CN108586608A - A kind of DHAV-1 2C protein polyclone antibodies, recombination fusion protein and preparation method thereof - Google Patents

Abstract

The invention discloses a kind of 1 2C protein polyclone antibodies of DHAV, recombination fusion protein and preparation method thereof, and the amino acid sequence of the immunogene of the 1 2C protein polyclone antibodies of DHAV is as shown in SEQ ID NO.4.The amino acid sequence of the recombination fusion protein is as shown in SEQ ID NO.16.The invention also discloses a kind of 2C mutant, the 151st amino acids on 1 2C albumen of DHAV become amino acid A, 152 amino acids by G and become by K that amino acid A or 151 amino acids become amino acid A by G and 152 amino acids become amino acid A by K, and target spot is provided for the antiviral therapy drug design of DHAV.The 1 2C protein polyclone antibodies of DHAV of the present invention can position distribution of the 2C albumen in cell, and direction is provided to find the metainfective therapy approach of virus.

Description

A kind of DHAV-1 2C protein polyclone antibodies, recombination fusion protein and preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, specifically, it is anti-to be related to a kind of DHAV-12C protein polyclones Body.

Background technology

1 type duck hepatitis A virus (Duck hepatitis A virus type1, DHAV-1) belongs to Picornaviridae Member, 4 week old of main infection duckling below is very harmful to aquaculture.2C albumen is located at the poly egg of DHAV-1 codings The areas Bai P2,2C albumen are one of albumen most conservative in all albumen of picornavirus, only just meeting when virus replication It generates, is the most crucial composition of viral replication complex, and have the affinity of specificity to capsid protein, to picornavirus It is pathogenic to play critically important effect.There are relatively big difference degree in structure for picornavirus its 2C albumen that different virus belongs to Difference, and its concrete function is not still fully aware of.In view of the harm that picornavirus constitutes human and animal, 2C is understood The structure of albumen has a very important significance the prevention of Amphixenosis.But it is had no at present to DHAV-1 2C protein characteristics And the report of functional study.

Invention content

In view of this, the present invention provides a kind of DHAV-1 2C protein polyclone antibodies, recombination fusion protein and its preparations Method.

In order to solve the above-mentioned technical problem, the invention discloses a kind of DHAV-1 2C protein polyclone antibodies, immunogenes Amino acid sequence as shown in SEQ ID NO.4.

The invention also discloses a kind of preparation methods of DHAV-1 2C protein polyclone antibodies, include the following steps：

Step 1 carries out DHAV-1X strain virus RNA extractions and is transcribed into cDNA, with the 2C specific primers of design DHAV-2C-P1 and DHAV-2C-P2 carries out the amplification of 2C segments using the cDNA of DHAV-1 as template；

The 2C segments correctly expanded are connected on pET32a by step 2, successfully build pET32a-2C prokaryotic expression carriers, will PET32a-2C is transferred in Escherichia coli Rossta (DE3), and 2C recombinant proteins are in the form of insoluble property inclusion body after IPTG inductions Expression, and carry out Westernblot identifications；

Step 3, purifying 2C recombinant proteins, the polyclonal of 2C albumen is obtained using 2C recombinant proteins as immunogen immune mouse Antibody, as DHAV-1 2C protein polyclone antibodies, the amino acid sequence such as SEQ ID of the immunogene of the polyclonal antibody Shown in NO.4.

Optionally, it is specially to the progress RNA extractions of DHAV-1X strain virus in the step 1：By DHAV-1X strain virus It is diluted with PBS, 0.22 μm of filtering with microporous membrane, adds dual anti-, dual anti-is mycillin mixed liquor, and 37 DEG C of water-baths act on 30min, connect Kind 0.2ml/ pieces, is incubated after inoculation in 37 DEG C of incubators in the chorioallantoic cavity of 11 age in days duck embryos；Embryo dead in for 24 hours is abandoned, Embryo dead in 24~72h is collected, collects allantoic fluid, -20 DEG C save backup.

Optionally, the nucleotide sequence of 2C the specific primers DHAV-2C-P1 and DHAV-2C-P2 in step 1 are respectively SEQ ID NO.1 and SEQ ID NO.2.

Optionally, the purifying 2C albumen in step 3 is specially：

The Rossta of successful conversion pET-32a-2C is expressed into a large amount of induced expressions of bacterium, lysate is added, thalline is resuspended, surpass Sound is broken, each 1min, totally 3 times, will take precipitation after the good bacterium solution 12000r centrifugations of ultrasound；Precipitation, 8000r are washed with cleaning solution 5min is centrifuged, supernatant is abandoned；Repetition is washed with deionized once, and precipitation is resuspended in Tris-HCl, 12000g centrifugations 10min；Precipitation is resuspended with solubilization of inclusion bodies liquid, and 12000g centrifuges 10min, takes supernatant；Elution buffer contains higher concentration Urea is dialysed with PBS solution and removes urea；Bag filter is cut into suitable size, sets the NaHCO of 10mmol/L₃It is boiled in solution, Distilled water rinses, and is boiled with the EDTA solution of 10mmol/L, during which replaces an EDTA solution, distilled water rinsing；Use bag filter Albumen after purification is handled, dialysis is carried out at 4 DEG C of equilibration buffer until imidazoles completely removes；Dialysis finishes, and protein is sucked out - 20 DEG C of preservations of solution；Obtain destination protein, as antigen.

The invention also discloses a kind of MBP-2C recombination fusion proteins, and amino acid sequence is as shown in SEQ ID NO.16.

The invention also discloses a kind of preparation methods of MBP-2C recombination fusion proteins, include the following steps：By maltose Binding protein (MBP) segment is connected into pET-28a after being added in the ends N ' of 2C sequences and is transferred to Escherichia coli Rossta (DE3), IPTG After induced expression and purification process is carried out, soluble 2C recombination fusion proteins, amino acid sequence such as SEQ ID is prepared Shown in NO.16.

Optionally, the purification process is specially：Ni fillers are fitted into chromatographic column, filler natural subsidence is made；With filtering Distill water washing filler；Filler is balanced with combination buffer；Sample is loaded in pillar, 0.5ml/s；It is washed with combination buffer Wash pillar；The de- albumen combined of imidazole elution buffer Xian of various concentration, is in charge of collection；SDS-PAGE analyzes point of albumen Cloth；Bag filter is cut into suitable size, sets the NaHCO of 10mmol/L₃It is boiled in solution, distilled water rinsing, with 10mmol/L's EDTA solution boils, and during which replaces an EDTA solution, distilled water rinsing；Albumen after purification is handled with bag filter, balance is slow Dialysis is carried out at 4 DEG C of fliud flushing until imidazoles completely removes；Dialysis finishes, and -20 DEG C of preservations of protein solution are sucked out.

The invention also discloses a kind of 2C mutant, the 151st amino acids on DHAV-1 2C albumen become amino by G Sour A, 152 amino acids are become that amino acid A or 151 amino acids become amino acid A by G and 152 amino acids are become by K by K Amino acid A.

