment to a vector, transforming the obtained recombinant plasmid into a cloned cell, extracting the recombinant plasmid and sequencing;

(2) and (3) transforming the recombinant plasmid which is sequenced correctly and contains the target gene into a corresponding expression cell, and inducing the expression of the target protein by IPTG.

In one embodiment of the present invention, the expression vector may be a prokaryotic cell expression vector, a eukaryotic cell expression vector, or an insect cell expression vector.

In one embodiment of the present invention, the expression cell may be a prokaryotic expression cell, a eukaryotic expression cell or an insect cell.

In one embodiment of the invention, the expression vector is pET28a (+), and the expression cell is e.coli BL21(DE 3).

The third purpose of the invention is to provide an anti-tumor drug, which contains the PvTrag17 protein shown in SEQ ID NO.1 and a pharmaceutically acceptable carrier.

The invention also claims the application of the PvTrag17 protein in preparing products for non-medical use.

Has the advantages that: the invention firstly screens and verifies the application of the PvTrag17 protein in regulating macrophage immunity, and Western Blot results show that the PvTrag17 protein can obviously promote the polarization of unactivated RAW264.7 macrophages to M1 type macrophages. The PvTrag17 protein acts on the unactivated RAW264.7 macrophage, can obviously enhance the capability of the RAW264.7 macrophage to secrete NO, IL-2, IL-6 and TNF-alpha, and respectively up-regulate the mRNA levels of IL-6, TNF alpha, IL-2 and iNOS by 6.9 times, 7.32 times, 11.89 times and 11.32 times.

Drawings

FIG. 1 is a schematic representation of Coomassie brilliant blue staining of the PvTrag17 protein (A) and a Western blotting assay (B),

FIG. 2 is a Western blotting method for detecting the influence of PvTrag17 on the polarization of RAW264.7 cells;

FIG. 3 is an Elisa method for detecting the effect of PvTrag17 on the secretion of IL-2, IL-6 and TNF-alpha by RAW264.7 cells;

FIG. 4 shows that Griess method detects the effect of PvTrag17 on NO secretion from RAW264.7 cells;

FIG. 5 shows the effect of the RT-PCR method on the expression level of iNOs, IL-2, IL-6 and TNF-alpha genes in RAW264.7 cells

Detailed Description

Example 1 construction of PvTrag17 recombinant plasmid

Prokaryotic expression plasmid pET28a (+), host bacterium BL21(DE3) and IPTG for induction are all purchased from Beijing holotype gold Biotechnology GmbH; restriction enzymes, T4 DNA ligase, pfu DNA polymerase and dNTPs were purchased from Takara. Primer synthesis and nucleotide sequence sequencing were performed by Soujin Weizhi Biotechnology, Inc. Agarose affinity media nickel columns (Ni) were purchased from QIAGEN corporation. His-Taq tag antibody was purchased from Cell Signaling Technology.

Designing primers to obtain a gene sequence of Plasmodium vivax PvTrag17 protein through PCR, wherein the primers are as follows:

SEQ ID NO.2：GGATCCATGGAACTAAAAGCCAATATG；

SEQ ID NO.3：CTCGAGTGAGTCATTATCTGTGCTCAC，

wherein GGATCC is a restriction enzyme cutting site BamH I of SEQ ID NO. 2; CTCGAG is the restriction site Xho I of SEQ ID NO. 3.

Obtaining a plasmodium vivax PvTrag17 gene sequence by PCR amplification by using a plasmodium vivax genome as a template, wherein the amplification program comprises the following steps: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 10s, annealing at 50 deg.C for 30s, and extension at 72 deg.C for 90s, circulating for 35 times, and finally extension at 72 deg.C for 10 min.

And carrying out agarose gel electrophoresis on the PCR product to detect a target gene amplification band, carrying out gel recovery, carrying out restriction enzyme digestion on the PCR product and pET28a (+) at 37 ℃ for 2h by using BamH I and Xho I restriction enzymes, and connecting the target gene to a prokaryotic expression vector pET28a (+) overnight by using T4 ligase.

Coli DH5 α cells were removed from-80 ℃. Immediately placing on ice, taking 4 μ L of the connected product, adding into 50 μ L of competent cells, mixing well, ice-cooling for 30min, heat-shocking for 90 at 42 ℃, taking out, and placing in ice-cooling for 2 min. To the tube, 1ml of nonresistant LB medium was added, and the tube was shake-cultured at 250rpm in a shaker at 37 ℃ for 1 hour. After centrifugation, 100. mu.l of the medium was used to resuspend the cells, spread on LB plates containing kanamycin (50. mu.g/ml), placed in an incubator at 37 ℃ for overnight inverted culture, and then the growth of colonies was observed. The single clone was picked, and the plasmid was extracted and sequenced. The sequencing result shows that the target gene sequence is correct.

