CN107746894B - Method for rapidly identifying nucleotide point mutation of phytophthora sojae β -tubulin gene and resistance of phytophthora sojae β -tubulin gene to ethaboxam - Google Patents
Method for rapidly identifying nucleotide point mutation of phytophthora sojae β -tubulin gene and resistance of phytophthora sojae β -tubulin gene to ethaboxam Download PDFInfo
- Publication number
- CN107746894B CN107746894B CN201711014310.9A CN201711014310A CN107746894B CN 107746894 B CN107746894 B CN 107746894B CN 201711014310 A CN201711014310 A CN 201711014310A CN 107746894 B CN107746894 B CN 107746894B
- Authority
- CN
- China
- Prior art keywords
- phytophthora sojae
- seq
- gly
- glu
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention relates to identification of nucleotide point mutation of soybean phytophthora microtubulin gene β -tubulin and application thereof in monitoring of ethaboxam resistance as a bactericide, and discloses a molecular detection method for identifying the resistance of 23-bit, 772-bit and 494-bit nucleotide mutations of the soybean phytophthora β -tubulin gene to ethaboxam and a special primer thereof.
Description
Technical Field
The invention relates to identification of nucleotide point mutation of phytophthora sojae tubulin β -tubulin gene and application of the nucleotide point mutation in ethaboxam resistance detection of bactericide, and particularly discloses a molecular detection method and a special primer for rapidly identifying nucleotide point mutation of phytophthora sojae β -tubulin gene and drug resistance of phytophthora sojae to ethaboxam, belonging to the technical field of molecular biology.
Background
Phytophthora sojae (Phytophthora sojae) is one of ten kinds of plant pathogenic oomycetes, and the sexual reproduction mode is the same as that of the original strain. The host range is single, and the soybean is mainly infected, so that the soybean root rot is caused. The disease is one of important diseases in soybean production, and leads to failure in production when the disease is serious. The disease was first discovered in indiana in the united states in 1948, and later rapidly spread to several countries in canada, brazil, argentina, europe, and africa, and is now distributed throughout major soybean producing regions of the world, with billions of dollars of economic loss each year.
At present, chemical control still plays an irreplaceable role in the control of plant pathogenic oomycete diseases such as phytophthora sojae due to the characteristics of quick effect and high efficiency. However, with the unreasonable frequent use of some systemic bactericides, many plant pathogenic oomycetes have developed severe resistance to them. Therefore, various international agricultural chemical companies are constantly dedicated to developing novel bactericides which have a new action mechanism and have no mutual drug resistance with the existing bactericides on the market, and the novel bactericides are used for preventing and treating plant pathogenic oomycete diseases such as phytophthora sojae and controlling drug resistance.
Ethaboxam (ethaboxam) is a thiazole amide fungicide developed by LG life science of korea (formerly LG chemical ltd) under the trade name Guardian. In 1998, ethaboxam was first approved to be registered as a novel bactericide in Korea. Ethaboxam is a systemic fungicide, has protection and treatment activity, and is mainly used for preventing and treating plant pathogenic oomycetes. The ethaboxam is found to have a certain destructive effect on the microtubules of pathogenic bacteria, can influence the integrity of the microtubules, and is presumed to be a tubulin inhibitor.
At present, ethaboxam is applied and registered in different regions in the world for preventing and controlling plant pathogenic oomycetes such as phytophthora sojae, phytophthora capsici, peronospora cubensis and peronospora viticola, and has wide application prospect. However, the present laboratory obtained a strain of phytophthora sojae which gave low and high levels of resistance to ethaboxam, respectively, by acclimatization of the drug, and the resistant strain had a certain suitability for survival, indicating a low to moderate risk of resistance. Therefore, when the ethaboxam is used for preventing and treating plant pathogenic oomycete diseases, attention needs to be paid to and drug resistance is avoided, detection and early warning of the resistance development of pathogenic bacteria to the ethaboxam are enhanced, scientific use of the ethaboxam is guided, the occurrence and development of drug resistance are delayed, and the service life of the medicament is prolonged.
The conventional detection method for the resistance of the bactericide comprises the following steps: a hypha growth rate method, a hypha dry weight method, a spore germination method, an agar spreading method and the like. However, these methods require isolation and purification of the pathogenic bacteria, followed by inoculation on a medium with a drug or on a bactericide-treated living plant or tissue, and the results can be investigated only after a certain period of time. By adopting the conventional method, when the frequency of the field drug-resistant strains is more than 1%, the field drug-resistant strains can be detected (if the drug-resistant strains with the frequency of 1% are detected with the probability of 95%, the detected sample size is more than 300), so the method has the defects of low sensitivity, large workload, long test period and the like.
With the rapid development of molecular biology technology and the continuous expansion of its application range, the allele specific PCR molecular technology is beginning to be applied in the detection of drug resistance of pathogenic bacteria. Compared with the traditional detection method, the method not only saves the detection time and improves the working efficiency, but also improves the detection sensitivity, and the detection frequency is 10-5～10-4And is more suitable for detecting the drug resistance gene with low frequency, so the method is also an ideal method for early diagnosis of the drug resistance in the field. Therefore, molecular detection technology will play an increasingly important role in the sustainable management system of diseases.
Disclosure of Invention
The invention aims to provide a method for detecting or assisting in detecting whether β -tubulin gene has a mutation site in phytophthora sojae and a special primer thereof.
The method for detecting or assisting in detecting whether the β -tubulin gene has a mutation site in phytophthora sojae provided by the invention comprises the following steps:
taking the genomic DNA of the phytophthora sojae to be detected as a template, and carrying out PCR amplification by using primers shown in SEQ ID NO 1 and SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4, and SEQ ID NO 5 and SEQ ID NO 6, wherein if any one of three bands of 354bp, 244bp and 284bp can be amplified, β -tubulin gene in the phytophthora sojae to be detected has a mutation site;
the mutation site refers to that the 23 rd nucleotide of the genome sequence of β -tubulin gene in phytophthora sojae is T homozygous from the 5' end, the 772 rd nucleotide is G homozygous and the 494 th nucleotide is A homozygous.
The genomic sequence of the β -tubulin gene in Phytophthora sojae is nucleotide 23 from the 5 'end, that is, nucleotide 23 from the 5' end in SEQ ID NO. 8, nucleotide 772 from the 5 'end, that is, nucleotide 772 from the 5' end in SEQ ID NO. 10, and nucleotide 494 from the 5 'end, that is, nucleotide 494 from the 5' end in SEQ ID NO. 12.