Compared with prior art, the present invention can be obtained including following technique effect：

1) DHAV-1 2C can be expressed in Escherichia coli in the form of inclusion body, by holding addition maltose to melt in its N ' Can get soluble expression albumen after hop protein (MBP) label, the albumen that availability table reaches has an enzymatic activity, it is convenient subsequently into The research of row 2C gene functions, the especially research of the biological functions such as enzyme activity, while also the application for 2C zymoproteins provides Preparation method.

2) the DHAV-1 2C protein polyclone antibodies prepared can position distribution of the 2C albumen in cell.DHAV- When 1 2C is individually expressed in DEF cells, it is distributed in nucleus and cytoplasm；But virus infect DEF during, 2C by Initial endochylema distribution is gradually transferred to nucleus and finally all enters core；2C albumen in endochylema can be positioned at endoplasmic reticulum and Gao Er It, can after virus infection body from coming in terms of instantaneous and real-time (or single expression is infected with virus) positioning two on matrix Can after approach, provide direction to find the metainfective therapy approach of virus.

3) the DHAV-12C albumen of soluble prokaryotic expression have NTP enzymatic activitys, the 151st of 2C albumen and the 152nd Amino acid is to influence the key amino acid site of enzyme activity, and then play the part of the angle of enzyme activity in entire virus replication for research 2C Color provides foundation, also provides target spot for the antiviral therapy drug design of DHAV.

Certainly, it implements any of the products of the present invention it is not absolutely required to while reaching all the above technique effect.

Description of the drawings

Attached drawing described herein is used to provide further understanding of the present invention, and constitutes the part of the present invention, this hair Bright illustrative embodiments and their description are not constituted improper limitations of the present invention for explaining the present invention.In the accompanying drawings：

Fig. 1 is the PCR amplification result of DHAV-1 2C of the present invention；Wherein, M：DL2000DNA Marker；1：DHAV-1 2C Pcr amplified fragment；

Fig. 2 is pMD19-T clone's double digestion qualification results of 2C of the present invention；Wherein, M:DL2000DNA Marker；1: The EcoR I/SalI double digestion products of pMD19-2C；

Fig. 3 is recombinant plasmid pET32a-2C digestions identification of the present invention；Wherein, M:DL15000DNA Marker；1：Recombination Plasmid pET32a-2C is identified by EcoR I/SalI double digestions；

Fig. 4 is the expression condition optimization of prokaryotic expression 2C recombinant proteins of the present invention；Wherein, A:Temperature optimization, M:Albumen Marker；1:PET32a induced expression products；2-4:PET32a-2C is in 25 DEG C, 30 DEG C and 37 DEG C expression products.B:Time is excellent Change, M:Albumen Marker；1:PET32a zero load induced expression products；2-8:PET32a-2C in 0h, 2h, 4h, 6h, 8h, 10h and Expression product overnight.C:IPTG concentration optimizations, M:Albumen Marker；1:PET32a induced expression products；2-6:PET32a-2C exists 0mmol/L, 0.3mmol/L, 0.5mmol/L, 0.8mmol/L and 1.0mmol/L IPTG induced expression products；

Fig. 5 is the soluble analysis of prokaryotic expression 2C recombinant proteins of the present invention；Wherein, A:Supernatant after ultrasonication processing； B:Ultrasonication treated precipitation.M:Albumen Marker；1:PET32a induced expression products；2-7:0h, 2h, 4h, 6h, 8h and 10h expression products；

Fig. 6 is 2C recombinant proteins western blot figure of the present invention；Wherein, M：Albumen Marker；1：2C after purification recombinates egg In vain；2：Unpurified 2C recombinant proteins；3：The product of pET32a expression；

Fig. 7 is 2C recombinant protein purifications result of the present invention；Wherein, M：Albumen Marker；1：2C recombinant proteins after purification；

Fig. 8 is recombinant plasmid pEGFP-C2-2C digestions identification of the present invention；Wherein, M：DL15000DNA Marker；1：Weight Group plasmid pEGFP-C2-2C is identified by EcoR I/SalI double digestions；

Fig. 9 is pEGFP-C2-2C protein immunoblots figure of the present invention；Wherein, M：Albumen Marker；1：Transfect DEF expression PEGFP-C2-2C albumen；2：The pEGFP-C2 for transfecting DEF expression is unloaded；

Figure 10 is that the caryoplasm under the indirect immunofluorescene assay eukaryon transfection of the anti-2C protein polyclone antibodies of mouse of the present invention is fixed Position；Wherein, a row is the cell controls for transfecting pEGFP-C2 zero loads above；A row is after transfecting pEGFP-C2-2C for 24 hours below Receive sample, the 2C albumen positioning scenarios observed under laser confocal microscope；It is followed successively by from left to right, 1：Core contaminates；2：pEGFP- Fluorescence microscope after C2/pEGFP-C2-2C transfected fibroblasts；3：The anti-2C albumen serum indirect immunofluorescence inspection of mouse The 2C albumen measured；4：MERGE schemes；

Figure 11 is the metainfective 2C albumen of the anti-2C albumen serum indirect immunofluorescene assay DHAV-1 of mouse of the present invention；Wherein, It is that sample is received after 0h, 2h, 4h, 6h, 10h and 20h successively from up to down, the 2C albumen observed under laser confocal microscope Positioning scenarios；Each time point is followed successively by from left to right：Core contaminates；The 2C eggs that the anti-2C albumen serum indirect immunofluorescene assay of mouse arrives In vain；MERGE schemes；

Figure 12 is the common location of mouse of the present invention anti-2C albumen serum indirect immunofluorescene assay 2C albumen and golgiosome；Its In, above a row be normal cell controls；A row receives sample after being infection DHAV-14h below, is observed under laser confocal microscope The common location situation of the 2C albumen and golgiosome that arrive；It is followed successively by from left to right：Core contaminates；Rabbit-anti Anti- β COP detect for primary antibody The golgiosome arrived；The 2C albumen that the anti-2C albumen serum of mouse detects；MERGE schemes；

Figure 13 is the common location of mouse of the present invention anti-2C albumen serum indirect immunofluorescene assay 2C albumen and endoplasmic reticulum；Its In, above a row be normal cell controls；A row receives sample after being infection DHAV-14h below, is observed under laser confocal microscope The common location situation of the 2C albumen and endoplasmic reticulum that arrive；It is sequentially followed successively by from left to right：Core contaminates；Rabbit-anti Anti-ERp57 examines for primary antibody Survey endoplasmic reticulum；The 2C albumen that the anti-2C albumen serum of mouse detects；MERGE schemes；

Figure 14 is MBP PCR amplifications result of the present invention, wherein M：DL2000DNA Marker；1：MBP segments；

Figure 15 is the PCR amplification result of 2C NTP enzyme activity critical sites rite-directed mutagenesis segment of the present invention, wherein M： DL4000DNA Marker；1：G151A-F1 segments；2：G151A-R1；3：K152A-F2 segments；4：K152A-R2 segments；5： GK151AA-F3 segments；6：GK151AA-R3 segments；