EXAMPLE 2 expression of the recombinant protein PvTrag17

Inoculating the positive monoclonal with correct sequencing into 5ml LB culture medium containing kanamycin, culturing at 37 ℃ overnight, inoculating the bacterial liquid into 500ml fresh LB culture medium containing kanamycin, adding 1mmol/L IPTG when OD600 is 0.6-0.8, and inducing for 8 h. The induced PvTrag17 was subjected to ultrasonication and resolved by 10% SDS-PAGE, indicating that the PvTrag17 protein was mainly localized in inclusion bodies and the molecular weight was as expected.

The inclusion bodies were solubilized by 8M urea to release PvTrag17 protein with a His-tag at the carbon end, which was purified by Ni2+ affinity chromatography using a His-tag nickel column from GE according to the kit instructions. Proteins were purified with different concentrations of imidazole, 20mM, 50mM, 100mM, 150mM and 250mM, respectively, and the 150mM imidazole-washed proteins were analyzed by 12% SDS-PAGE, confirmed by Coomassie blue staining. And further analyzing the purity of the target protein by using Western Blot.

Coomassie blue staining showed the purified product to be the protein of interest, with molecular weight size consistent with expected. The Western Blot result shows that the expressed protein has high purity and strong specificity, and is shown in figure 1.

Example 3 PvTrag17 protein promotes macrophage RAW264.7 polarization

Logarithmic phase RAW264.7 cells were taken and the cell concentration was adjusted to 5X 10 in DMEM medium containing 10% FBS⁵Per mL, 1mL per well was inoculated in a 6-well plate with 5% CO₂Culturing for 6h in an incubator at 37 ℃, discarding the supernatant after the cells adhere to the wall, and washing with PBS buffer solution to remove the cells which do not adhere to the wall. The samples were added to 1mL of 20. mu.g/mL PvTrag17 and the blank was added to an equal volume of medium. After further culturing for 24h, the cells are lysed, the supernatant is centrifuged, and the expression level of CD80 and PD-L1 is detected by Western Blot. The Western Blot result shows that the Western Blot is deepened (see figure 2) for CD80 and PD-L1 protein, namely the protein expression is up-regulated, and the PvTrag17 protein can remarkably promote the polarization of unactivated RAW264.7 macrophages to M1 type macrophages.

Example 4 PvTrag17 protein promotes the secretion of NO, IL-2, IL-6, TNF-alpha by RAW264.7 cells

Logarithmic phase RAW264.7 cells were collected and the cell concentration was adjusted to 5X 10 in DMEM medium containing 10% FBS⁵one/mL, 100. mu.L/well of the suspension was inoculated into a 96-well plate and 5% CO was added₂Culturing at 37 deg.C for 6 hr, and discarding after cell adherenceSupernatant, PBS buffer wash removed nonadherent cells. The sample groups were added with 100. mu.L of PvTrag17 at different concentrations (5, 10, 20. mu.g/mL) and the blank group was added with an equal volume of medium. After further culturing for 24h, collecting supernatant, and detecting the secretion of NO, IL-2, IL-6 and TNF-alpha by using corresponding Elisa kit. Compared with a blank control group, the secretion amounts of TNF alpha, IL-6 and IL-2 of the experimental group are obviously increased in the sample concentration range. Compared with the blank group, the maximum secretion of the TNF alpha and the IL-6 cytokines in the experimental group is improved by 2.91 times and 2.71 times; in addition, compared with the blank group without secretion, the IL-2 secretion amount in the experimental group reaches 2.79pg/mL (shown in figure 3); the NO secretion of the experimental group was increased by 3.61 times (FIG. 4).

Example 5 PvTrag17 protein promotes expression of iNOs, IL-2, IL-6, TNF-alpha genes in RAW264.7 cells

(1) Logarithmic phase RAW264.7 cells were taken and the cell concentration was adjusted to 1X 10 in DMEM medium containing 10% FBS⁶one/mL, 1mL per well was inoculated in a 6-well plate, and 5% CO was placed₂Culturing for 6h in an incubator at 37 ℃, discarding the supernatant after the cells adhere to the wall, and washing with PBS buffer solution to remove the cells which do not adhere to the wall. The samples were added to 1mL of 20. mu.g/mL PvTrag17 and the blank was added to an equal volume of medium. After further culturing for 24h, RNA of each group of cells is collected by adopting an RNA extraction kit. The RNA was further reverse transcribed into DNA according to the cDNA reverse transcription kit instructions.

(2) The following primers were synthesized

(3)RT-PCR

The reaction system is shown below

SYBR Green	10μL
		ROX	0.4μL
cDNA	1μL
		Upstream primer	0.5μL
Downstream primer	0.5μL
		ddH₂O	Make up to 20. mu.L

PCR reaction conditions (two-step process): pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 60 ℃ and extension for 30s, 40 cycles; the dissolution curve 10 ℃ Hold; after the reaction was completed, the relative expression level of the gene was calculated.