In the process, the annealing temperatures in the PCR amplification are 66.7 ℃, 66.7 ℃ and 68.1 ℃.
The primer pair for detecting or assisting in detecting whether β -tubulin gene has mutation in phytophthora sojae provided by the invention consists of DNA molecules shown in SEQ ID NO. 1 and SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4, and SEQ ID NO. 5 and SEQ ID NO. 6.
Another objective of the invention is to provide a mutation site of β -tubulin gene or protein in Phytophthora sojae.
The three mutation sites of the β -tubulin gene in the phytophthora sojae provided by the invention are that the 23 rd nucleotide from the 5' end of the genome sequence of the β -tubulin gene in the phytophthora sojae is T homozygous, the 772 th nucleotide is G homozygous and the 494 th nucleotide is A homozygous, wherein the 23 rd nucleotide from the 5' end of the genome sequence of the β -tubulin gene in the phytophthora sojae is the 23 rd nucleotide from the 5' end of SEQ ID NO: 8, the 772 th nucleotide from the 5' end is the 772 th nucleotide from the 5' end of SEQ ID NO: 10, and the 494 th nucleotide from the 5' end is the 494 th nucleotide from the 5' end of SEQ ID NO: 12.
The three mutation sites of β -tubulin protein in the phytophthora sojae provided by the invention are that the 8 th amino acid from the N end of β -tubulin protein in the phytophthora sojae is homozygous leucine, the 258 th amino acid is homozygous valine and the 165 th amino acid is homozygous tyrosine, wherein the 8 th amino acid from the N end of β -tubulin protein in the phytophthora sojae is the 8 th amino acid from the N end of SEQ ID NO: 7, the 268 th amino acid from the N end of SEQ ID NO: 9 is the 268 th amino acid from the N end, and the 165 th amino acid from the N end of SEQ ID NO: 11 is the 165 th amino acid from the N end.
The application of any mutation site in identifying the drug resistance of the phytophthora sojae also belongs to the protection scope of the invention; the drug resistance is a thiazole amide bactericide such as ethaboxam resistance.
In the application, the phytophthora sojae with the mutation site has drug resistance.
The method for detecting the point mutation of the phytophthora sojae for generating the drug resistance of ethaboxam, provided by the invention, has the advantages that the high-sensitivity, simple and rapid molecular detection is carried out on resistant strains, the generation dynamics of the drug resistance can be known in time, and the method has important significance for formulating a reasonable disease management scheme and effectively controlling the development of drug-resistant diseases.
Drawings
FIG. 1 shows the sequence alignment of sensitive and resistant strains of Phytophthora sojae A, C, E, mutation of β -tubulin gene of Phytophthora sojae B, homozygous T base at position 23 of β -tubulin gene of Phytophthora sojae, homozygous G base at position 772 of β -tubulin gene of Phytophthora sojae D, and homozygous A base at position 494 of β -tubulin gene of Phytophthora sojae F, PSDZT2-14, Ps6 and P6497 as sensitive strains, R40, R41, R42, R7, R14, R15, R25, R53 and R68 as resistant strains.
FIG. 2 shows the AS-PCR detection of phytophthora sojae resistant mutants. A: electrophoresis results of three pairs of AS-PCR primers under different temperature conditions. B: the primer PSLR23F/R amplified at 66.7 ℃. C: amplification of primer PSLR772F/R at 66.7 ℃. D: amplification result of primer PSHR494F/R at 68.1 ℃. S is a sensitive strain, R is a resistant strain, and CK is a blank control.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The "resistant strains" in this context all refer to phytophthora sojae which is resistant to the fungicide ethaboxam; the "sensitive strains" all refer to phytophthora sojae which is sensitive to the bactericide ethaboxam.
The strains of phytophthora sojae used in the examples below were: sensitive strain Ps 6; sensitive parent strains PSDZT2-14 and P6497; resistant strains R40, R41, R42, R7, R14, R15, R25, R53 and R68.
The strains PSDZT2-14, R7, R14, R15, R25, R53 and R68 are collected from Heilongjiang province in China; ps6 was collected from the region of anhui, china; p6497, R40, R41 and R42 were collected from the United states. All strains are identified to be phytophthora sojae by the existing morphological and molecular biology methods.
The above strains were tested for resistance to drugs by colony growth assay.
Example 1 determination of susceptibility of Phytophthora sojae to ethaboxam
Nine phytophthora sojae resistant mutants, with the strain numbers of R40, R41, R42, R7, R14, R15, R25, R53 and R68; three phytophthora sojae sensitive strains, PSDZT2-14, Ps6 and P6497.
V8 medium: 100mL of V8 raw juice, 15g of agar powder and distilled water are added to a constant volume of 1L, and the mixture is subjected to moist heat sterilization at 121 ℃ for 20 minutes.
1. The experimental procedure was as follows:
1) ethaboxam is prepared into 10 by dimethyl sulfoxide (DMSO)5Mu.g/ml of mother liquor. For the sensitivity determination of the phytophthora sojae sensitive strain, the reagent ethaboxam is gradually diluted into a concentration gradient of 0.2 mu g/mL, 0.1 mu g/mL, 0.05 mu g/mL, 0.025 mu g/mL, 0.01 mu g/mL and 0.005 mu g/mL; for the sensitivity determination of phytophthora sojae resistant strains, the test agent ethaboxam is diluted stepwise to a concentration gradient of 5. mu.g/mL, 1. mu.g/mL, 0.5. mu.g/mL, 0.2. mu.g/mL, 0.1. mu.g/mL or 200. mu.g/mL, 100. mu.g/mL, 50. mu.g/mL, 25. mu.g/mL, 10. mu.g/mL.
2) Sucking 60 μ L of the medicinal liquid with a pipette, adding into sterilized 60mL V8 culture medium cooled to 45 deg.C to make solvent content 1 ‰, mixing, pouring the culture medium with medicine into a culture dish with diameter of 9cm, and repeating for 3 times with each ratio of medicinal preparation, wherein the treatment of adding 60 μ L of DMSO is used as blank control.