Figure 16 is the amplification of 2C mutant strains segment of the present invention；Wherein, M：DL2000DNA Marker；1：G151A pieces Section；2：K152A segments；3：GK151AA segments；

Figure 17 is MBP-2C PCR amplifications result of the present invention；Wherein, M：DL4000DNA Marker；1：MBP-2C segments； 2：MBP-2C (G151A) segment；3：MBP-2C (K152A) segment；4：MBP-2C (GK151AA) segment；

Figure 18 is the subclone double digestion qualification result of MBP-2C and its mutant fragments of the present invention；Wherein, M： DL15000DNA Marker；1：The BamH I/SalI double digestion products of pET28a/MBP-2C；2：pET28a/MBP-2C (G151A) BamHI/SalI double digestion products；3：The BamH I/SalI double digestion products of pET28a/MBP-2C (K152A)； 4：The BamH I/SalI double digestion products of pET28a/MBP-2C (GK151AA)；

Figure 19 is pET28a/MBP-2C and its mutant of the present invention in Rosseta (DE3) protein expression result；Wherein, M： Albumen Marker；1：PET28a is unloaded；2：PET28a/MBP-2C albumen；3：PET28a/MBP-2C (G151A) albumen；4： PET28a/MBP-2C (K152A) albumen；5：pET28a/MBP-2C(GK151AA)；

Figure 20 is Westernblot identifications of the present invention, wherein M：Albumen Marker；1：MBP-2C albumen；2：MBP-2C (G151A) albumen；3：MBP-2C (K152A) albumen；4：MBP-2C (GK151A) albumen；5：The product of pET28a expression；

Figure 21 is protein purification result of the present invention, wherein M：Albumen Marker；1：MBP-2C albumen；2：MBP-2C (G151A) albumen；3：MBP-2C (K152A) albumen；4：MBP-2C (GK151A) albumen；

Figure 22 is phosphate standard curves figure of the present invention；

Figure 23, which is 2C albumen of the present invention, has NTP enzymatic activitys, wherein A：It is detected every 10min as substrate using ATP enzyme Pi values；B：The Pi values detected under different NTP and dNTP zymolytes；

Figure 24 is difference Mg of the invention²⁺Concentration is on the active influences of ATPase；

Figure 25 is present invention difference PH on the active influences of ATPase；Wherein, using ATP enzyme as substrate, in different pH gradients Under the Pi contents that detect, when pH is 8, ATPase activity highests；

Figure 26 is different concentration of guanidine hydrochloride of the invention on the active influences of ATPase；Wherein, using ATP enzyme as substrate, not With the Pi contents detected under GnHCl concentration；

Figure 27 is difference NTP enzyme activity critical sites point mutation of the invention on the active influences of ATPase；Wherein, with ATP enzyme For substrate, the Pi contents detected after different NTP enzyme activity critical sites point mutation.

Specific implementation mode

Carry out the embodiment that the present invention will be described in detail below in conjunction with embodiment, thereby to the present invention how application technology hand Section solves technical problem and reaches the realization process of technical effect to fully understand and implement.

Material used in the present invention is as follows：

Strong X plants of the poison of I type duck hepatitis A virus (DHAV-1), DH5 α, Rosseta (DE3), pET-32a carriers, pEGFP-C2 are carried Body, pET-28a carriers, pMAL-C2X carriers are preserved by Sichuan Agricultural University's poultry diease research center, and the 9 of no DHAV maternal antibodies Age in days duck embryos (Ya'an Sichuan province duck).

The expression of embodiment 1DHAV-1 2C albumen, the preparation of polyclonal antibody and subcellular localization detection

1, DHAV-1 2C subcellular localizations are predicted

(http is predicted to the subcellular localization of 2C using subcellular localization software Pro tComp 9.0:// linux1.softberry.com/berry.phtmlTopic=protcompan＆group=programs＆su bgroup =proloc) it finds, 2C albumen may be located in the organelles such as golgiosome, endoplasmic reticulum.

2, the PCR amplification of 2C genes and T clones

2.1, according to DHAV-1X strain whole genome sequence (the GenBank accession number logged in GenBank in NCBI： JQ316452.1), by 5 design primers of biological software Primer Premier, the two digestion positions EcoRI and SalI are introduced Point (shown in underscore), design of primers is as follows：

DHAV-2C-P1：5'GAATTCGAGGATCAATCTGGCAAAAC 3', nucleotide sequence such as SEQ ID NO.1 It is shown；

DHAV-2C-P2：5'GTCGACCTACTTAGACTGGTTCATAAAGGA3', nucleotide sequence such as SEQ ID Shown in NO.2；

DHAV-1X strain virus is diluted, 0.22 μm of filtering with microporous membrane with PBS, is added dual anti-(mycillin mixed liquor), 37 DEG C water-bath acts on 30min, is inoculated in the chorioallantoic cavity of 11 age in days duck embryos, 0.2ml/ pieces, is incubated in 37 DEG C of incubators after inoculation It educates.Embryo dead in for 24 hours is abandoned, embryo dead in 24~72h is collected, collects allantoic fluid, -20 DEG C save backup.Then RNA is carried out Extraction and be transcribed into cDNA, be with the cDNA of DHAV-1 with the 2C specific primer DHAV-2C-P1 and DHAV-2C-P2 of design Template carries out the amplification of 2C segments, and the target fragment length for obtaining meeting expected size is 999bp (Fig. 1).

Wherein, PCR amplification system：By 25 μ l of PCR Master Mix, 2 μ l of template cDNA, 0.5 μ l of sense primer, under Swim primer 0.5 μ l, ddH₂22 μ l of O are uniformly mixed in PCR reaction tubes.Reaction condition is：94 DEG C of 4min, (94 DEG C of 30s, 55 DEG C 30s, 72 DEG C of 1min) 30 cycles, 72 DEG C of 10min.

2.2, the T clone identifications of 2C genes

The 2C segments expanded from DHAV-1 are connected to pMD19-T and obtain pMD19-2C, after PCR and double digestion identification The purpose band for meeting expected size is obtained, carrier T size is 2692bp, and the length of 2C genes is 999bp (Fig. 2).

Wherein, linked system is：Buffer 1 μ l, T₄1 μ l of ligase, 4.5 μ l, pMD19-T 1.5 of target gene fragment μ l, ddH₂O 2μl.Reaction volume is 10 μ l, and 16 DEG C of connections are overnight.

3, the prokaryotic expression of 2C albumen

3.1, the structure of prokaryotic expression carrier pET32a-2C

Correct pMD19-2C plasmids and pET32a empty carriers will be sequenced and use restriction enzyme EcoRI and Sal I respectively Double digestion, recycling, connection are carried out, prokaryotic expression carrier pET32a-2C is obtained, is obtained after PCR and digestion identification expected big Small band, after double digestion, pET32a sizes are 5900bp, and 2C sizes are about 1kb (Fig. 3), show 2C in combination with sequencing result It is successively inserted into pET32a carriers.