The results are shown in FIG. 5. Analysis of the results revealed that PvTrag17 protein up-regulates the mRNA levels of IL-6, TNF α, IL-2 and iNOS by 6.9-fold, 7.32-fold, 11.89-fold and 11.32-fold, respectively.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> a protein and application thereof in regulating and controlling macrophage immune function

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 315

<212> PRT

<213> Artificial sequence

<400> 1

Met Glu Leu Lys Ala Asn Met Lys Gly Pro Ala Pro Gln Gln Lys Phe

1 5 10 15

Ser Pro Ala Lys Lys Thr Gln Asn Arg Asn Pro Lys Leu Ser Lys Met

20 25 30

Thr Ala Ile Phe Thr Val Ser Pro Leu Gln Ile Ile Leu Phe Ala Leu

35 40 45

Phe Ser Val Phe Ile Leu Asn Pro Ser His Ala Ala Ser Thr Glu Arg

50 55 60

Gly Ser Ile Lys Cys Tyr Leu Pro Asn Asn Leu Met Glu Phe Trp Lys

65 70 75 80

Asp Asp Val Asp Gln Ser Glu Gln Leu Lys Lys Cys Ala Trp Asn Asn

85 90 95

Trp Met Met Arg Leu Glu Ser Glu Trp Glu Asn Phe Asn Thr Ser Met

100 105 110

Lys Ser Lys Lys Asn Val Trp Leu Gln Glu Thr Glu Gln Glu Trp Thr

115 120 125

Glu Trp Ile Lys Gln Met Glu Asn Lys Trp Met Asn Cys Asn Glu Asn

130 135 140

Ile Asn Asp Glu Tyr Lys Asp Tyr Leu Ile Ser Lys Ser Ala Thr Trp

145 150 155 160

Thr Asp Glu Glu Trp Lys Glu Trp Ile Lys Thr Glu Gly Lys Asn Phe

165 170 175

Met Lys Thr Asp Leu Glu Lys Trp Ile Lys Ala Lys Glu Thr Ser Leu

180 185 190

Asp Leu Leu Leu Leu Thr Glu Trp Val Gln Trp Lys Asn Glu Lys Ile

195 200 205

Met Ala Trp Leu Leu Ser Glu Trp Lys Thr Glu Glu Asp Thr Tyr Trp

210 215 220

Ser Gln Trp Glu His Ser Thr Trp Leu Lys Trp Leu Asn Leu Thr Gln

225 230 235 240

Lys Lys His Trp Leu Lys Trp Lys Glu Arg Asn His Arg Glu Gly Glu

245 250 255

Gln Trp Ser Thr Trp Leu His Val Lys Glu Asn Val Tyr Ile Phe Ser

260 265 270

Glu Trp Asn Asn Trp Ser Ile Trp Lys Asn Glu Lys Glu Glu Phe Phe

275 280 285

Tyr Lys Trp Met Glu Asp Thr Ile Asn Glu Trp Ile Asn Glu Lys Arg

290 295 300

Trp Asn Thr Leu Val Ser Thr Asp Asn Asp Ser

305 310 315

<210> 2

<211> 948

<212> DNA

<213> Artificial sequence

<400> 2

atggaactaa aagccaatat gaagggtcca gcaccccagc aaaagttctc ccctgctaag 60

aaaacacaaa atagaaatcc caagttatcc aaaatgacgg caattttcac agtttctcct 120

ttacagatta tcttatttgc tctattttca gttttcatct taaatccctc ccatgctgca 180

agcaccgaaa ggggaagtat caagtgttat cttccaaaca atttaatgga attttggaaa 240

gatgacgtag atcaatcaga acaattaaaa aaatgtgcgt ggaataactg gatgatgagg 300

ttggaatcag aatgggaaaa cttcaacaca tccatgaaga gcaaaaagaa cgtatggctc 360

caagaaacag aacaagaatg gaccgaatgg attaaacaaa tggaaaataa atggatgaat 420

tgtaatgaga atattaatga tgaatataag gattatctta tatcaaaatc tgctacatgg 480

actgatgaag aatggaaaga atggataaaa acagaaggga aaaactttat gaaaacagat 540

ttagaaaaat ggattaaagc aaaagaaaca tcattggatt tgttactatt aacagaatgg 600

gtccagtgga aaaatgaaaa gatcatggca tggctattga gcgaatggaa aactgaagaa 660

gacacctact ggtcacaatg ggaacactca acatggctta agtggctcaa cttgacccag 720

aaaaaacatt ggctcaaatg gaaagaaaga aatcataggg aaggtgaaca atggtctact 780

tggttgcacg ttaaagaaaa tgtttatata tttagcgagt ggaataattg gtcaatatgg 840

aaaaatgaaa aagaagaatt cttctacaaa tggatggaag atacaattaa cgagtggata 900

aatgagaaga ggtggaacac cttggtgagc acagataatg actcataa 948

<210> 3

<211> 27

<212> DNA

<213> Artificial sequence

<400> 3

ggatccatgg aactaaaagc caatatg 27

<210> 4

<211> 27

<212> DNA

<213> Artificial sequence

<400> 4

ctcgagtgag tcattatctg tgctcac 27

Claims

The application of the PvTrag17 recombinant protein in preparing a product for promoting the polarization of unactivated macrophage RAW264.7 to the M1 type in vitro is characterized in that the amino acid sequence of the PvTrag17 recombinant protein is shown as SEQ ID NO. 1.