3) Culturing the phytophthora sojae on a V8 plate for 5 days, punching a bacterial cake with the diameter of 0.5cm along the edge of a bacterial colony by using a puncher, inoculating the bacterial colony face downwards into the drug-carrying and control culture medium in the step 2), placing the bacterial colony in an incubator at 25 ℃ for dark culture, and measuring the diameter of the bacterial colony after 5 days.
4) And measuring the diameter of the bacterial colony by a cross method, and calculating the inhibition rate of each compound proportion on the growth of hyphae of the test strain according to the average diameter value of the bacterial colony. Then converting the inhibition rate into a probability value (Y), converting the medicament concentration into a logarithmic value (X) with the base of 10, drawing a regression line in Microsoft Excel, and respectively obtaining the virulence regression curve equation Y ═ a + bX, the correlation coefficient r and the effective inhibition medium concentration EC of the soybean phytophthora strain to be tested50Values, and fold resistance were calculated.
Multiple of resistance ═ EC of resistant strains50EC of sensitive parent Strain50
2. Results
TABLE 112 susceptibility of strains of A. sojae to ethaboxam
Through the sensitivity detection of the phytophthora sojae on ethaboxam, the result shows that EC of phytophthora sojae sensitive strains Ps6, PSDZT2-14 and P649750At 3.22X 10-2～5.01×10-2EC of low-resistant strains R40, R41, R42, R7, R14 and R15 between μ g/mL50Between 0.33 and 1.55 mu g/mL, and the EC of the high-resistance strains R25, R53 and R6850More than 50 mug/mL, significantly higher than the EC of the sensitive strain50As in table 1.
Example 2 discovery of the β -tubulin Gene and β -tubulin protein mutation sites in Phytophthora sojae
1. The strain is as follows: sensitive strains Ps6, PSDZT2-14 and P6497; resistant strains R40, R41, R42, R7, R14, R15, R25, R53 and R68.
2. The method comprises the following steps:
1) strain culture: the phytophthora sojae is cultured at 25 deg.c in V8 culture medium (V8 juice 100mL, agar powder 15g, distilled water to 1 L.121 deg.c for 20min, wet heat sterilizing). Inoculating the pre-cultured phytophthora sojae sensitive strain and resistant strain to V8 culture medium spread with cellophane, dark culturing at 25 deg.C for 5d, collecting mycelium, freezing with liquid nitrogen, and storing at-80 deg.C for extracting genome DNA.
2) Respectively extracting genome DNA of a phytophthora sojae sensitive strain and genome DNA of a phytophthora sojae resistant strain:
taking a proper amount of hypha frozen by liquid nitrogen, grinding the hypha into powder by a mortar, and placing the powder into a 1.5mL centrifuge tube;
adding 150 μ L of extraction buffer (0.35M sorbitol, 0.1M Tris, 0.005M EDTA [ pH 7.5], 0.02M sodium bisulfite) and shaking on a shaker for 30 s;
adding 150. mu.L of a nuclear lysis buffer (0.2M Tris, 0.05M EDTA [ pH 7.5], 2.0M NaCl and 2% CTAB [ pH 7.5]) and 60. mu.L of 20% SDS, shaking on a shaker, and then bathing in a 65 ℃ water bath for 30 min;
equal volume of chloroform was added: mixing isoamyl alcohol (v/v, 24: 1) gently, centrifuging at 12000rpm for 20min at 4 deg.C;
taking the supernatant fluid in a new tube, adding chloroform for re-extraction;
centrifuging, adding isovolumetric 4 deg.C isopropanol and 0.1 volume times of 3M sodium acetate (pH 8.0) into supernatant, standing at room temperature for 15min to precipitate genome;
centrifuging at 12000rpm for 20min at 4 deg.C, washing the precipitate twice with 300 μ L of 70% precooled ethanol;
after drying in vacuo, the extract was dissolved in 50. mu.L of sterile Milli-Q H2O, storing at-20 ℃ for later use.
3) PCR amplification of phytophthora sojae sensitive strain tubulin β -tubulin gene
Primers PsbetaF1 (5'-CGTGCGTCAAACATAGCAGG-3') and PsbetaR1 (5'-TTAGAACGTACCGGCTGCTC-3') were used to amplify the full length of the gene encoding phytophthora sojae tubulin β -tubulin and its upstream and downstream sequences.
The PCR reaction system is as follows:
50- μ L PCR System:
the PCR reaction conditions were as follows:
4) sequencing
Sequencing the PCR product, taking genome DNA as a template, wherein the total length of the tubulin β -tubulin gene of the phytophthora sojae resistant strain is 134Ibp, the sequences are shown as SEQ ID NO. 8, SEQ ID NO. 10 and SEQ ID NO. 12, and the cDNA codes 447 amino acids, and the sequences are shown as SEQ ID NO. 7, SEQ ID NO. 9 and SEQ ID NO. 11.
5) Sequence alignment
The full length of tubulin β -tubulin gene of resistant strains R40, R41, R42, R7, R14, R15, R25, R53, R68 and sensitive strains Ps6, PSDZT2-14, P6497, respectively, was sequenced.
In the sensitive strain, the 23 rd nucleotide of the genome sequence of the gene β -tubulin from the 5' end is homozygous A, the 772 th nucleotide is homozygous A and the 494 th nucleotide is homozygous G, the 8 th amino acid of the phytophthora sojae β -tubulin protein from the N end is homozygous glutamine, the 258 th amino acid is homozygous isoleucine and the 165 th amino acid is homozygous cysteine;
in the resistant strain, the 23 rd nucleotide of the genome sequence of the gene β -tubulin from the 5' end is T homozygous, the 772 th nucleotide is G homozygous and the 494 th nucleotide is A homozygous, the 8 th amino acid of the phytophthora sojae β -tubulin protein from the N end is leucine homozygous, the 258 th amino acid is valine homozygous and the 165 th amino acid is tyrosine homozygous (FIG. 1A, C, E);
the results show that the resistant strains are respectively mutated at 23, 772 and 494, homozygous A is respectively mutated into homozygous T, homozygous A is mutated into homozygous G, homozygous G is mutated into homozygous A, and the peak line graph of sequencing is analyzed, so that an obvious single peak (figure 1B, D, F) can be seen, and the change of the three bases also respectively causes that 8 homozygous glutamine is mutated into homozygous leucine, 258 homozygous isoleucine is mutated into homozygous valine and 165 cysteine is mutated into homozygous tyrosine. Therefore, the mutation at all three sites is related to the resistance of phytophthora sojae to the fungicide ethaboxam.