3.2, the expression of 2C albumen

A.2C the condition optimizing of recombinant protein expression

PET32a-2C is transferred in Roseeta (DE3), successful expression goes out the recombinant protein of about 55kDa sizes, core Nucleotide sequence is as shown in SEQ ID NO.3, and amino acid sequence is as shown in SEQ ID NO.4.After optimum induction, when A concentration of 0.5mmol/L of IPTG, when 37 DEG C of overnight inductions, recombinant protein expression quantity highest (Fig. 4).

B.2C the soluble analysis of recombinant protein expression

Using the solubility of optimum inductive condition analysis 2C recombinant proteins expression, find in the nearly no purpose band of supernatant Mainly there is (Fig. 5 B) in the form of inclusion body in (Fig. 5 A).

3.3, the Western blot identifications of 2C recombinant proteins

Primarily determine pET32a-2C recombinant proteins expression after, with histidine tag antibody to pET32a-2C recombinant proteins into The Western blot that gone are detected, while pET32a zero loads are arranged and compare, and have obtained the purpose for meeting expected size about 55kDa Band is determined as required recombinant protein (Fig. 6).

3.4, the purifying of 2C recombinant proteins

(1) it purifies

A. the acquisition of inclusion body：The Rossta of successful conversion pET32a-2C is expressed into a large amount of induced expressions of bacterium, cracking is added Thalline, ultrasonication is resuspended in liquid, and each 1min totally 3 times, will take precipitation after the good bacterium solution 12000r centrifugations of ultrasound；

B. the elution and dissolving of inclusion body：Precipitation is washed with cleaning solution, 8000r centrifuges 5min, abandons supernatant.Repetition spend from Sub- water washing is primary, and precipitation is resuspended in Tris-HCl, and 12000g centrifuges 10min.Precipitation is resuspended with solubilization of inclusion bodies liquid, 12000g centrifuges 10min, takes supernatant；

C. elution buffer contains the urea of higher concentration, is dialysed with PBS solution and removes urea；

(2) dialysis and protein concentrate

A. the processing of bag filter:Bag filter is cut into suitable size, sets the NaHCO of 10mmol/L₃It boils, distills in solution Water rinses, and is boiled with the EDTA solution of 10mmol/L, during which replaces an EDTA solution, distilled water rinsing；

B. albumen after purification is handled with bag filter, carries out dialysis at 4 DEG C of equilibration buffer until imidazoles completely removes；

C. dialysis finishes, and -20 DEG C of preservations of protein solution are sucked out.

Finally use gel extraction way of purification, obtain purity, concentration it is higher and meet the destination protein of size (figure 7)。

4, the preparation of the anti-2C albumen serum of mouse

(1) immune programme (table 1)

Immune programme prepared by the anti-2C albumen serum of 1 mouse of table

(2) acquisition and preservation of serum

Blood is collected using eyeball blood sampling and is placed in 2h or so at 37 DEG C, is conducive to the precipitation of serum, after solidification at 4 DEG C overnight 5000r centrifuges 10min.Serum is sucked out, sets -20 DEG C of preservations.

5, the structure of carrier for expression of eukaryon pEGFP-C2-2C

Correct pMD19-2C plasmids and pEGFP-C2 empty carriers will be sequenced and use restriction enzyme EcoRI and Sal respectively I carries out double digestion, recycling, connection, and the recombinant of acquisition obtains the band of expected size, double enzymes after PCR and digestion identification After cutting identification, pEGFP-C2 sizes are 4700bp, and the size of 2C is about 999bp (Fig. 8), shows 2C just in combination with sequencing result It is really inserted into pEGFP-C2 carriers, successfully constructs carrier for expression of eukaryon pEGFP-C2-2C.

6, the Western blot identifications of eukaryotic expression albumen

Since recombinant protein pEGFP-C2-2C expression quantity is too low, purpose band can not be observed directly using SDS-PAGE, Western blot have been carried out using the how anti-2C serum of mouse to detect, while pEGFP-C2 zero loads are set and are compared, and have been met It is expected that the purpose band of size about 58kDa, is determined as required albumen (Fig. 9).

7, the positioning scenarios of 2C albumen during transiently transfecting

The pEGFP-C2-2C of structure is transferred in duck embryo fibroblasts, and it is negative control that pEGFP-C2 zero loads, which are arranged, Receive sample afterwards for 24 hours, observation discovery 2C albumen is distributed (Figure 10) in caryoplasm under laser confocal microscope.

8, duck embryo fibroblasts infect the subcellular localization of 2C albumen after DHAV-1

8.1, the caryoplasm of 2C albumen positions after duck embryo fibroblasts infection DHAV-1

After duck embryo fibroblasts infect DHAV-1, examined by primary antibody of the anti-2C serum of mouse after receiving sample in different time points respectively Positioning of the 2C albumen measured in duck embryo fibroblasts, under laser confocal microscope observation find 2C albumen before 4h It is distributed in packet slurry, starts to occur after 6h, into nuclear phenomenon, nucleus to be completely introduced into after 20h, and not with the extension of time Go out core (Figure 11) again.

8.2, positioning of the 2C albumen in golgiosome after duck embryo fibroblasts infection DHAV-1

Sample is received after duck embryo fibroblasts infection DHAV-14h, and 2C albumen and Gorky are observed under laser confocal microscope The common location of body, while it is control group that setting, which does not connect poison, and it is fixed altogether to detect that 2C and golgiosome may have occurred after meeting malicious 4h Position (Figure 12).

8.3, positioning of the 2C albumen in endoplasmic reticulum after duck embryo fibroblasts infection DHAV-1

Sample is received after duck embryo fibroblasts infection DHAV-14h, and 2C albumen and endoplasmic reticulum are observed under laser confocal microscope Common location, while setting do not connect poison be control group, detect 2C and endoplasmic reticulum may have occurred after meeting malicious 4h common location (figure 13)

The NTP enzymatic activitys and enzymatic activity critical sites of embodiment 2DHAV-1 2C

1,2C amino acid alignments

2C sequences are subjected to Multiple Sequence Alignment discovery with the member of other Picornaviridaes, it is similar to there is same unwindase man Enzyme activity motif, respectively A (GX2GXGKS), B (QX5DD) and C (KX13N) show that the function of 2C genes may be small with other RNA virus 2C sequences equally have NTP enzyme activity and helicase activity, and the 151st and the 152nd amino acids " G in DHAV-12C (glycine) K (lysine) " is the critical sites of NTP enzyme activity.

2, the amplification of MBP-2C and its mutant strain segment

2.1, the PCR amplification of MBP segments is using carrier pMAL-C2X as template, with the specific primer MBP-P1 of design and MBP segments are expanded to come from carrier by MBP-P2 (as shown in table 2), obtain the purpose band 1101bp (figures for meeting expected size 14)。

The primer sequence of 2 MBP and 2C genes of table

Note：MBP-P1：MBP sense primers；MBP-P2：MBP downstream primers；DHAV-2C-P1’：2C sense primers；DHAV- 2C-P2’：2C downstream primers；F1/G：151st glycine mutation is alanine, sense primer；R1/G：151st glycine Sport alanine, downstream primer；F2/K：152nd lysine mutation is alanine, sense primer；R2/K：152nd relies Histidine mutations are alanine, downstream primer；F3/GK：151st and the 152nd lysine sport alanine, and upstream is drawn Object；R3/GK：151st glycine and the 152nd lysine sport alanine, downstream primer.

2.2, the PCR amplification of 2C genes NTP enzyme activity critical sites mutant fragments

(1) it is cloned as template with the T of 2C, with the F1/G and R1/G, F2/K and R2/K, F3/GK and R3/GK primers of specificity Critical sites mutant fragments are amplified, expected size (Figure 15) is met.

(2) segment that (1) amplifies is amplified to the 2C mutant strain segments for meeting size, size in the method for over-lap PCR For 999bp (Figure 16)

(3) MBP segments and 2C segments and its mutant fragments that step 2.1 amplification obtains are utilized to the method weight of over-lap PCR Poststack obtains the target fragment for meeting size, is named as MBP-2C and its mutant fragments, about 2100bp (Figure 17).

3, the prokaryotic expression of MBP-2C and its point mutation albumen

3.1, the subclone of MBP-2C and its point mutation body is identified

MBP-2C segments and its point mutation segment are cloned into pET28a carriers, obtained after PCR and digestion identification pre- Phase size strip, in double digestion identification, pET28a sizes are 5369bp, and the size of MBP-2C and its mutant fragments is about 2100bp (Figure 18) shows that MBP-2C and its point mutation segment are correctly inserted into pET28a carriers in combination with sequencing result.

3.2, the expression of MBP-2C and its point mutation albumen

PET28a/MBP-2C and its point mutation recombinant plasmid are transformed into respectively in host strain Rosseta (DE3), induced Condition is 30 DEG C, 0.6mmol/L IPTG, overnight induction, and expressing quantity is maximum, while pET28a is arranged and compares.Albumen exists It is the albumen (Figure 19) needed for enzyme activity research to have great expression, the albumen of supernatant expression in inclusion body and supernatant.

3.3, the Western blot identifications of MBP-2C and its point mutation albumen

After primarily determining pET28a/MBP-2C and its point mutation protein expression, using histidine tag antibody to pET28a/ MBP-2C and its point mutation albumen have carried out Western blot detections, while pET28a zero loads are arranged and compare, and are accorded with The purpose band for closing expected size about 80kDa, is determined as required albumen (Figure 20).

The purifying of 3.4MBP-2C and its point mutation albumen

After Westernblot identifications are correct, the purifying to MBP-2C and its point mutation albumen is for NTP enzyme activity functions Research, thus it is higher to the structural requirement of albumen, by the way of shear protein adhesive the albumen being purified into can such as lost and lives Property.The MBP-2C of the present invention and its purification process of point mutation albumen are as follows：

(1) it purifies

A. Ni fillers are fitted into chromatographic column, make filler natural subsidence；B. used filtration distilled water washs filler；C. with combination Buffer solution balances filler；D. sample is loaded in pillar, 0.5ml/s；E. pillar is washed with combination buffer；F. various concentration The de- albumen combined of imidazole elution buffer Xian, be in charge of collection；G.SDS-PAGE analyzes the distribution of albumen.

(2) dialysis and protein concentrate

A. the processing of bag filter:Bag filter is cut into suitable size, sets the NaHCO of 10mmol/L₃It boils, distills in solution Water rinses, and is boiled with the EDTA solution of 10mmol/L, during which replaces an EDTA solution, distilled water rinsing；B. at bag filter Albumen after purification is managed, dialysis is carried out at 4 DEG C of equilibration buffer until imidazoles completely removes；C. dialysis finishes, and protein is sucked out - 20 DEG C of preservations of solution.

The present invention is come out Protein Separation using histidine tag using above-mentioned Ni column purifications mode, has obtained meeting purpose Size and single band, about 80kDa (MBP label 40kDa+2C protein 37 kDa), are shown in Figure 21, nucleotide sequence such as SEQ Shown in ID NO.15, amino acid sequence is as shown in SEQ ID NO.16.

The NTP Enzyme assays of embodiment 3MBP-2C albumen

1, the drafting of phosphate standard curves

Phosphate standard curves figure is delineated according to the specification of phosphoric acid detection kit, as shown in figure 22.

2,2C albumen has NTP enzyme activity

It is lived using phosphoric acid detection kit detection ATP enzyme, maximum phosphoric acid value (Figure 23 A) is measured when being coated with 90min, subsequently Experiment makees condition with this.After measuring ATP enzyme and living, it is substrate to be coated in addition several NTP and dNTP enzymes, and enzyme activity efficiency is dATP >dGTP>dCTP>dTTP>ATP>GTP>UTP>CTP, 2C albumen are higher than NTP (Figure 23 B) to the hydrolysis efficiency of dNTP enzymes.

3, difference Mg²⁺Concentration is on the active influences of ATPase

ATPase chelatings Mg²⁺It plays an important role in NTP enzyme activity, detects Mg first²⁺To the influence that ATP enzyme is lived, ATP enzyme It lives by Mg²⁺The regulation and control of concentration, and rely on Mg²⁺Enzyme activity function is played, enzyme activity reaches highest (Figure 24) in 2.5mM.

4, different pH value are on the active influences of ATPase

Provided with different pH gradients on the active influences of ATPase, when pH is 8, ATPase activity highest (Figure 25).

5, guanidine hydrochloride is on the active influences of ATPase

Provided with the active situations of change of ATPase under different concentration of guanidine hydrochloride, ATPase enzyme activity is several under the concentration of 50mM It loses (Figure 26).

5, influence of the mutation to enzyme activity

The critical sites " GK " of ATPase enzyme activity are mutated, three mutant strains have been done in this experiment, independent mutating acid " G ", " K " and simultaneous mutation amino acid " GK ".F1 mutating acid " G " is " A "；F2 mutating acid " K " is " A "；F3 is prominent Become amino acid " GK " as " AA ".It was found that mutating acid " G " makes ATPase enzyme activity increase rather than reduce, mutating acid " K " and mutating acid " GK " can make ATPase enzyme activity reduce (Figure 27).

Above description has shown and described several preferred embodiments of invention, but as previously described, it should be understood that invention is not It is confined to form disclosed herein, is not to be taken as excluding other embodiments, and can be used for various other combinations, modification And environment, and can be carried out by the above teachings or related fields of technology or knowledge in the scope of the invention is set forth herein Change.And changes and modifications made by those skilled in the art do not depart from the spirit and scope of invention, then should all be weighed appended by invention In the protection domain that profit requires.