Example 3 method for detecting mutation site in Phytophthora sojae
First, AS-PCR detection method
1. Primer design
The primers are shown in Table 2.
Table 2 primers used in AS-PCR detection of drug resistance of Phytophthora sojae to ethaboxam
| Primer | Sequence(5′-3′) | SEQ ID |
| PSLR23F | TGAGAGAGCTCGTTCACATCGT | SEQ ID NO：1 |
| PSLR23R | CGTCGAGAACCGAGTCGATAA | SEQ ID NO：2 |
| PSLR772F | CGTAAGCTTGCCGTGAACCTAG | SEQ ID NO：3 |
| PSLR772R | TGAGCATCTGCTCGTCAACC | SEQ ID NO：4 |
| PSHR494F | AGTACCCGGACCGTATCATGTA | SEQ ID NO：5 |
| PSLR494R | CTTACGCAGGTCCGAGTTCA | SEQ ID NO：6 |
The last base of the upstream primer is consistent with the mutant, the penultimate base is changed at the same time, and amplification is carried out by combining different annealing temperatures, so that the specificity of the primer is improved. The reaction conditions were as follows:
the PCR reaction system is as follows:
50- μ L PCR System:
the PCR reaction conditions were as follows:
the results (FIG. 2A) show that the primer pair PSLR23F/R can amplify to bands from resistant strains and sensitive strains at 50.0-59.8 ℃ and can amplify to brighter bands from resistant strains at 63.2-68.1 ℃; PSLR772F/R can be amplified to bands from resistant strains and sensitive strains at 50.0-64.9 ℃, and can be amplified to bands from resistant strains at 66.7-68.1 ℃; PSHR494F/R amplified bands from both resistant and susceptible strains at 50.0-66.7 ℃ and from resistant strains at 68.1-70.0 ℃. At partial temperature, three pairs of primers can respectively amplify a single target band from a resistant strain but cannot amplify a band from a sensitive strain. The three pairs of primers are shown to detect corresponding resistance sites. Thus, the primer pairs PSLR23F/R, PSLR772F/R and PSHR494F/R all served AS AS-PCR primers with annealing temperatures of 66.7 ℃, 66.7 ℃ and 68.1 ℃, respectively.
The primer PSLR23F/R amplification product is SEQ ID NO: nucleotides 2 to 355 of 8; the amplification product of the primer PSLR772F/R is SEQ ID NO: 10 nucleotide 751-994; the amplification product of primer PSHR494F/R is SEQ ID NO: 12 at nucleotide 473 and 756.
2. Detection of mutation sites
Taking genome DNA of phytophthora sojae to be detected as a template, respectively carrying out PCR amplification on PSLR23F/R, PSLR772F/R and PSHR494F/R by using primers, then carrying out agarose gel electrophoresis detection, if fragments can be obtained by amplification from the genome DNA of the strain, judging the strain to be a resistant strain, and if the fragments cannot be obtained by amplification, judging the detected phytophthora sojae strain to be a sensitive strain.
The PCR amplification system and the reaction conditions are consistent with those in the experiment, and the annealing temperatures of the three pairs of primers, namely PSLR23F/R, PSLR772F/R and PSHR494F/R, are 66.7 ℃, 66.7 ℃ and 68.1 ℃ respectively.
The strains to be tested are as follows: resistant strains R40, R41, R42, R7, R14, R15, R25, R53, R68 and sensitive strains Ps6, PSDZT2-14 and P6497.
The results are shown in FIGS. 2B, C and D. The results show that the target fragment could only be amplified from resistant strains, but not from sensitive strains. Therefore, primers PSLR23F/R, PSLR772F/R and PSHR494F/R are adopted to carry out PCR amplification at the annealing temperatures of 66.7 ℃, 66.7 ℃ and 68.1 ℃ respectively, so that the drug-resistant strain of phytophthora sojae for ethaboxam can be effectively detected.
Sequence listing
<110> university of agriculture in China
<120> method for rapidly identifying nucleotide point mutation of phytophthora sojae β -tubulin gene and resistance to ethaboxam thereof
<160>12
<170>SIPOSequenceListing 1.0
<210>1
<211>22
<212>DNA
<213> Artificial sequence (Phytophthora sojae)
<400>1
tgagagagct cgttcacatc gt 22
<210>2
<211>21
<212>DNA
<213> Artificial sequence (Phytophthora sojae)
<400>2
cgtcgagaac cgagtcgata a 21
<210>3
<211>22
<212>DNA
<213> Artificial sequence (Phytophthora sojae)
<400>3
cgtaagcttg ccgtgaacct ag 22
<210>4
<211>20
<212>DNA
<213> Artificial sequence (Phytophthora sojae)
<400>4
tgagcatctg ctcgtcaacc 20
<210>5
<211>22
<212>DNA
<213> Artificial sequence (Phytophthora sojae)
<400>5
agtacccgga ccgtatcatg ta 22
<210>6
<211>20
<212>DNA
<213> Artificial sequence (Phytophthora sojae)