Sequence table

<110>Sichuan Agricultural University

<120>A kind of DHAV-1 2C protein polyclone antibodies, recombination fusion protein and preparation method thereof

<130> 2018

<141> 2018-04-13

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 1

gaattcgagg atcaatctgg caaaac 26

<210> 2

<211> 30

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 2

gtcgacctac ttagactggt tcataaagga 30

<210> 3

<211> 1518

<212> DNA

<213>1 type duck hepatitis A virus (Duck hepatitis A virus type1)

<400> 3

atgagcgata aaattattca cctgactgac gacagttttg acacggatgt actcaaagcg 60

gacggggcga tcctcgtcga tttctgggca gagtggtgcg gtccgtgcaa aatgatcgcc 120

ccgattctgg atgaaatcgc tgacgaatat cagggcaaac tgaccgttgc aaaactgaac 180

atcgatcaaa accctggcac tgcgccgaaa tatggcatcc gtggtatccc gactctgctg 240

ctgttcaaaa acggtgaagt ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg 300

aaagagttcc tcgacgctaa cctggccggt tctggttctg gccatatgca ccatcatcat 360

catcattctt ctggtctggt gccacgcggt tctggtatga aagaaaccgc tgctgctaaa 420

ttcgaacgcc agcacatgga cagcccagat ctgggtaccg acgacgacga caaggccatg 480

gctgatatcg gatccgaatt cgaggatcaa tctggcaaaa ccacctctcc taaatctttt 540

aatgattgga caacctgtgc caaaaatgta caatggtggc ttgaatcatt tgtcaaagtt 600

gtaaattggc ttaaagaaaa aatatttcct tcaaaaactg acccaactct tcagtggctc 660

caggaccacg aagaacatat agctatcatg ttggcattgt gtgatgagca cctttgtatg 720

ctaagaactg aaaaagatta catttgtgag cacaatactc gcccaaaaca tcagtgtttg 780

gttgaaatgg tctctggcac attgaaccaa ctccaaggta tttcaagtgc tcgtgaattg 840

gcagctagac tacagcatgt gttgaacaaa ctccaccaag tcaattttga gcctgaactg 900

gagtggacac accgtcctga acctcttggt atatggatat ctggtggccc tggtgttggg 960

aagagctttt tatcaaatta cattgttaaa gaaatagcca aattaaagca ttggaagagt 1020

tatgccaacc caactgggag taagcatatg gatgggtatg tgtcacagga gattcatgtt 1080

tttgatgatt ttggtcaaaa tcgggaagag gaagactatt ctttaatttg taaccttatt 1140

tctagtgttc cattcattac tccaaaggca agtgtagagg ccaagggcac ccagtacagg 1200

ggacgccttg ttgttgtcac aaccaataga cgggatttca cttcttgcaa gttgactgac 1260

ccagatgcat tggaaaggcg tttccctatt cgccttaata ttcggccatt gcaaaaatat 1320

aaccacaagg gccgtttgga tgtggcaaca gctatgagag atggaagctt gcagggagga 1380

gcttgctggg aaagggatat aggccaatta ggccttgaat gttggaatcc tataaatggc 1440

caaaccctga ttgatgaaat tatgagtgag ttgcaggtta ggcaagaagt agcttccttt 1500

atgaaccagt ctaagtag 1518

<210> 4

<211> 505

<212> PRT

<213>1 type duck hepatitis A virus (Duck hepatitis A virus type1)

<400> 4

Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp

1 5 10 15

Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp Phe Trp Ala Glu Trp

20 25 30

Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu Ile Ala Asp

35 40 45

Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gln Asn

50 55 60

Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly Ile Pro Thr Leu Leu

65 70 75 80

Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val Gly Ala Leu Ser

85 90 95

Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser Gly

100 105 110

Ser Gly His Met His His His His His His Ser Ser Gly Leu Val Pro

115 120 125

Arg Gly Ser Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln

130 135 140

His Met Asp Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met

145 150 155 160

Ala Asp Ile Gly Ser Glu Phe Glu Asp Gln Ser Gly Lys Thr Thr Ser

165 170 175

Pro Lys Ser Phe Asn Asp Trp Thr Thr Cys Ala Lys Asn Val Gln Trp

180 185 190

Trp Leu Glu Ser Phe Val Lys Val Val Asn Trp Leu Lys Glu Lys Ile

195 200 205

Phe Pro Ser Lys Thr Asp Pro Thr Leu Gln Trp Leu Gln Asp His Glu

210 215 220

Glu His Ile Ala Ile Met Leu Ala Leu Cys Asp Glu His Leu Cys Met

225 230 235 240

Leu Arg Thr Glu Lys Asp Tyr Ile Cys Glu His Asn Thr Arg Pro Lys

245 250 255

His Gln Cys Leu Val Glu Met Val Ser Gly Thr Leu Asn Gln Leu Gln

260 265 270

Gly Ile Ser Ser Ala Arg Glu Leu Ala Ala Arg Leu Gln His Val Leu

275 280 285

Asn Lys Leu His Gln Val Asn Phe Glu Pro Glu Leu Glu Trp Thr His

290 295 300

Arg Pro Glu Pro Leu Gly Ile Trp Ile Ser Gly Gly Pro Gly Val Gly

305 310 315 320

Lys Ser Phe Leu Ser Asn Tyr Ile Val Lys Glu Ile Ala Lys Leu Lys

325 330 335

His Trp Lys Ser Tyr Ala Asn Pro Thr Gly Ser Lys His Met Asp Gly

340 345 350

Tyr Val Ser Gln Glu Ile His Val Phe Asp Asp Phe Gly Gln Asn Arg

355 360 365

Glu Glu Glu Asp Tyr Ser Leu Ile Cys Asn Leu Ile Ser Ser Val Pro

370 375 380

Phe Ile Thr Pro Lys Ala Ser Val Glu Ala Lys Gly Thr Gln Tyr Arg

385 390 395 400

Gly Arg Leu Val Val Val Thr Thr Asn Arg Arg Asp Phe Thr Ser Cys

405 410 415

Lys Leu Thr Asp Pro Asp Ala Leu Glu Arg Arg Phe Pro Ile Arg Leu

420 425 430

Asn Ile Arg Pro Leu Gln Lys Tyr Asn His Lys Gly Arg Leu Asp Val

435 440 445

Ala Thr Ala Met Arg Asp Gly Ser Leu Gln Gly Gly Ala Cys Trp Glu

450 455 460

Arg Asp Ile Gly Gln Leu Gly Leu Glu Cys Trp Asn Pro Ile Asn Gly

465 470 475 480

Gln Thr Leu Ile Asp Glu Ile Met Ser Glu Leu Gln Val Arg Gln Glu

485 490 495

Val Ala Ser Phe Met Asn Gln Ser Lys

500 505

<210> 5

<211> 51

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 5

cgcggatccc atcaccatca ccatcacatg aaaatcgaag aaggtaaact g 51

<210> 6

<211> 55

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 6

gccagattga tcctcgccct gaaaatacag gttttcatta gtctgcgcgt ctttc 55

<210> 7

<211> 35

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 7

ctgtattttc agggcgagga tcaatctggc aaaac 35

<210> 8

<211> 34

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 8

acgcgtcgac ctacttagac tggttcataa agga 34

<210> 9

<211> 27

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 9

ccctggtgtt gcaaagagct ttttatc 27

<210> 10

<211> 24

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 10

agctctttgc aacaccaggg ccac 24

<210> 11

<211> 27

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 11

ccctggtgtt ggggcgagct ttttatc 27

<210> 12

<211> 24

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 12

agctcgcccc aacaccaggg ccac 24

<210> 13

<211> 27

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 13

ccctggtgtt gcagcgagct ttttatc 27

<210> 14

<211> 24

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 14

agctcgctgc aacaccaggg ccac 24

<210> 15

<211> 2241

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 15

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atggctagca tgactggtgg acagcaaatg ggtcgcggat ccgccaccat ggaccatcac 120

catcaccatc acatgaaaat cgaagaaggt aaactggtaa tctggattaa cggcgataaa 180

ggctataacg gtctcgctga agtcggtaag aaattcgaga aagataccgg aattaaagtc 240

accgttgagc atccggataa actggaagag aaattcccac aggttgcggc aactggcgat 300

ggccctgaca ttatcttctg ggcacacgac cgctttggtg gctacgctca atctggcctg 360

ttggctgaaa tcaccccgga caaagcgttc caggacaagc tgtatccgtt tacctgggat 420

gccgtacgtt acaacggcaa gctgattgct tacccgatcg ctgttgaagc gttatcgctg 480

atttataaca aagatctgct gccgaacccg ccaaaaacct gggaagagat cccggcgctg 540

gataaagaac tgaaagcgaa aggtaagagc gcgctgatgt tcaacctgca agaaccgtac 600

ttcacctggc cgctgattgc tgctgacggg ggttatgcgt tcaagtatga aaacggcaag 660

tacgacatta aagacgtggg cgtggataac gctggcgcga aagcgggtct gaccttcctg 720

gttgacctga ttaaaaacaa acacatgaat gcagacaccg attactccat cgcagaagct 780

gcctttaata aaggcgaaac agcgatgacc atcaacggcc cgtgggcatg gtccaacatc 840

gacaccagca aagtgaatta tggtgtaacg gtactgccga ccttcaaggg tcaaccatcc 900

aaaccgttcg ttggcgtgct gagcgcaggt attaacgccg ccagtccgaa caaagagctg 960

gcaaaagagt tcctcgaaaa ctatctgctg actgatgaag gtctggaagc ggttaataaa 1020

gacaaaccgc tgggtgccgt agcgctgaag tcttacgagg aagagttggc gaaagatcca 1080

cgtattgccg ccactatgga aaacgcccag aaaggtgaaa tcatgccgaa catcccgcag 1140

atgtccgctt tctggtatgc cgtgcgtact gcggtgatca acgccgccag cggtcgtcag 1200

actgtcgatg aagccctgaa agacgcgcag acttctggca aaaccacctc tcctaaatct 1260

tttaatgatt ggacaacctg tgccaaaaat gtacaatggt ggcttgaatc atttgtcaaa 1320

gttgtaaatt ggcttaaaga aaaaatattt ccttcaaaaa ctgacccaac tcttcagtgg 1380

ctccaggacc acgaagaaca tatagctatc atgttggcat tgtgtgatga gcacctttgt 1440

atgctaagaa ctgaaaaaga ttacatttgt gagcacaata ctcgcccaaa acatcagtgt 1500

ttggttgaaa tggtctctgg cacattgaac caactccaag gtatttcaag tgctcgtgaa 1560

ttggcagcta gactacagca tgtgttgaac aaactccacc aagtcaattt tgagcctgaa 1620

ctggagtgga cacaccgtcc tgaacctctt ggtatatgga tatctggtgg ccctggtgtt 1680

gggaagagct ttttatcaaa ttacattgtt aaagaaatag ccaaattaaa gcattggaag 1740

agttatgcca acccaactgg gagtaagcat atggatgggt atgtgtcaca ggagattcat 1800

gtttttgatg attttggtca aaatcgggaa gaggaagact attctttaat ttgtaacctt 1860

atttctagtg ttccattcat tactccaaag gcaagtgtag aggccaaggg cacccagtac 1920

aggggacgcc ttgttgttgt cacaaccaat agacgggatt tcacttcttg caagttgact 1980

gacccagatg cattggaaag gcgtttccct attcgcctta atattcggcc attgcaaaaa 2040

tataaccaca agggccgttt ggatgtggca acagctatga gagatggaag cttgcaggga 2100

ggagcttgct gggaaaggga tataggccaa ttaggccttg aatgttggaa tcctataaat 2160

ggccaaaccc tgattgatga aattatgagt gagttgcagg ttaggcaaga agtagcttcc 2220

tttatgaacc agtctaagta g 2241

<210> 16

<211> 746

<212> PRT

<213>Artificial sequence (Artificial sequence)