<400>6
cttacgcagg tccgagttca 20
<210>7
<211>446
<212>PRT
<213> Phytophthora sojae (Phytophthora sojae)
<220>
<221>VARIANT
<222>(8)
<223> Gln is Leu
<400>7
Met Arg Glu Leu Val His Ile Gln Gly Gly Gln Cys Gly Asn Gln Ile
1 5 10 15
Gly Ala Lys Phe Trp Glu Val Ile Ser Asp Glu His Gly Val Asp Pro
20 25 30
Thr Gly Ser Tyr His Gly Asp Ser Asp Leu Gln Leu Glu Arg Ile Asn
35 40 45
Val Tyr Tyr Asn Glu Ala Thr Gly Gly Arg Tyr Val Pro Arg Ala Ile
50 55 60
Leu Met Asp Leu Glu Pro Gly Thr Met Asp Ser Val Arg Ala Gly Pro
65 70 75 80
Tyr Gly Gln Leu Phe Arg Pro Asp Asn Phe Val Phe Gly Gln Thr Gly
85 90 95
Ala Gly Asn Asn Trp Ala Lys Gly His Tyr Thr Glu Gly Ala Glu Leu
100 105 110
Ile Asp Ser Val Leu Asp Val Val Arg Lys Glu Ala Glu Ser Cys Asp
115 120 125
Cys Leu Gln Gly Phe Gln Ile Thr His Ser Leu Gly Gly Gly Thr Gly
130 135 140
Ser Gly Met Gly Thr Leu Leu Ile Ser Lys Ile Arg Glu Glu Tyr Pro
145 150 155 160
Asp Arg Ile Met Cys Thr Tyr Ser Val Cys Pro Ser Pro Lys Val Ser
165 170 175
Asp Thr Val Val Glu Pro Tyr Asn Ala Thr Leu Ser Val His Gln Leu
180 185 190
Val Glu Asn Ala Asp Glu Val Met Cys Leu Asp Asn Glu Ala Leu Tyr
195 200 205
Asp Ile Cys Phe Arg Thr Leu Lys Leu Thr Thr Pro Thr Tyr Gly Asp
210 215 220
Leu Asn His Leu Val Cys Ala Ala Met Ser Gly Ile Thr Thr Cys Leu
225 230 235 240
Arg Phe Pro Gly Gln Leu Asn Ser Asp Leu Arg Lys Leu Ala Val Asn
245 250 255
Leu Ile Pro Phe Pro Arg Leu His Phe Phe Met Ile Gly Phe Ala Pro
260 265 270
Leu Thr Ser Arg Gly Ser Gln Gln Tyr Arg Ala Leu Thr Val Pro Glu
275 280 285
Leu Thr Gln Gln Gln Phe Asp Ala Lys Asn Met Met Cys Ala Ala Asp
290 295 300
Pro Arg His Gly Arg Tyr Leu Thr Ala Ala Cys Met Phe Arg Gly Arg
305 310 315 320
Met Ser Thr Lys Glu Val Asp Glu Gln Met Leu Asn Val Gln Asn Lys
325 330 335
Asn Ser Ser Tyr Phe Val Glu Trp Ile Pro Asn Asn Ile Lys Ala Ser
340 345 350
Val Cys Asp Ile Pro Pro Lys Gly Leu Lys Met Ser Thr Thr Phe Ile
355 360 365
Gly Asn Ser Thr Ala Ile Gln Glu Met Phe Lys Arg Val Ser Glu Gln
370 375 380
Phe Thr Ala Met Phe Arg Arg Lys Ala Phe Leu His Trp Tyr Thr Gly
385 390 395 400
Glu Gly Met Asp Glu Met Glu Phe Thr Glu Ala Glu Ser Asn Met Asn
405 410 415
Asp Leu Val Ser Glu Tyr Gln Gln Tyr Gln Asp Ala Thr Ala Glu Glu
420 425 430
Glu Gly Glu Phe Asp Glu Asp Glu Glu Met Asp Glu Met Met
435 440 445
<210>8
<211>1341
<212>DNA
<213> Phytophthora sojae (Phytophthora sojae)
<220>
<221>misc_feature
<222>(23)
<223>y=t
<400>8
atgagagagc tcgttcacat ccygggtggc cagtgcggta accagatcgg cgccaagttc 60
tgggaggtca tctccgacga gcacggcgtg gaccccacgg gatcctacca cggcgactcg 120
gacctgcagc tggagcgcat caacgtgtac tacaacgagg ccacgggcgg ccgctacgtg 180
ccgcgcgcca tcctcatgga cctggagccc ggcaccatgg actcggtgcg cgccggcccc 240
tacggccagc tcttccgccc ggacaacttc gtgttcggcc agacgggcgc cggtaacaac 300
tgggccaagg gacactacac ggagggtgcc gagcttatcg actcggttct cgacgtcgtc 360
cgcaaggagg ctgagagctg tgactgcctt cagggtttcc agatcacgca ctcgctgggt 420
ggcggtaccg gttccggtat gggtacgctt cttatctcca agattcgtga ggagtacccg 480
gaccgtatca tgtgcacgta ctcggtctgc ccgtcgccta aggtgtcgga cacggtcgtc 540
gagccctaca acgctacgct gtccgtccac cagctcgttg agaacgccga tgaggtcatg 600
tgcctggata acgaggccct gtacgacatt tgcttccgta ccctgaagct cacgaccccc 660
acctacggtg acctgaacca cctggtgtgc gccgccatgt ccggcattac cacgtgcctg 720
cgtttccccg gtcagctgaa ctcggacctg cgtaagcttg ccgtgaacct gytcccgttc 780
ccgcgtctcc acttcttcat gatcggtttc gccccgctga cgtcgcgcgg ctcgcagcag 840
taccgtgccc tgacggtgcc cgagctgacc cagcagcagt tcgatgctaa gaacatgatg 900
tgtgccgccg accctcgcca cggccgctat ttaactgccg cgtgtatgtt ccgcggacgt 960
atgagcacga aggaggttga cgagcagatg ctcaacgtgc agaacaagaa ctcgtcgtac 1020
ttcgtcgagt ggatccccaa caacatcaag gctagcgtgt gtgacatccc gcccaagggt 1080
ctcaagatga gcaccacgtt catcggtaac tcgaccgcta tccaggagat gttcaagcgc 1140
gtgtccgaac agttcacggc tatgttccgt cgtaaggctt tcttgcactg gtacacgggt 1200
gagggtatgg acgagatgga gttcacggag gccgagtcca acatgaacga tcttgtgtct 1260
gagtaccagc agtaccagga cgctaccgca gaggaggagg gcgagttcga cgaggacgag 1320
gaaatggatg agatgatgta g 1341
<210>9
<211>446
<212>PRT
<213> Phytophthora sojae (Phytophthora sojae)
<220>
<221>VARIANT
<222>(258)
<223> Ile is Val
<400>9
Met Arg Glu Leu Val His Ile Gln Gly Gly Gln Cys Gly Asn Gln Ile
1 5 10 15
Gly Ala Lys Phe Trp Glu Val Ile Ser Asp Glu His Gly Val Asp Pro
20 25 30
Thr Gly Ser Tyr His Gly Asp Ser Asp Leu Gln Leu Glu Arg Ile Asn
35 40 45