<400> 16

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg

20 25 30

Gly Ser Ala Thr Met Asp His His His His His His Met Lys Ile Glu

35 40 45

Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys Gly Tyr Asn Gly

50 55 60

Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr Gly Ile Lys Val

65 70 75 80

Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe Pro Gln Val Ala

85 90 95

Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala His Asp Arg Phe

100 105 110

Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile Thr Pro Asp Lys

115 120 125

Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp Ala Val Arg Tyr

130 135 140

Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu Ala Leu Ser Leu

145 150 155 160

Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys Thr Trp Glu Glu

165 170 175

Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly Lys Ser Ala Leu

180 185 190

Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro Leu Ile Ala Ala

195 200 205

Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys Tyr Asp Ile Lys

210 215 220

Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly Leu Thr Phe Leu

225 230 235 240

Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp Thr Asp Tyr Ser

245 250 255

Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala Met Thr Ile Asn

260 265 270

Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys Val Asn Tyr Gly

275 280 285

Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser Lys Pro Phe Val

290 295 300

Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro Asn Lys Glu Leu

305 310 315 320

Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp Glu Gly Leu Glu

325 330 335

Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala Leu Lys Ser Tyr

340 345 350

Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala Thr Met Glu Asn

355 360 365

Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln Met Ser Ala Phe

370 375 380

Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala Ser Gly Arg Gln

385 390 395 400

Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Ser Gly Lys Thr Thr

405 410 415

Ser Pro Lys Ser Phe Asn Asp Trp Thr Thr Cys Ala Lys Asn Val Gln

420 425 430

Trp Trp Leu Glu Ser Phe Val Lys Val Val Asn Trp Leu Lys Glu Lys

435 440 445

Ile Phe Pro Ser Lys Thr Asp Pro Thr Leu Gln Trp Leu Gln Asp His

450 455 460

Glu Glu His Ile Ala Ile Met Leu Ala Leu Cys Asp Glu His Leu Cys

465 470 475 480

Met Leu Arg Thr Glu Lys Asp Tyr Ile Cys Glu His Asn Thr Arg Pro

485 490 495

Lys His Gln Cys Leu Val Glu Met Val Ser Gly Thr Leu Asn Gln Leu

500 505 510

Gln Gly Ile Ser Ser Ala Arg Glu Leu Ala Ala Arg Leu Gln His Val

515 520 525

Leu Asn Lys Leu His Gln Val Asn Phe Glu Pro Glu Leu Glu Trp Thr

530 535 540

His Arg Pro Glu Pro Leu Gly Ile Trp Ile Ser Gly Gly Pro Gly Val

545 550 555 560

Gly Lys Ser Phe Leu Ser Asn Tyr Ile Val Lys Glu Ile Ala Lys Leu

565 570 575

Lys His Trp Lys Ser Tyr Ala Asn Pro Thr Gly Ser Lys His Met Asp

580 585 590

Gly Tyr Val Ser Gln Glu Ile His Val Phe Asp Asp Phe Gly Gln Asn

595 600 605

Arg Glu Glu Glu Asp Tyr Ser Leu Ile Cys Asn Leu Ile Ser Ser Val

610 615 620

Pro Phe Ile Thr Pro Lys Ala Ser Val Glu Ala Lys Gly Thr Gln Tyr

625 630 635 640

Arg Gly Arg Leu Val Val Val Thr Thr Asn Arg Arg Asp Phe Thr Ser

645 650 655

Cys Lys Leu Thr Asp Pro Asp Ala Leu Glu Arg Arg Phe Pro Ile Arg

660 665 670

Leu Asn Ile Arg Pro Leu Gln Lys Tyr Asn His Lys Gly Arg Leu Asp

675 680 685

Val Ala Thr Ala Met Arg Asp Gly Ser Leu Gln Gly Gly Ala Cys Trp

690 695 700

Glu Arg Asp Ile Gly Gln Leu Gly Leu Glu Cys Trp Asn Pro Ile Asn

705 710 715 720

Gly Gln Thr Leu Ile Asp Glu Ile Met Ser Glu Leu Gln Val Arg Gln

725 730 735

Glu Val Ala Ser Phe Met Asn Gln Ser Lys

740 745

Claims (9)

1. a kind of DHAV-12C protein polyclone antibodies, which is characterized in that the amino acid sequence of its immunogene such as SEQ ID NO.4 It is shown.

2. a kind of preparation method of DHAV-12C protein polyclone antibodies, which is characterized in that include the following steps：

Step 1 carries out DHAV-1X strain virus RNA extractions and is transcribed into cDNA, with the 2C specific primers DHAV-2C- of design P1 and DHAV-2C-P2 carries out the amplification of 2C segments using the cDNA of DHAV-1 as template；

The 2C segments correctly expanded are connected on pET32a by step 2, successfully build pET32a-2C prokaryotic expression carriers, will PET32a-2C is transferred in Escherichia coli Rossta (DE3), and 2C recombinant proteins are in the form of insoluble property inclusion body after IPTG inductions Expression, and carry out Westernblot identifications；

Step 3, purifying 2C recombinant proteins, the Anti-TNF-α of 2C albumen is obtained using 2C recombinant proteins as immunogen immune mouse Body, as DHAV-12C protein polyclone antibodies, the amino acid sequence such as SEQ ID NO.4 institutes of the immunogene of the polyclonal antibody Show.

3. preparation method according to claim 2, which is characterized in that carried out to DHAV-1X strain virus in the step 1 RNA is extracted：DHAV-1X strain virus is diluted with PBS, 0.22 μm of filtering with microporous membrane, add it is dual anti-, it is dual anti-for green strepto- Plain mixed liquor, 37 DEG C of water-baths act on 30min, are inoculated in the chorioallantoic cavity of 11 age in days duck embryos, 0.2ml/ pieces, in 37 DEG C after inoculation It is incubated in incubator；Embryo dead in for 24 hours is abandoned, embryo dead in 24~72h is collected, collects allantoic fluid, -20 DEG C save backup.

4. preparation method according to claim 2, which is characterized in that the 2C specific primers DHAV-2C-P1 in step 1 Nucleotide sequence with DHAV-2C-P2 is respectively SEQ ID NO.1 and SEQ ID NO.2.

5. preparation method according to claim 2, which is characterized in that the purifying 2C albumen in step 3 is specially：

The Rossta of successful conversion pET-32a-2C is expressed into a large amount of induced expressions of bacterium, lysate is added, thalline is resuspended, ultrasound is broken Broken, each 1min totally 3 times, will take precipitation after the good bacterium solution 12000r centrifugations of ultrasound；Precipitation, 8000r centrifugations are washed with cleaning solution 5min abandons supernatant；Repetition is washed with deionized once, and precipitation is resuspended in Tris-HCl, and 12000g centrifuges 10min；It is heavy It forms sediment and is resuspended with solubilization of inclusion bodies liquid, 12000g centrifuges 10min, takes supernatant；Elution buffer contains the urea of higher concentration, uses PBS solution dialysis removal urea；Bag filter is cut into suitable size, sets the NaHCO of 10mmol/L₃It is boiled in solution, distilled water Rinsing, is boiled with the EDTA solution of 10mmol/L, during which replaces an EDTA solution, distilled water rinsing；It is handled with bag filter pure Albumen after change carries out dialysis at 4 DEG C of equilibration buffer until imidazoles completely removes；Dialysis finishes, and protein solution -20 is sucked out DEG C preserve；Obtain destination protein, as antigen.

6. a kind of MBP-2C recombination fusion proteins, which is characterized in that its amino acid sequence is as shown in SEQ ID NO.16.

7. a kind of preparation method of MBP-2C recombination fusion proteins, which is characterized in that include the following steps：By maltose combination egg (MBP) segment is connected into pET-28a after being added in the ends N ' of 2C sequences and is transferred to Escherichia coli Rossta (DE3) in vain, and IPTG induces table Up to rear and carry out purification process, soluble 2C recombination fusion proteins, amino acid sequence such as SEQ ID NO.16 is prepared It is shown.

8. preparation method according to claim 8, which is characterized in that the purification process is specially：Ni fillers are packed into In chromatographic column, make filler natural subsidence；Used filtration distilled water washs filler；Filler is balanced with combination buffer；By sample loading Into pillar, 0.5ml/s；Pillar is washed with combination buffer；The de- albumen combined of imidazole elution buffer Xian of various concentration, It is in charge of collection；SDS-PAGE analyzes the distribution of albumen；Bag filter is cut into suitable size, sets the NaHCO of 10mmol/L₃In solution It boils, distilled water rinsing is boiled with the EDTA solution of 10mmol/L, during which replaces an EDTA solution, distilled water rinsing；With saturating The albumen of bag processing after purification is analysed, dialysis is carried out until imidazoles completely removes at 4 DEG C of equilibration buffer；Dialysis finishes, and egg is sucked out - 20 DEG C of preservations of white matter solution.

9. a kind of 2C mutant, which is characterized in that the 151st amino acids on DHAV-12C albumen become amino acid A, 152 by G Amino acids are become that amino acid A or 151 amino acids become amino acid A by G and 152 amino acids become amino acid by K by K A。