Val Tyr Tyr Asn Glu Ala Thr Gly Gly Arg Tyr Val Pro Arg Ala Ile
50 55 60
Leu Met Asp Leu Glu Pro Gly Thr Met Asp Ser Val Arg Ala Gly Pro
65 70 75 80
Tyr Gly Gln Leu Phe Arg Pro Asp Asn Phe Val Phe Gly Gln Thr Gly
85 90 95
Ala Gly Asn Asn Trp Ala Lys Gly His Tyr Thr Glu Gly Ala Glu Leu
100 105 110
Ile Asp Ser Val Leu Asp Val Val Arg Lys Glu Ala Glu Ser Cys Asp
115 120 125
Cys Leu Gln Gly Phe Gln Ile Thr HisSer Leu Gly Gly Gly Thr Gly
130 135 140
Ser Gly Met Gly Thr Leu Leu Ile Ser Lys Ile Arg Glu Glu Tyr Pro
145 150 155 160
Asp Arg Ile Met Cys Thr Tyr Ser Val Cys Pro Ser Pro Lys Val Ser
165 170 175
Asp Thr Val Val Glu Pro Tyr Asn Ala Thr Leu Ser Val His Gln Leu
180 185 190
Val Glu Asn Ala Asp Glu Val Met Cys Leu Asp Asn Glu Ala Leu Tyr
195 200 205
Asp Ile Cys Phe Arg Thr Leu Lys Leu Thr Thr Pro Thr Tyr Gly Asp
210 215 220
Leu Asn His Leu Val Cys Ala Ala Met Ser Gly Ile Thr Thr Cys Leu
225 230 235 240
Arg Phe Pro Gly Gln Leu Asn Ser Asp Leu Arg Lys Leu Ala Val Asn
245 250 255
Leu Ile Pro Phe Pro Arg Leu His Phe Phe Met Ile Gly Phe Ala Pro
260 265 270
Leu Thr Ser Arg Gly Ser Gln Gln Tyr Arg Ala Leu Thr Val Pro Glu
275 280 285
Leu Thr Gln Gln Gln Phe Asp Ala Lys Asn MetMet Cys Ala Ala Asp
290 295 300
Pro Arg His Gly Arg Tyr Leu Thr Ala Ala Cys Met Phe Arg Gly Arg
305 310 315 320
Met Ser Thr Lys Glu Val Asp Glu Gln Met Leu Asn Val Gln Asn Lys
325 330 335
Asn Ser Ser Tyr Phe Val Glu Trp Ile Pro Asn Asn Ile Lys Ala Ser
340 345 350
Val Cys Asp Ile Pro Pro Lys Gly Leu Lys Met Ser Thr Thr Phe Ile
355 360 365
Gly Asn Ser Thr Ala Ile Gln Glu Met Phe Lys Arg Val Ser Glu Gln
370 375 380
Phe Thr Ala Met Phe Arg Arg Lys Ala Phe Leu His Trp Tyr Thr Gly
385 390 395 400
Glu Gly Met Asp Glu Met Glu Phe Thr Glu Ala Glu Ser Asn Met Asn
405 410 415
Asp Leu Val Ser Glu Tyr Gln Gln Tyr Gln Asp Ala Thr Ala Glu Glu
420 425 430
Glu Gly Glu Phe Asp Glu Asp Glu Glu Met Asp Glu Met Met
435 440 445
<210>10
<211>1341
<212>DNA
<213> Phytophthora sojae (Phytophthora sojae)
<220>
<221>misc_feature
<222>(772)
<223>y=g
<400>10
atgagagagc tcgttcacat ccagggtggc cagtgcggta accagatcgg cgccaagttc 60
tgggaggtca tctccgacga gcacggcgtg gaccccacgg gatcctacca cggcgactcg 120
gacctgcagc tggagcgcat caacgtgtac tacaacgagg ccacgggcgg ccgctacgtg 180
ccgcgcgcca tcctcatgga cctggagccc ggcaccatgg actcggtgcg cgccggcccc 240
tacggccagc tcttccgccc ggacaacttc gtgttcggcc agacgggcgc cggtaacaac 300
tgggccaagg gacactacac ggagggtgcc gagcttatcg actcggttct cgacgtcgtc 360
cgcaaggagg ctgagagctg tgactgcctt cagggtttcc agatcacgca ctcgctgggt 420
ggcggtaccg gttccggtat gggtacgctt cttatctcca agattcgtga ggagtacccg 480
gaccgtatca tgtgcacgta ctcggtctgc ccgtcgccta aggtgtcgga cacggtcgtc 540
gagccctaca acgctacgct gtccgtccac cagctcgttg agaacgccga tgaggtcatg 600
tgcctggata acgaggccct gtacgacatt tgcttccgta ccctgaagct cacgaccccc 660
acctacggtg acctgaacca cctggtgtgc gccgccatgt ccggcattac cacgtgcctg 720
cgtttccccg gtcagctgaa ctcggacctg cgtaagcttg ccgtgaacct gytcccgttc 780
ccgcgtctcc acttcttcat gatcggtttc gccccgctga cgtcgcgcgg ctcgcagcag 840
taccgtgccc tgacggtgcc cgagctgacc cagcagcagt tcgatgctaa gaacatgatg 900
tgtgccgccg accctcgcca cggccgctat ttaactgccg cgtgtatgtt ccgcggacgt 960
atgagcacga aggaggttga cgagcagatg ctcaacgtgc agaacaagaa ctcgtcgtac 1020
ttcgtcgagt ggatccccaa caacatcaag gctagcgtgt gtgacatccc gcccaagggt 1080
ctcaagatga gcaccacgtt catcggtaac tcgaccgcta tccaggagat gttcaagcgc 1140
gtgtccgaac agttcacggc tatgttccgt cgtaaggctt tcttgcactg gtacacgggt 1200
gagggtatgg acgagatgga gttcacggag gccgagtcca acatgaacga tcttgtgtct 1260
gagtaccagc agtaccagga cgctaccgca gaggaggagg gcgagttcga cgaggacgag 1320
gaaatggatg agatgatgta g 1341
<210>11
<211>446
<212>PRT
<213> Phytophthora sojae (Phytophthora sojae)
<220>
<221>VARIANT
<222>(165)
<223> Cys is Tyr
<400>11
Met Arg Glu Leu Val His Ile Gln Gly Gly Gln Cys Gly Asn Gln Ile
1 5 10 15
Gly Ala Lys Phe Trp Glu Val Ile Ser Asp Glu His Gly Val Asp Pro
20 25 30
Thr Gly Ser Tyr His Gly Asp Ser Asp Leu Gln Leu Glu Arg Ile Asn
35 40 45
Val Tyr Tyr Asn Glu Ala Thr Gly Gly Arg Tyr Val Pro Arg Ala Ile
50 55 60
Leu Met Asp Leu Glu Pro Gly Thr Met Asp Ser Val Arg Ala Gly Pro
65 70 75 80
Tyr Gly Gln Leu Phe Arg Pro Asp Asn Phe Val Phe Gly Gln Thr Gly
85 90 95
Ala Gly Asn Asn Trp Ala Lys Gly His Tyr Thr Glu Gly Ala Glu Leu
100 105 110
Ile Asp Ser Val Leu Asp Val Val Arg Lys Glu Ala Glu Ser Cys Asp
115 120 125
Cys Leu Gln Gly Phe Gln Ile Thr His Ser Leu Gly Gly Gly Thr Gly
130 135 140
Ser Gly Met Gly Thr Leu Leu Ile Ser Lys Ile Arg Glu Glu Tyr Pro
145 150 155 160
Asp Arg Ile Met Cys Thr Tyr Ser Val Cys Pro Ser Pro Lys Val Ser
165 170 175
Asp Thr Val Val Glu Pro Tyr Asn Ala Thr Leu Ser Val His Gln Leu
180 185 190
Val Glu Asn Ala Asp Glu Val Met Cys Leu Asp Asn Glu Ala Leu Tyr
195 200 205
Asp Ile Cys Phe Arg Thr Leu Lys Leu Thr Thr Pro Thr Tyr Gly Asp
210 215 220
Leu Asn His Leu Val Cys Ala Ala Met Ser Gly Ile Thr Thr Cys Leu
225 230 235 240
Arg Phe Pro Gly Gln Leu Asn Ser Asp Leu Arg Lys Leu Ala Val Asn
245 250 255
Leu Ile Pro Phe Pro Arg Leu His Phe Phe Met Ile Gly Phe Ala Pro
260 265 270
Leu Thr Ser Arg Gly Ser Gln Gln Tyr Arg Ala Leu Thr Val Pro Glu
275 280 285
Leu Thr Gln Gln Gln Phe Asp Ala Lys Asn Met Met Cys Ala Ala Asp
290 295 300
Pro Arg His Gly Arg Tyr Leu Thr Ala Ala Cys Met Phe Arg Gly Arg
305 310 315 320
Met Ser Thr Lys Glu Val Asp Glu Gln Met Leu Asn Val Gln Asn Lys
325 330 335
Asn Ser Ser Tyr Phe Val Glu Trp Ile Pro Asn Asn Ile Lys Ala Ser
340 345 350
Val Cys Asp Ile Pro Pro Lys Gly Leu Lys Met Ser Thr Thr Phe Ile
355 360 365
Gly Asn Ser Thr Ala Ile Gln Glu Met Phe Lys Arg Val Ser Glu Gln
370 375 380
Phe Thr Ala Met Phe Arg Arg Lys Ala Phe Leu His Trp Tyr Thr Gly
385 390 395 400
Glu Gly Met Asp Glu Met Glu Phe Thr Glu Ala Glu Ser Asn Met Asn
405 410 415
Asp Leu Val Ser Glu Tyr Gln Gln Tyr Gln Asp Ala Thr Ala Glu Glu
420 425 430
Glu Gly Glu Phe Asp Glu Asp Glu Glu Met Asp Glu Met Met
435 440 445
<210>12
<211>1341
<212>DNA
<213> Phytophthora sojae (Phytophthora sojae)
<220>
<221>misc_feature
<222>(494)
<223>y=a
<400>12
atgagagagc tcgttcacat ccagggtggc cagtgcggta accagatcgg cgccaagttc 60
tgggaggtca tctccgacga gcacggcgtg gaccccacgg gatcctacca cggcgactcg 120
gacctgcagc tggagcgcat caacgtgtac tacaacgagg ccacgggcgg ccgctacgtg 180
ccgcgcgcca tcctcatgga cctggagccc ggcaccatgg actcggtgcgcgccggcccc 240
tacggccagc tcttccgccc ggacaacttc gtgttcggcc agacgggcgc cggtaacaac 300
tgggccaagg gacactacac ggagggtgcc gagcttatcg actcggttct cgacgtcgtc 360
cgcaaggagg ctgagagctg tgactgcctt cagggtttcc agatcacgca ctcgctgggt 420
ggcggtaccg gttccggtat gggtacgctt cttatctcca agattcgtga ggagtacccg 480
gaccgtatca tgtycacgta ctcggtctgc ccgtcgccta aggtgtcgga cacggtcgtc 540
gagccctaca acgctacgct gtccgtccac cagctcgttg agaacgccga tgaggtcatg 600
tgcctggata acgaggccct gtacgacatt tgcttccgta ccctgaagct cacgaccccc 660
acctacggtg acctgaacca cctggtgtgc gccgccatgt ccggcattac cacgtgcctg 720
cgtttccccg gtcagctgaa ctcggacctg cgtaagcttg ccgtgaacct gatcccgttc 780
ccgcgtctcc acttcttcat gatcggtttc gccccgctga cgtcgcgcgg ctcgcagcag 840
taccgtgccc tgacggtgcc cgagctgacc cagcagcagt tcgatgctaa gaacatgatg 900
tgtgccgccg accctcgcca cggccgctat ttaactgccg cgtgtatgtt ccgcggacgt 960
atgagcacga aggaggttga cgagcagatg ctcaacgtgc agaacaagaa ctcgtcgtac 1020
ttcgtcgagt ggatccccaa caacatcaag gctagcgtgt gtgacatccc gcccaagggt 1080
ctcaagatga gcaccacgtt catcggtaac tcgaccgcta tccaggagat gttcaagcgc 1140
gtgtccgaac agttcacggc tatgttccgt cgtaaggctt tcttgcactg gtacacgggt 1200
gagggtatgg acgagatgga gttcacggag gccgagtcca acatgaacga tcttgtgtct 1260
gagtaccagc agtaccagga cgctaccgca gaggaggagg gcgagttcga cgaggacgag 1320
gaaatggatg agatgatgta g 1341
Claims (5)
1. A method for detecting or assisting in detecting whether a mutation site exists in β -tubulin gene in phytophthora sojae comprises the following steps:
the method comprises the steps of taking genomic DNA of phytophthora sojae to be detected as a template, carrying out PCR amplification by using primers shown in SEQ ID NO 1 and SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4, and SEQ ID NO 5 and SEQ ID NO 6 respectively, and if bands of 354bp, 244bp and 284bp can be amplified respectively, the β -tubulin gene in the phytophthora sojae to be detected has a mutation site, wherein in the PCR amplification, the annealing temperatures are 66.7 ℃, 66.7 ℃ and 68.1 ℃, respectively, the mutation site refers to that 23 rd nucleotide from the 5' end of the genomic sequence of β -tubulin gene in the phytophthora sojae is T homozygous, 772 th nucleotide is G homozygous and 494 a nucleotide is A homozygous, so that 8 th amino acid of the phytophthora sojae β -tubulin protein from the N end is homozygous leucine, 258 th amino acid is homozygous valine and 494 th amino acid is homozygous tyrosine.
2.A primer pair for detecting or assisting in detecting whether β -tubulin gene has mutation sites in phytophthora sojae consists of DNA molecules shown in SEQ ID NO. 1 and SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4, and SEQ ID NO. 5 and SEQ ID NO. 6.
3. Use of the method of claim 1 for identifying phytophthora sojae resistance; the drug resistance is an anti-thiazole amide bactericide.
4. Use of the primer pair of claim 2 for identifying resistance to phytophthora sojae; the drug resistance is an anti-thiazole amide bactericide.
5. Use according to claim 3, characterized in that: the phytophthora sojae with the mutation sites has the drug resistance against thiazole amide bactericides.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711014310.9A CN107746894B (en) | 2017-10-26 | 2017-10-26 | Method for rapidly identifying nucleotide point mutation of phytophthora sojae β -tubulin gene and resistance of phytophthora sojae β -tubulin gene to ethaboxam |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711014310.9A CN107746894B (en) | 2017-10-26 | 2017-10-26 | Method for rapidly identifying nucleotide point mutation of phytophthora sojae β -tubulin gene and resistance of phytophthora sojae β -tubulin gene to ethaboxam |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107746894A CN107746894A (en) | 2018-03-02 |
| CN107746894B true CN107746894B (en) | 2020-05-26 |
Family
ID=61252605
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711014310.9A Active CN107746894B (en) | 2017-10-26 | 2017-10-26 | Method for rapidly identifying nucleotide point mutation of phytophthora sojae β -tubulin gene and resistance of phytophthora sojae β -tubulin gene to ethaboxam |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107746894B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111647590B (en) * | 2020-07-06 | 2023-02-17 | 西北农林科技大学 | Adenylate cyclase containing FYVE structural domain and coding gene and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925565A (en) * | 2012-10-19 | 2013-02-13 | 中国农业大学 | Method for identifying nucleotide point mutation of phytophthora sojae beta-microtubulin gene and use thereof for diagnosing zoxamide resistance |
| EP3205208A1 (en) * | 2016-02-09 | 2017-08-16 | Basf Se | Mixtures and compositions comprising paenibacillus strains or fusaricidins and chemical pesticides |
| CN105861655B (en) * | 2016-04-11 | 2019-03-19 | 中国农业大学 | The method and special primer pair of a kind of Rapid identification soybean phytophthora to dimethomorph drug resistance |
-
2017
- 2017-10-26 CN CN201711014310.9A patent/CN107746894B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107746894A (en) | 2018-03-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102643925B (en) | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof | |
| CN104313175B (en) | LAMP detection primer composition for phytophthora infestans and LAMP detection kit and LAMP detection method of LAMP detection primer composition | |
| CN107299147B (en) | Method for rapidly identifying drug resistance of corynebacterium polyspora to fluopyram and special primer pair | |
| CN109680056A (en) | A kind of kit, detection method and its application detecting MCR gene | |
| CN109486972A (en) | A kind of CPA primer sets for detecting pseudomonas aeruginosa, CPA nucleic acid test strip kit and its application | |
| CN101974651B (en) | Fluorescence quantitative polymerase chain reaction (PCR) detection method and detection kit for phytophthora capsici leonian | |
| Marfell et al. | Global gene expression profiling of monocyte-derived macrophages from red deer (Cervus elaphus) genotypically resistant or susceptible to Mycobacterium avium subspecies paratuberculosis infection | |
| CN102534050B (en) | Triple polymerase chain reaction (PCR) detecting primer group, reagent kit and method for diagnosing grass carp reovirus | |
| CN104946758A (en) | LAMP detection primer set, detection kit and detection method for candida albicans | |
| CN106381340B (en) | Botrytis cinerea LAMP detection primer, detection kit and its application | |
| CN103397085B (en) | Pratylenchus penetrans detection kit and detection method thereof | |
| CN104372099A (en) | LAMP detection primer composition for phytophthotacactorum, as well as LAMP detection kit and LAMP detection method of LAMP detection primer composition | |
| CN107746894B (en) | Method for rapidly identifying nucleotide point mutation of phytophthora sojae β -tubulin gene and resistance of phytophthora sojae β -tubulin gene to ethaboxam | |
| CN106148565A (en) | A kind of Koi herpesvirus CPA detection primer and application | |
| CN104313177B (en) | The molecular detecting method of a kind of Rapid identification the pathogen of Botrytis cinerea to carbendazim resistance gene type F200Y bacterial strain | |
| CN104372092B (en) | The LAMP detection primer composition of a kind of banksia rose phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN103667271B (en) | The primer of detection by quantitative Candida albicans bacterium and probe and application thereof | |
| CN108588266A (en) | The LAMP detection primer composition and its LAMP detection kit and LAMP detection method of a kind of phytophthora hibernalis | |
| CN107828905A (en) | Tobacco smoke pollution LAMP detection primer and detection method | |
| CN105861655B (en) | The method and special primer pair of a kind of Rapid identification soybean phytophthora to dimethomorph drug resistance | |
| CN104561267A (en) | Loop-mediated isothermal amplification reaction primer for detecting streptococcus agalactiae of tilapias | |
| CN111635959A (en) | LAMP primer of Fluoxapiprolin resistance genotype G700V phytophthora capsici and application | |
| CN101875965B (en) | TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) detection of angiostrongylus cantonensis infected snails | |
| CN102851363B (en) | Method and special primers for fast identifying phytophthora capsici leonian resistance to pyrimorph | |
| CN104651493A (en) | Method for quickly identifying point mutation of nucleotide of phytophthora capsici leonian PcORP1 gene and pesticide resistance of mutant phytophthora capsici leonian PcORP1 gene to oxathiapiprolin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |