CN111187784A

CN111187784A - Use of aminoacylase-1

Info

Publication number: CN111187784A
Application number: CN202010088971.1A
Authority: CN
Inventors: 郭新梅; 宋希云; 陈东滨; 李军; 裴玉贺; 赵美爱; 张恩盈
Original assignee: Qingdao Agricultural University
Current assignee: Qingdao Agricultural University
Priority date: 2020-02-12
Filing date: 2020-02-12
Publication date: 2020-05-22
Anticipated expiration: 2040-02-12
Also published as: CN115109767B; CN115109767A; CN111187784B; LU102487B1

Abstract

The invention provides an application of aminoacylase-1 in improving plant traits, wherein the plant traits are selected from the following: the germination rate of plant seeds is improved; increasing the plant height; increasing the leaf area; increasing the stem thickness; increasing the root length; increasing the number of blades; increasing the root area; increasing pod weight; and increasing the fresh weight of the plant. The invention also provides application of aminoacylase-1 in improving bacterial polyethylene glycol resistance. The protein of the aminoacylase-1 is selected from the protein shown in SEQ ID NO.1, or the protein which has more than 90 percent of sequence homology with the protein shown in SEQ ID NO.1 and has the enzymatic activity of aminoacylase-1.

Description

Use of aminoacylase-1

Technical Field

The invention belongs to the technical field of agricultural biology, and relates to application of a corn aminoacylase-1 gene in improving the polyethylene glycol resistance of bacteria and improving the growth performance of plants.

Background

Aminoacylase-1 with bound Zn²⁺An ionic zinc-binding domain and a main domain promoting dimerization of the zinc-binding domain, the active site of which is located between the two zinc-binding domains^[1-2]. Binding of zinc by promoting binding of N-acyl-L-amino acid substrates causes conformational transfer, and protein subunits aggregate around the substrates, thereby allowing catalysis to occur^[3]。

Aminoacylase-1 (acylase I; N-acyl-L-amino acid amidohydrolase) participates in the hydrolysis of N-acylated or N-acetylated amino acids (except for L-aspartic acid), which form N-acyl-L-amino acids when the N-terminus of the L-amino acid is covalently bonded to an acyl group. Acyl groups provide stability to the amino acid, making it more resistant to degradation. However, N-acyl-L-amino acids cannot be used directly as building blocks for protein construction, and must first be converted into L-amino acids by aminoacylase-1, and the L-amino acid products can be used for biosynthesis or catabolic energy.

Aminoacylase-1 is involved in regulating the action of cells on oxidative stress in animal bodies and participating in amino acid metabolism and urea circulation, and urea circulation in plants means that arginine is synthesized, and individual plants can also produce urea which is decomposed to generate ammonia under the action of urease to synthesize nitrogen-containing compounds including nucleic acid, hormone, chloroplast, heme, amine, alkaloid and the like. However, there has been little research on aminoacylase-1 in plants. Shihuafang, etc^[4]Purified from riceThe rice aminoacylase has the greatest activity on N-acetyl-L-methionine, followed by N-acetyl-DL-serine and N-acetyl-L-alanine.

Reference to the literature

[1]Lindner-HA,Lunin-VV,Alary-A,et al.Essential Roles of Zinc Ligationand Enzyme Dimerization for Catalysis in the Aminoacylase-1/M20 Family[J].Journal of Biological Chemistry,2003,278(45):44496-44504.

[2]Fones-WS,Lee-M.Hydrolysis of N-acyl derivative of alanine andphenylalanine by acylase I and carboxypeptidase[J].Journal of BiologicalChemistry,1953,201(2):847-856.

[3]Lindner-H,Alary-A,Wilke-M,et al.Probing the acyl-binding pocket ofaminoacylase-1[J].Biochemistry,2008,47(14):66-75.

[4] Sphuafang, Huang Weida, Li hongjie, classification, purification and characterization of rice aminoacylases [ J ]. J.Biol.Chem.1997, 13(1):54-58.

[5]Fougere-F,Le-RD,Streeter-JG.Effects of salt stress on amino acid,organic acid,and carbohydrate composition of roots,bacteroids,and cytosol ofalfalfa(Medicago sativa L.)[J].Plant Physiology,1991,96(4):1228-1236.

[6]Zorb-C,Schmitt-S,Neeb-A.The biochemical reaction of maize(Zea maysL.)to salt stress is characterized by a mitigation of symptoms and not by aspecific adaptation[J].Plant Science,2004,167(1):91-100.

[7]Zhi-Z,Cui-YM,Zheng-S,et al.The amino acid metabolic andcarbohydrate metabolic pathway play important roles during salt-stressresponse in tomato[J].Frontiers in Plant Science,2017,8:1231.

[8]Khedr-AH,Abbas-MA,Wahid-AA,et al.Proline induces the expression ofsalt-stress-responsive proteins and may improve the adaptation of pancratiummaritimum L.to salt-stress[J].Journal of Experimental Botany,2003,54(392):2553-2562.

[9]Abbasi-AR,Hajirezaei-M,Hofius-D,et al.Specific roles of-and gamma-ocopherol in adminbiotic stress responses of transgenic tobacco[J].PlantPhysiology,2007,143(4):1720-1738.

Disclosure of Invention

The invention provides a first aspect of the application of aminoacylase-1 in improving plant traits, wherein the plant traits are selected from the following: the germination rate of plant seeds is improved; increasing the plant height; increasing the leaf area; increasing the stem thickness; increasing the root length; increasing the number of blades; increasing the root area; increasing pod weight; and increasing the fresh weight of the plant. In some embodiments, the aminoacylase-1 is a plant-derived aminoacylase-1. In some embodiments, the aminoacylase-1 is maize aminoacylase-1. In some embodiments, the protein of aminoacylase-1 is selected from the protein shown in SEQ ID No.1, or a protein having more than 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%) sequence homology with the protein shown in SEQ ID No.1 and having aminoacylase-1 enzyme activity. In the present invention, aminoacylase-1 proteins having homology with the protein shown as SEQ ID NO.1 include, but are not limited to: proteins with aminoacylase-1 protein activity that are naturally occurring in maize and other plants (e.g., sorghum), genetically engineered (e.g., fusion proteins), or mutated in an artificial environment (e.g., radiation mutation). When a large fragment of the fusion protein is fused, for example, green fluorescent protein is fused with aminoacylase-1 protein, the homology may be close to 50%, and the present invention is not limited to more than 90% of sequence homology. In some embodiments, the nucleic acid sequence encoding the aminoacylase-1 is as set forth in SEQ ID NO. 2. In some embodiments, the plant trait is an improvement in a tobacco trait. In some embodiments, the improved plant trait is a trait that is improved by increasing the expression level of NBEXPA1 gene and/or NBEIN2 gene.

In a second aspect, the present invention provides a method for improving a plant trait by transferring an expressible aminoacylase-1 gene into a plant, wherein the plant trait is selected from the group consisting of: the germination rate of plant seeds is improved; increasing the plant height; increasing the leaf area; increasing the stem thickness; increasing the root length; increasing the number of blades; increasing the root area; increasing pod weight; and increasing the fresh weight of the plant. In some embodiments, the aminoacylase-1 is a plant-derived aminoacylase-1. In some embodiments, the aminoacylase-1 is maize aminoacylase-1. In some embodiments, the protein of aminoacylase-1 is selected from the protein shown in SEQ ID No.1, or a protein having more than 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%) sequence homology with the protein shown in SEQ ID No.1 and having aminoacylase-1 enzyme activity. In some embodiments, the nucleic acid sequence encoding the aminoacylase-1 is as set forth in SEQ ID No. 2. In some embodiments, the plant trait is an improvement in a tobacco trait. In some embodiments, the improved plant trait is a trait that is improved by increasing the expression level of NBEXPA1 gene and/or NBEIN2 gene.

In a third aspect, the invention provides the use of aminoacylase-1 in improving bacterial polyethylene glycol resistance. In some embodiments, the bacterial anti-polyethylene glycol is growth of the bacteria in a liquid medium containing 1 wt% to 20 wt% (such as 2 wt%, 3 wt%, 5 wt%, 8 wt%, 10 wt%, 12 wt%, 15 wt%, 18 wt%), preferably 5 wt% to 15 wt% polyethylene glycol. In some embodiments, the aminoacylase-1 is a plant-derived aminoacylase-1. In some embodiments, the aminoacylase-1 is maize aminoacylase-1. In some embodiments, the protein of aminoacylase-1 is selected from the protein shown in SEQ ID No.1, or a protein having more than 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%) sequence homology with the protein shown in SEQ ID No.1 and having aminoacylase-1 enzyme activity. In some embodiments, the nucleic acid sequence encoding the aminoacylase-1 is as set forth in SEQ ID NO. 2. In some embodiments, the bacterium is escherichia coli, preferably, escherichia coli BL 21.

In the fourth aspect, the invention provides a method for improving the polyethylene glycol resistance of bacteria, which is to transfer an expressible aminoacylase-1 gene into the bacteria. In some embodiments, the bacterial anti-polyethylene glycol is growth of the bacteria in a liquid medium containing 1 wt% to 20 wt% (such as 2 wt%, 3 wt%, 5 wt%, 8 wt%, 10 wt%, 12 wt%, 15 wt%, 18 wt%), preferably 5 wt% to 15 wt% polyethylene glycol. In some embodiments, the aminoacylase-1 is a plant-derived aminoacylase-1. In some embodiments, the aminoacylase-1 is maize aminoacylase-1. In some embodiments, the protein of aminoacylase-1 is selected from the protein shown in SEQ ID No.1, or a protein having more than 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%) sequence homology with the protein shown in SEQ ID No.1 and having aminoacylase-1 enzyme activity. In some embodiments, the nucleic acid sequence encoding the aminoacylase-1 is as set forth in SEQ ID NO. 2. In some embodiments, the bacterium is escherichia coli, preferably, escherichia coli BL 21.

The fifth aspect of the invention provides a recombinant genetic engineering vector, which contains an expressible aminoacylase-1 gene. In some embodiments, the aminoacylase-1 is a plant-derived aminoacylase-1. In some embodiments, the aminoacylase-1 is maize aminoacylase-1. In some embodiments, the protein of aminoacylase-1 is selected from the protein shown in SEQ ID No.1, or a protein having more than 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%) sequence homology with the protein shown in SEQ ID No.1 and having aminoacylase-1 enzyme activity. In some embodiments, the nucleic acid sequence encoding the aminoacylase-1 is as set forth in SEQ ID NO. 2. In some embodiments, the recombinant genetically engineered vector is a recombinant prokaryotic gene expression vector; preferably, the vector of the recombinant prokaryotic gene expression vector is pET28 a. In some embodiments, the recombinant genetically engineered vector is a recombinant eukaryotic gene expression vector; preferably, the vector of the recombinant eukaryotic gene expression vector is pCAMBIA 1300. In some embodiments, the recombinant genetically engineered vector is a recombinant gene expression shuttle vector.

The sixth aspect of the present invention provides a host comprising the above recombinant gene engineering vector. In some embodiments, the host is a bacterium or a plant; preferably, the bacterium is escherichia coli, more preferably, escherichia coli BL 21. The plant is preferably tobacco.

Aminoacylase-1 of the invention is a zinc-binding enzyme that participates in urea cycle and ammonia (NH) in animals₄ ⁺) Clearance and regulation of cellular responses to oxidative stress, but few have been studied in plants. The invention takes a maize inbred line Zheng 58 as a material, clones a maize aminoacylase-1 gene ZmACY-1, and performs biological function analysis and research on the ZmACY-1 at the prokaryotic and eukaryotic levels, and the result is as follows:

1. bioinformatics analysis shows that ZmACY-1(LOC100283955) belongs to zinc peptidase superfamily, M20 aminoacylase-1 subfamily gene, the sequence length of an open reading frame coded by the ZmACY-1 gene is 1317bp, 439 amino acids are coded, the relative molecular weight of the coded protein is 48.33KD, and the theoretical isoelectric point is 6.02.

2. A prokaryotic expression vector pET28a-ZmACY-1 is constructed and is transferred into escherichia coli BL21 for salt-resistant and polyethylene glycol-resistant analysis. The results show that: compared with a pET28a control group strain, the recombinant pET28a-ZmACY-1 escherichia coli strain shows certain resistance capability under the stress of 5%, 10% and 15% PEG 6000; under the stress of 0.4mol/L, 0.6mol/L and 0.8mol/L NaCl, the overexpression of pET28a-ZmACY-1 in the Escherichia coli strain seriously inhibits the salt tolerance of the strain along with the increase of the salt concentration. It is presumed that recombinant Escherichia coli BL21(pET28a-ZmACY-1) has different tolerance patterns to NaCl stress and polyethylene glycol stress.

3. A plant binary expression vector pCAMBIA1300-ZmACY-1 is constructed, agrobacterium is used for infecting the tobacco of the indigenous tobacco, and the phenotype identification is carried out on the transgenic tobacco. The results show that: compared with wild type, the over-expression of ZmACY-1 in the tobacco promotes the growth and development of transgenic plants, including increasing the seed germination speed, increasing the leaf area, the plant height, the stem thickness, the weight of overground part, the weight of underground part, the root length, the root area and the pod size of mature plants. In the first-month-old transgenic original tobacco, the expression levels of genes NbEXPA1 and NbEIN2 related to plant growth are obviously higher than those of a wild type.

4. For tobacco T₃Carrying out NaCl treatment and natural drought treatment on the generation transgenic line and the wild type, and finding that the fresh weight and the chlorophyll content of the overground part of the transgenic line are obviously lower than those of the wild type after the salt stress treatment; after drought stress treatment, the fresh weight of the overground part of the transgenic line is obviously lower than that of the wild type, and the wilting degree is more serious. In addition, the determination of stress-related physiological indexes shows that the contents of protective enzymes POD, SOD and CAT in transgenic lines are all lower than that of wild type under salt stress and drought stress, and the MDA and the relative conductivity are higher than that of the wild type. These results indicate that the overexpression of ZmACY-1 in Nicotiana benthamiana negatively regulates the drought and salt tolerance of transgenic plants. Also, it was shown that ZmACY-1 has different anti-PEG patterns in E.coli and tobacco.

All the results show that ZmACY-1 participates in various life activities of plants and responds to adversity stress, promotes the growth and development of the plants, but inhibits the drought and salt resistance of the plants.

Drawings

FIG. 1 is a photograph of a gel of PrimerSTAR Max DNA Polymerase amplified ZmACY-1 gene.

Note: m: takara DL 2000DNA marker; lanes 1-4: amplification result of ZmACY-1 gene.

FIG. 2 is the PCR identification gel picture (A) and the double digestion verification gel picture (B) of pMD19T-ZmACY-1 plasmid colony.

Note: lanes M1, M2: takara DL 2000DNA marker; lanes 1-7: PCR identification of pMD19T-ZmACY-1 plasmid colony; lanes 8-11: pMD19T-ZmACY-1 plasmid double enzyme digestion verification.

FIG. 3 is a schematic diagram of prediction of conserved regions of ZmACY-1 protein.

FIG. 4 is a schematic diagram of the gene evolution analysis of ZmACY-1.

FIG. 5 shows PCR-verified gel map (A) of pET28a-ZmACY-1 and gel map (B) of the double digestion result.

Note: m1: takara DL 2000DNA marker, M2: takara DL 5000DNA marker; lanes 1-4: PCR identification is carried out on pET28a-ZmACY-1 plasmid colonies; lanes 5-6: and carrying out double enzyme digestion verification on the pET28a-ZmACY-1 plasmid.

FIG. 6 is a gel photograph of pET28a-ZmACY-1 prokaryotic expression product analysis.

Note: m: a protein Marker; 1 and 2: respectively an induced supernatant and a precipitate of the pET28a-ZmACY-1 strain; lanes 3 and 4: respectively, uninduced supernatant and precipitate of pET28a-ZmACY-1 strain;

lanes

5, 6 are induction supernatant and pellet of empty vector strain, respectively;

lanes

7, 8 are induction supernatant and pellet of empty vector strain, respectively; the protein of interest is indicated by the arrow.

FIG. 7 is a graph showing the growth curves of bacteria stressed by different concentrations of NaCl or different concentrations of PEG 6000.

Note: A-C, growth curves of the recombinant strain and the control strain are respectively carried out under the stress of (0.4mol/L, 0.6mol/L and 0.8mol/L) NaCl concentration.

D-F growth curves of the recombinant bacteria and the control bacteria under (5%, 10% and 15%) PEG6000 aqueous solution respectively.

FIG. 8 is a gel photograph showing the results of PCR identification (A) and double digestion (B) of the plasmid of the plant expression vector pCambia 1300-ACY-1.

Note: lane M1: takara DL 2000DNA marker, lane M2: takara DL15000 DNA marker; lanes 1-6: screening positive clone PCR results; lanes 7-9: and (5) performing double digestion on the recombinant plasmid.

FIG. 9 is a schematic view of the infection and screening process of the Bunsen tobacco leaves.

Note: a, in-vitro leaf B: callus tissue; C-D: adventitious buds; e, seedling; f: and (5) transplanting the tobacco plants.

FIG. 10 shows the results of PCR amplification of the selected vaccine genome (A) and the relative expression level of ZmACY-1 in T3 transgenic tobacco stocks (B).

A: lane M: takara DL 2000DNA marker; lane 1 wild type native tobacco; lanes 2-7: t0 generation ZmACCY-1 is transferred to screen the PCR result of the original tobacco; b: WT is wild type native tobacco, OE1, OE3 and OE5 are ZmACY-1 three transgenic lines T3 generation.

FIG. 11 shows the phenotypic identification results of wild type and ZmACY-1 transgenic tobacco seedlings.

Note: a, the germination rate of tobacco in a plate added with MS culture medium; B-D: tobacco growth vigor of 10 days in plates supplemented with MS medium; "*": p <0.05, "×": p < 0.01.

FIG. 12 shows phenotypic identification results of one month old wild type and ZmACY-1 transgenic nicotiana tabacum plants.

Note: a: the growth vigor of the tobacco of one month; B-H: identifying the phenotype of the tobacco of one month old; "*": p <0.05, "×": p < 0.01.

FIG. 13 is a diagram showing the expression levels of growth-related genes in transgenic and wild-type native tobacco.

Note: a: NbEXPA1 gene relative expression level; b: NbEIN2 gene relative expression level; "*": p <0.05, "×": p < 0.01.

FIG. 14 shows phenotypic identification of wild type and transgenic ZmACY-1 genes for the present tobacco pods.

Note: a: photographs of fully developed pods from wild-type and transgenic lines; b: pod weight in wild type and transgenic lines; "*": p <0.05, "×": p < 0.01.

FIG. 15 shows the results of salt tolerance analysis of the tobacco produced from the ZmACY-1 transgenic tobacco.

Note: a, the phenotype of each tobacco strain is stressed by 350mmol/L NaCl and treated by clear water; b: fresh weight of the overground part of each tobacco strain under 350mmol/L NaCl stress treatment and clear water treatment; c, the chlorophyll content of each tobacco strain is treated under 350mmol/L NaCl stress and clear water; "*": p <0.05, "×": p < 0.01.

FIG. 16 is a photograph showing the drought resistance analysis of the original tobacco transformed with ZmACY-1 gene.

Note: a, expressing the phenotype of each tobacco strain under natural drought and clear water treatment; b: fresh weight of the overground part of each tobacco strain under natural drought and clear water treatment.

FIG. 17 is a schematic diagram showing the results of determination of physiological indexes related to stress of wild type and transgenic indigenous tobacco under salt stress and drought stress.

Note: POD activity; b, SOD activity; c, CAT activity; d: MDA activity; e: relative conductivity; "*": p <0.05, "×": p < 0.01.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

Materials and methods

The test materials, maize inbred line 'Zheng 58' and wild type benthamiana (Nicotiana benthamiana) seeds, were provided by Qingdao agricultural university crop breeding laboratory strains, Escherichia coli (Escherichia coli) competent cells BL21(DE3) and DH5 α, Agrobacterium (Agrobacterium rhizogenes) competent cells BL 4404 were provided by Bokan biology Limited company (Qingdao). plasmid pMD19-T was purchased from Takara, plant expression vector pCAMBIA1300 and prokaryotic expression vector pET28a were provided by Qingdao agricultural university molecular laboratory, reagents isopropanol, absolute ethanol, AMP, X-gal, IPTG, kanamycin, Kana, rifampicin Rif, hygromycin Hyg, cefamycin Cef, 2000DNA Marker, 15000DNA Marker, nucleic acid dye, MS medium, 1/2MS medium, LB, YEB medium, conventional quantitative culture medium, PCR, fluorescent quantitative culture medium, PCR instrument, PCR concentration analyzer, and ultra-dry cell analyzer.

The primer sequence is as follows: the GenBank number of the Zheng 58 corn aminoacylase-1 gene (ZmACY-1 gene) is as follows: NP _ 001150325.2. The protein sequence is shown as SEQ ID NO.1 in the sequence table. The nucleotide coding sequence is shown as SEQID NO.2 in the sequence table. Based on the information such as ZmACY-1 gene sequence, software Primer Premier5 was used to design primers synthesized by Hippocastanaceae Biotechnology Limited, as follows (Table 1).

TABLE 1 primer sequences

Obtaining of cDNA of materials: firstly, extracting RNA according to the instruction provided by a Plant RNA Extraction Kit of Takara company; performing concentration detection on the extracted RNA by using a spectrophotometer, determining the purity and concentration of the RNA, and performing agarose gel electrophoresis detection; then reverse transcription is carried out, and the system is as follows: master mix 2.0. mu.L, RNA 2.0-4.0. mu.L (<500ng), RNase Free water make-up 10. mu.L, PCR protocol: reacting at 37 deg.C for 15min, reacting at 85 deg.C for 5s, and storing at 4 deg.C. The cDNA of the test material thus obtained was used for the fluorescent quantitative PCR.

Example 1: cloning of maize ZmACY-1 Gene

Firstly, extracting RNA: total RNA (Total RNA) Extraction of Zheng 58 maize leaf tissue was performed according to the instructions provided by the Plant RNA Extraction Kit of Takara corporation.

(II) RNA quality detection: and detecting the concentration of the extracted RNA by using a spectrophotometer, determining the purity and the concentration of the RNA, and then carrying out agarose gel electrophoresis detection.

(III) cDNA template synthesis: the reverse transcription system was prepared on ice with specific steps of Master mix 2.0. mu.L, Total RNA 2.0-4.0. mu.L (<500ng), and RNase Free water was added to bring the reaction to 10. mu.L. Adding the reaction solution according to the reaction system, and fully and uniformly mixing. The reaction is carried out in a PCR instrument, and the reaction program is as follows: reacting at 37 deg.C for 15min, reacting at 85 deg.C for 5s, and storing at 4 deg.C.

(IV) high fidelity enzyme amplification ZmACY-1 gene: and extracting RNA from leaves, and carrying out reverse transcription. Taking the total cDNA reverse transcribed from the RNA in the step (three) as a reaction template, and performing gene amplification by using high fidelity enzyme (PrimerSTAR Max DNA Polymerase) to amplify ZmACY-1 gene, wherein the system (Takara) is as follows: takara PrimerSTAR Max DNApolymerase 25. mu.L, ZmACY-1-F1. mu.L shown in Table 1, ZmACY-1-R1. mu.L shown in Table 1, cDNA 2. mu.L, and RNasefree water was added to the reaction system to 50. mu.L. The PCR reaction steps are as follows: denaturation at 98 ℃ for 10 s; annealing at 58 ℃ for 30 s; extension at 72 ℃ for 15 s; the number of cycles 35; storing at 4 ℃.

A single band of approximately 1320bp in size was obtained as shown in FIG. 1. The result shows that the specificity of the primer is better, the amplified fragment is clear, the size of the band is consistent with that of the target gene, and further cloning experiments can be carried out.

(V) recovering the amplification product and adding A tail

The procedure according to the gel recovery kit (Nanjing Novozam Biotechnology Co., Ltd., model DC301-01) was as follows:

1. pipette 100. mu.L of the LPCR product into a sterilized 1.5mL centrifuge tube using a pipette gun. 2. Add equal volume of Buffer GDP and mix by inversion or vortexing. 3. After the collection tube was fitted with the DNA adsorption column, the mixture was transferred to the DNA adsorption column and centrifuged at 10,000 Xg for 1 min. 4. The filtrate was discarded, and after the adsorption column was replaced in the collection tube, 600. mu.L buffer GW (absolute ethanol had been added) was added to the adsorption column, and centrifuged at 12,000 Xg for 1 min. 5. And (4) repeating the step. 6. The filtrate was discarded, the adsorption column was returned to the recovery header, and centrifuged at 12,000 Xg for 2 min. 7. The column was placed in a sterilized 1.5mL centrifuge tube, 30. mu.L solution Buffer was added to the center of the column, and after standing for 2min, centrifugation was carried out at 12,000 Xg for 1 min. The adsorption column was discarded, and the purified DNA solution was stored in a-20 ℃ refrigerator. 8. Adding "A" (deoxyadenosine) to the product, taking 14.5 mu L of PCR product as a template, adding 2 mu L of Taq Buffer, 3 mu L of dNTPs and 0.5 mu L of Taq enzyme to the PCR product, and reacting for 30min at 72 ℃.

(VI) construction of cloning vector pMD19T-ZmACY-1

The intermediate vector pMD19T-ZmACY-1 was constructed by following the procedure, and DNA was purified and recovered after completion of the "A" reaction of the amplification product.

(1) The recovered fragment was ligated into the linear pMD19-T vector

Preparing a connection reaction solution in a microcentrifuge tube. The pMD19T-ZmACY-1 system is as follows: T-Vector pMD 191. mu.L; 1 mu L of PCR product; 5. mu.L of DNA Ligase; RNase free water was added to the system at 10. mu.L.

The above reaction system was added to an EP tube and mixed well. Placing into a PCR instrument, setting the temperature at 16 ℃, and reacting for 30 min. After the reaction, the reaction mixture was added to 100. mu.L of E.coli competent cells BL21(DE3) at a volume ratio of 1:10, and rapidly placed on ice for 40 min. And then putting the mixture into a water bath with the temperature of 42 ℃ for heating treatment for 90s, quickly putting the mixture into ice for reaction for 2min, finally adding the reaction solution into an LB liquid culture medium without antibiotics, and putting the mixture into a shaking table for shaking culture for 60min at the temperature of 37 ℃.

(VII) screening of cloning vector pMD19T-ZmACY-1

(1) And (4) screening blue and white spots. To an Amp-containing LB plate was added 30. mu. L X-gal and 3. mu.L IPTG in a super clean bench, and the mixture was allowed to stand for 1 hour, then the transformed E.coli was spread on the plate, and after standing for 30 minutes, the plate was cultured overnight by inversion at 37 ℃.

(2) And (4) screening positive bacteria. White single colonies were selected and subjected to PCR to screen positive recombinant plasmids. The reaction system is as follows: 2 × TaqPlusMasterMixII (DyePlus)25 μ L; ZmACY-1-F1 μ L; ZmACY-1-R1 μ L; strainsolution 2. mu.L; RNase free water was added to the system at 50. mu.L.

(eight) identification of cloning vector pMD19T-ZmACY-1

(1) Plasmid extraction

White single colonies were picked, inoculated into LB medium (containing Amp), and cultured overnight at 37 ℃. And (3) sucking the bacterial liquid into a centrifugal tube, centrifuging for 1min at the rotating speed of 10,000rpm, and collecting thalli. Extracting plasmids according to the steps of a plasmid extraction kit: 1. 2mL of the recombinant Escherichia coli liquid cultured overnight (12-16h) is added into a 2mL centrifuge tube, centrifuged at 10,000 Xg for 1min, and the centrifuge tube is inverted on filter paper to suck up residual liquid. 2. 250 μ L of Buffer P1 (previously checked for RNase A) was added to the tube containing the pellet, and vortexed to mix the pellet. 3. mu.L of Buffer P2 was added to step 2 and the tube was gently inverted 10 times to lyse the cells thoroughly. 4. Add 350. mu.L of Buffer P3 to step 3 and immediately gently invert the tube 10 times to thoroughly neutralize the Buffer P2 thoroughly and centrifuge at 13,000 Xg for 10 min. 5. FastPure DNA MiniColumns adsorption columns were placed in a Collection Tube 2 mL. The supernatant from step 4 was carefully transferred to an adsorption column with a pipette gun and centrifuged at 13,000 Xg for 1min to avoid aspiration of the pellet. The waste liquid in the collecting pipe is discarded, and the adsorption column is put into the collecting pipe again. 6. Add 600. mu.L Buffer PW2 (diluted with absolute ethanol) to the adsorption column and centrifuge at 13,000 Xg for 1 min. Abandoning the waste liquid, and replacing the adsorption column into the collection pipe again. 7. And 6, repeating the step. 8. The adsorption column was returned to the collection tube. The column was dried by centrifugation at 13,000 Xg for 1min to completely remove the residual rinse from the column. 9. The column was replaced in a fresh sterilized 1.5mL centrifuge tube. Add 50. mu.L of Elution Buffer to the center of the adsorption column membrane. Standing at room temperature for 2min, and centrifuging at 13,000 Xg for 1min to elute the plasmid. 10. The adsorption column was discarded and the plasmid was stored at-20 ℃ to prevent DNA degradation.

(2) Enzyme digestion verification: the plasmid is identified by double enzyme digestion by using restriction endonucleases BamH I and Hind III, and the enzyme digestion pMD19T-ZmACY-1 plasmid system is as follows: 10 XK Buffer 5. mu.L; 1 mu L of BamH I; hind III 1. mu.L; plasmid15 μ L; RNase free water was added to the system at 50. mu.L.

The PCR identification result of the pMD19T-ZmACY-1 plasmid colony is shown in FIG. 2A, and a single band with the size of about 1320bp is obtained through amplification. The result of plasmid double restriction enzyme digestion verification of transformants with correct PCR of the bacterial liquid is shown in FIG. 2B. The identified positive clones are sent to Qingdao Zhixi biotechnology Limited for sequencing. The sequencing result shows that the part of the PCR product related to the coding sequence is the same as the part of the PCR product related to the SEQ ID NO.2, and the cloning is successful.

Example 2: bioinformatics analysis

And (3) carrying out amino acid sequence alignment on the sequencing result by using DNAMAN software, and carrying out phylogenetic tree analysis on the gene by using MEGA 5.1 software. Sequence analysis is carried out on the cloned ZmACY-1 gene by using Bioxm software, and the analysis shows that the sequence length (excluding a stop codon) of an open reading frame coded by the gene is 1317bp, and 439 amino acids are coded. The result of predictive analysis by ProtParam (https:// web. expasy. org/ProtParam /) online software shows that the molecular formula of the protein coded by the ZmACY-1 gene is C₂₁₇₃H₃₃₆₇N₅₉₉O₆₂₅S₁₄The protein has a relative molecular weight of 48.33kD, a theoretical isoelectric point of 6.02, a total number of positively charged residues (Arg + Lys) of 42, a total number of negatively charged residues (Asp + Glu) of 50 and a destabilization coefficient of 46.03, and belongs to unstable proteins. The conserved region of the amino acid sequence encoded by the ZmACY-1 gene was analyzed by the conserved functional region analysis program cds (conserved domains) of NCBI as shown in fig. 3, indicating that ZmACY-1 belongs to the zinc peptidase superfamily, M20 aminoacylase-1 subfamily, having an M20-acylase domain and five zinc binding sites. The ZmACY-1 evolutionary analysis is shown in figure 4.

Example 3: construction of prokaryotic expression vector pET28a-ZmACY-1

(one) construction of recombinant bacterium

XbaI-ZmACY-1-F and BamHI-ZmACY-1-R shown in Table 1 were used as primers to perform PCR amplification of recombinant plasmid pMD19T-ZmACY-1 with high fidelity enzyme, thereby adding protected bases at both ends of the plasmid. The PCR reaction system is as follows: TakaraPrimeR STAR Max DNA Polymerase 25. mu.L; XbaI-ZmACY-1-F1 uL; BamHI-ZmACY-1-R1 μ L; pMD 19T-ZmACY-12 μ L (0.1-10 ng); RNase free water was added to the system at 50. mu.L.

Recovering target fragments by glue, and respectively using Xba I and BamH I to perform enzyme digestion for 5h at 37 ℃ on a prokaryotic expression vector pET28a and an amplified fragment of the positive clone PMD19T-ACY-1, wherein the enzyme digestion reaction system is as follows: 10 XK Buffer 5. mu.L; xba I1. mu.L; 1 mu L of BamHI; plasmid 20. mu.L; RNase free water was added to the system at 50. mu.L.

After the enzyme digestion reaction is finished, recovering the product according to a gel recovery kit, connecting the target fragment and the vector fragment according to the following system, and putting the target fragment and the vector fragment into a PCR instrument for overnight connection at 16 ℃ to obtain a prokaryotic expression vector pET28 a-ZmACY-1. The connecting system is as follows: vector 3. mu.L; PCR product 12. mu.L; 1. mu.L of DNA Ligase; 10 × Buffer 2 μ L; RNase free water was added to the system at 20. mu.L.

The recombinant plasmid is transformed into prokaryotic expression host bacteria BL21(DE3), then the prokaryotic expression host bacteria BL21 is coated on LB culture medium containing kanamycin (the concentration is 50 mug/mL) for overnight culture, after screening, plasmid extraction is carried out for enzyme digestion identification, wherein, positive clones are screened, and the PCR verification result is shown in figure 5A. The strains which are successfully verified by PCR are amplified and shaken and plasmids are extracted, the result of the recombinant plasmid double-restriction enzyme digestion identification is shown in FIG. 5B, and the result shows that the pET28a-ZmACY-1 prokaryotic expression vector is successfully constructed. The positive plasmid is sent to Qingdao Kangchi Biotechnology Limited company for sequencing to obtain the same coding sequence shown in SEQ ID NO. 2.

(II) prokaryotic expression of fusion protein

Prokaryotic expression of ZmACY-1 Gene in E.coli BL21(DE3)

1. Inoculating overnight cultured host bacteria BL21(DE3) into 10mL LB liquid medium containing Amp resistance at volume ratio of 1:100, placing into shaking incubator at 37 deg.C and 200rpm, shaking for 5 hr, and measuring OD value to OD₆₀₀Up to 0.8.

2. IPTG was added at 0.1M to a final concentration of 0.05mmol/L and the experiment was incubated at 28 ℃ for 5h in an incubator with no inducer IPTG added as a control. Then 100 μ L of the bacterial liquid was centrifuged and subjected to SDS-PAGE electrophoresis to determine whether the recombinant protein was expressed. 3. Adding 100 mu L of BL21(pET28a-ACY-1) recombinant bacteria into 10mL LB liquid medium, performing induction expression according to the method, centrifuging at the rotating speed of 10,000rpm for 1min, pouring out supernatant, re-suspending and precipitating with PBS, centrifuging at the rotating speed of 10,000rpm for 10min, repeating the steps for three times, placing the collected bacteria into an ice bath, performing ultrasonic disruption for 5min, repeating the steps for one time, and centrifuging at the rotating speed of 10,000rpm for 20min when the bacteria liquid is clear. 4. mu.L of the supernatant and the precipitate suspension were taken, 10. mu.L of 5 XSDS loading buffer was added to each, and boiled in boiling water at 100 ℃ for 10min for SDS-PAGE analysis to determine whether the expression product was soluble (in the supernatant) or in the form of inclusion bodies (in the precipitate). The protein coded by ZmACY-1 is induced by IPTG, then is centrifuged, resuspended, ultrasonically broken and centrifuged, and then is subjected to SDS-PAGE detection, the result is shown in figure 6, the protein size is about 48.33kD and is consistent with the molecular weight of ZmACY-1 protein predicted by ProtParam, and the result shows that pET28a-ZmACY-1 can express protein in escherichia coli BL21, so that the salt tolerance polyethylene glycol resistance analysis of the next step can be carried out.

Example 4: salt and polyethylene glycol resistance tests of recombinant host bacterium BL21(pET28a-ZmACY-1)

Salt resistance analysis of recombinant host bacterium BL21(pET28 a-ZmACY-1): setting three LB liquid culture media containing NaCl in different concentrations (final NaCl concentrations are 0.4mol/L, 0.6mol/L, 0.8mol/L), adding BL21(pET28a-ZmACY-1) host bacteria induced by 1ml IPTG and BL21(pET28a) host bacteria of control group into the culture media, mixing, placing in a shaking culture box for shaking culture at 37 ℃, and measuring OD (OD) every L hour₆₀₀The value is obtained. Each treatment was assayed in 3 replicates.

Anti-polyethylene glycol analysis of recombinant host bacterium BL21(pET28 a-ZmACY-1): setting three LB liquid culture media containing PEG6000 at different concentrations (the final concentration of PEG6000 is 5%, 10%, 15%), and taking 1mL of induced BL21(pET28a-ZmACY-1 host bacteria and control group BL21(pET28a) host bacteriaAdding into culture medium, mixing, placing into shaking culture box, shaking culturing at 37 deg.C, and measuring OD every l hr₆₀₀The value is obtained. Each treatment was assayed in 3 replicates.

The effect of different stress times on the growth of the host bacteria was observed. The average OD on the abscissa of the cultivation time₆₀₀Values are plotted as ordinate, growth curves are plotted. The results showed that the host bacteria transformed with pET28a-ZmACY-1 grew well before low salt stress (FIG. 7A) compared to the host bacteria transformed with pET28a, but the growth of the host bacteria transformed with pET28a-ZmACY-1 was weaker than that of the control host bacteria under medium salt stress (FIG. 7B) and high salt stress (FIG. 7C), and the growth curve of pET28a-ZmACY-1 host bacteria could not be further increased with the passage of time under high salt stress of 0.8mol/L, and the high salt concentration weakened was responsible for the medium salt stress and high salt stress tolerance of the host bacteria. However, under different concentrations of PEG6000 stress (FIG. 7D-F), the growth of pET28a-ZmACY-1 host bacteria is better than that of pET28a host bacteria, which indicates that the host bacteria has a certain anti-PEG capacity by the over-expression of ZmACY-1 in Escherichia coli BL21, and the OD difference is larger at high PEG concentration than at low PEG concentration, for example, at 5% PEG concentration, the OD value of the transPEG gene strain is only slightly increased, and at 15% PEG concentration, the OD value of the transPEG gene strain is increased by about 50%, which indicates that in the PEG concentration range used in the invention, the anti-PEG capacity of the ZCY-1 gene to Escherichia coli is increased along with the increase of PEG concentration.

Example 5: ZmACY-1 transgenic tobacco

(I) construction of plant expression vector pCambia1300-ZmACY-1

PMD19-ACY-1 is used as a template, ZmACY-1-XbaI-F (the sequence is the same as XbaI-ZmACY-1-F shown in a table 1) and ZmACY-1-BamHI-R (the sequence is the same as BamHI-ZmACY-1-R shown in a table 1) are used as primers, PCR amplification is carried out by a high fidelity enzyme, so that protective bases are added at two ends of a plasmid, and a target fragment is recovered. The pCambia1300 expression vector and the amplified fragment of the positive clone PMD19T-ZmACY-1 were double digested with XbaI and BamHI at 37 ℃ for 3h, respectively, as follows: 10 XKBuffer 5. mu.L; xba I1. mu.L; 1 mu L of BamH I; plasmid 20. mu.L; RNase free water was added to the system at 50. mu.L. The linking system is as follows: 3 mu L of T-Vector pCambia1300 (after enzyme digestion); PCR product (after digestion) 12. mu.L; DNALigase 1. mu.L; 10 × Buffer 2 μ L; RNase free water was added to the system at 20. mu.L.

The recombinant plasmid is transformed into escherichia coli DH5 α, the LB culture medium containing kanamycin (with the concentration of 50 mug/mL) is cultured overnight at 37 ℃, the plasmid is extracted for enzyme digestion identification, PCR identification and an enzyme digestion map are shown in figure 8, and therefore, the plant expression vector pCambia1300-ZmACY-1 is successfully constructed, the positive plasmid is sent to Qingdao Kangxi biotechnology Limited company for sequencing, and the correctness of vector construction is verified.

Genetic transformation of ZmACY-1 gene into native cigarette

Transformation of LBA4404 competent cells

1. Taking out the agrobacterium LBA4404 competent cells from an ultralow-temperature refrigerator at-80 ℃, and inserting the competent cells into ice for ice bath for 10min after the competent cells are slightly melted. 2. In a clean bench, 1 μ L of expression vector plasmid pCambia1300-ZmACY-1 was added to competent cells, gently blown and stirred uniformly, ice-bathed for 5min, transferred into liquid nitrogen for 5min, transferred into a water bath kettle at 37 ℃ for 5min, and then ice-bathed for 2 min. 3. Adding the agrobacterium after ice bath into 600 mu LLB liquid culture medium in the sensitive state, putting the mixture into a shaking incubator, and setting the conditions as follows: shaking and culturing at 28 deg.C and rotation speed of 200rpm for 2-3 h. 4. The cells were centrifuged at 10,000rpm for 3min, the supernatant was discarded, and the cells were resuspended in 100. mu.L LYEB (or LB) liquid medium. 5. The resuspended bacterial liquid is smeared on YEB solid culture medium containing 50mg/L kanamycin and 20mg/L rifampicin, and is placed upside down in an incubator to be cultured for 36-48h at 28 ℃. 6. And (3) selecting single agrobacterium colony after 36-48h of culture, inoculating the single agrobacterium colony in a centrifuge tube filled with YEB (or LB) liquid culture medium (50mg/L Kan +20mg/LRif) for overnight culture (>16h), and carrying out PCR verification after the bacterial liquid is turbid. And (3) preserving the bacteria of the bacteria liquid and sterilized 50% glycerol according to the ratio of 1:1, and storing in a refrigerator at the temperature of minus 80 ℃.

(III) genetic transformation of the original tobacco (leaf disc method)

1. 200. mu.L of Agrobacterium LBA4404 strain containing the expression vector pCambia1300-ZmACY-1 stored in an ultra-low temperature refrigerator at-80 ℃ was inoculated into 10mLYEB liquid medium (50mg/L Kan +20mg/LRif) overnight (>16h) Shake culturing, activating strain. 2. The activated bacteriaShaking culture was continued in YEB liquid medium (50mg/L Kan) at a volume ratio of 1:50, overnight culture was performed, and then centrifugation was performed to collect samples (7,000rpm for 3 min). 3. Resuspension (OD) of the inoculum was performed in a clean bench with 5% sucrose in 1/2 medium (agar-free)₆₀₀The value: 0.6-0.8), placing the leaves of the native tobacco which are pre-cultured for two days into a heavy suspension for soaking for 5-10min, airing on filter paper after soaking, and then moving the leaves to a co-culture medium (MS +3mg/L6BA +0.2mg/LNAA +150 mu mol/L acetosyringone, PH is 5.8) covered with two layers of filter paper for co-culture for 3 days in the dark. 4. The tobacco leaves after 3 days of co-culture were transferred to an induced callus medium (MS +3mg/L6BA +0.2mg/LNAA +25mg/LHyg +250mg/LCef, pH 5.8) supplemented with hygromycin and cephamycin for selection culture (25 ℃ C., 16 hours of light), and the medium was changed once a week. 5. After adventitious buds grow from the callus, cutting off young buds in an ultraclean workbench, transferring the young buds to a sprouting culture medium (MS +20mg/LHyg +200mg/LCef, pH 5.8) for screening, cutting off plants when young buds form 3-5cm seedlings, transferring the young buds to a (1/2MS +15mg/L Hyg +150mg/LCef, pH 5.6) rooting screening culture medium for culturing. 6. After the screened seedlings grow roots, the cover of the tissue culture bottle is opened, the sealing film is replaced, and the sealing film is cut into a plurality of cracks by a scalpel to practice the seedlings. After two days, the tissue culture seedlings are gently moved out by using tweezers, the roots of the tissue culture seedlings are washed by using clear water until the root culture medium is washed clean, and the tissue culture seedlings are transplanted into sterilized soil. 7. And (4) watering the transplanted native tobacco thoroughly, placing the native tobacco into illumination culture for constant temperature culture at 25 ℃, and covering a film for moisturizing in the first three days. After three days, the culture was normal.

(IV) planting of the original tobacco

(1) Seed disinfection and aseptic seeding

The seeds are firstly put on a clean vessel, impurities are removed, then the seeds are moved to an EP tube, the seeds are washed once by sterile water, and then the seeds are soaked in 75% alcohol for 30-60 s. The present tobacco seeds were then washed with 2% NaClO for 10 min. And finally, cleaning for 3-5 times by using sterile water. The sterilized seeds were spotted onto MS medium using a sterile 1mL pipette tip.

(2) Transplanting of native tobacco

Firstly, before transplanting, sterilizing nutrient soil at 120 ℃ for 30min, and after the soil is cooled, putting the soil into a flowerpot for planting the natural tobacco. Transplanting the strong native tobacco into nutrient soil by using forceps, and transplanting 1 tobacco in each pot. And (4) putting the transplanted ben-sheng tobacco into a light incubator, and culturing at a constant temperature of 25 ℃.

The infection and screening process of the tobacco leaves of the present green tobacco is summarized as shown in fig. 9. The infected leaves are screened in a callus screening induction culture medium (figure 9A) added with hygromycin to obtain callus (figure 9B), the callus is changed into a shoot screening culture medium added with hygromycin to screen and obtain buds (figure 9C), the buds are cut out and screened and cultured in a rooting screening culture medium (figure 9D), the buds grow into formed plants and roots (figure 9E) show that the screening is finished, and then the seedlings can be trained and moved to the soil (figure 9F).

(V) identification of the original tobacco

Extraction of DNA

The method comprises the following steps of 1, placing 0.5g of tobacco leaves into a mortar precooled by liquid nitrogen, fully grinding the tobacco leaves, continuously adding the liquid nitrogen, quickly transferring the tobacco leaves into a 2mLEP tube, 2, adding 700 mu L of CTAB (65 ℃ water bath preheating) extraction buffer solution into the EP tube, fully and uniformly mixing the buffer solution, adding 20 mu L of β -mercaptoethanol, gently shaking the mixture every 20min at 3.65 ℃ in a water bath for 40min, cooling the mixture to room temperature, adding equal volume of phenol, namely chloroform, isoamyl alcohol (1:1:1) solution, fully and uniformly mixing the mixture, carrying out ice bath for 5min, carrying out 12,000rpm, centrifuging the mixture for 15min, taking out supernatant, repeating the step 4.6, absorbing the supernatant into a new EP tube, adding equal volume of isopropanol, uniformly mixing the mixture, placing the mixture into a refrigerator, standing the mixture for 1h, carrying out 12,000rpm, centrifuging the mixture for 8min, discarding supernatant after 4.6, washing the supernatant in a fresh EP tube, carrying out centrifugation for 3min, adding 70% of water, carrying out centrifugation for 2-20 mu L, carrying out precipitation at 50 min, carrying out centrifugation, and carrying out precipitation at the temperature of deionized water at 50-20 ℃, and carrying out centrifugation.

And (3) PCR amplification detection: the DNA extracted in the previous step is taken as a template to amplify the ZmACY-1 gene, and the Real time PCR reaction system is as follows: TBGreenPremixExTaqII 12.5. mu.L; qRT-ZmACY-1-F0.5 mu L; qRT-ZmACY-1-R0.5 μ L, and cDNA after reverse transcription 2.0 μ L; RNase free water to 25. mu.L. The Real Time PCR reaction steps are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing at 55-60 deg.C for 30 s; extension at 72 ℃ for 30 s; the cycle is repeated 40 times.

Real-time fluorescent quantitative PCR: using wild type Bunsen as a control, the expression of ZmACY-1 in Bunsen was detected by fluorescent quantitative PCR using TBGreenPremixExTaqII (TliRNaseHPlus) kit (TaKaRa). In the experiment, the endogenous gene NbEF1a of the raw cigarette is used as an internal reference gene (NbEF 1a-F and NbEF1a-R shown in Table 1 are used as primers), and the relative expression quantity of ZmACY-1 on the transcription level is determined (qRT-ZmACY-1-F and qRT-ZmACY-1-R are used as primers). The real-time fluorescent quantitative PCR reaction system is the same as above.

Extracting DNA of the selected seedling leaves obtained by hygromycin screening, and carrying out T₀And (5) detecting the positive transformation strain by using molecules. As a result, as shown in FIG. 10A, six T strains were obtained₀The generation ZmACY-1 positive seedlings are successfully transformed positive seedlings, and 3 ZmACY-1 transformed strains are selected and named as OE1, OE3 and OE5 respectively to serve as subsequent experimental materials. Extraction of T₃The ZmACY-1 purified vaccine and the wild type natural tobacco leaf RNA are transferred for real-time fluorescence quantification to detect the relative expression quantity of the ZmACY-1 in each strain, the method is the same, and the result is shown in FIG. 10B. From this, it was found that ZmACY-1 was hardly expressed in wild-type tobacco, but highly expressed in OE1, OE3 and OE5 strains, indicating that the altered phenotype (trait) of OE1, OE3 and OE5 strains relative to wild-type tobacco is caused directly or indirectly by the ZmACY-1 gene.

(VI) identification of ZmACY-1 transgenic tobacco phenotype

1. Determination and comparison of germination rates of ZmACY-1-transgenic tobacco seeds and wild-type tobacco seeds

Transgenic lines OE1, OE3, OE5 and wild type tobacco seeds were aseptically sown in clean benches in petri dishes containing MS medium with one hundred seeds per plate and germination rate (statistical data see FIG. 11A) measurements and comparisons were made from the third day onward. To compare the growth vigor of the transgenic lines and the wild-type lines (see FIGS. 11-B-D), seeds of each line were aseptically sown in the same plate, and 25 seeds were sown per line. Therefore, the ZmACY-1 gene can improve the germination rate of tobacco seeds and promote the growth of tobacco.

2. Identification of phenotype of ZmACY-1 transgenic tobacco plants and wild-type tobacco plants

For T₃The generation transgenic lines OE1, OE3, OE5 and wild type tobacco seedlings were cultured in MS medium for 15 days, then transplanted into soil, and the plant height of one month old tobacco plants (see results in fig. 12C), leaf area (see results in fig. 12B), stem thickness (see results in fig. 12D), root length (see results in fig. 12F), leaf number (see results in fig. 12A), root area (see results in fig. 12G), fresh weight of aerial parts (see results in fig. 12E) and fresh weight of underground parts (see results in fig. 12H) were measured 15 days later.

3. The RNA of the transgenic strains OE1, OE3 and OE5 and the leaf blade RNA of the same part of the natural tobacco of the wild type tobacco are extracted to carry out real-time fluorescence quantitative PCR, the PCR method is the same as the fifth section of the example 5, and the NBEXPA1 gene is amplified by adopting NbEXPA1-F, NbEXPA1-R shown in the table 1 as a primer. NBEIN2 gene was amplified using NbEIN2-F, NbEIN2-R shown in Table 1 as a primer. The relative expression amounts of the two genes NBEXPA1(GenBank accession No.: NM-001325646.1) and NBEIN2(GenBank accession No.: XM-016579720.1) were measured. The results are shown in FIG. 13.

NBEXPA1 belongs to the swollenin protein family and plays an extremely important role in promoting leaf growth. NbEIN2 is a necessary positive regulator in the ethylene signal path. As can be seen from fig. 13, the expression level of NBEXPA1 and NBEIN2 in the transgenic tobacco is significantly higher than that of the wild type. The over-expression of the ZmACY-1 gene in the nicotiana benthamiana is proved to cause the plant growth speed to be accelerated by positively regulating the expression of plant growth related genes NBEXPA1 and NBEIN 2. Therefore, ZmACY-1 not only responds to the regulation of plant hormones, thereby promoting the growth and development process of plants, but also plays an important role in improving the biomass and yield of the plants.

5. The fully developed pods of tobacco at the maturity stage were picked for weighing and fruit length and width measurements (see figure 14 for results).

As shown in fig. 11, fig. 12 and fig. 14, the overexpression of ZmACY-1 in the native tobacco significantly promoted the growth and development of the plants, and the germination rate, plant height, root length, stem thickness, leaf area (the fifth functional leaf), root area, fresh weight of the above-ground part, fresh weight of the underground part and pod (mature plant) of the transgenic plants were all significantly greater than those of the wild type plants. ZmACY-1 can promote the growth of the natural tobacco.

(VII) study on response of ZmACY-1-transformed tobacco to salt stress and PEG stress

Influence of salt stress and PEG stress on physiological and biochemical functions of trans-ZmACY-1 Bunsen smoking

1. And irrigating 350mmol/L NaCl to the seedlings of the first month-old Benzenbachia to carry out salt stress, wherein the PEG stress is 20% of PEG6000 aqueous solution treatment.

Response of ZmACY-1 transformed native tobacco to salt stress

For pair T₃The result of 350mmol/L NaCl solution treatment of the original one-month-old tobacco shows that after 10 days of treatment, the wild type and ZmACY-1 transformed strains gradually lose green and yellow, but the green and yellow losing situation of the ZmACY-1 transformed tobacco is more obvious and is obviously higher than that of the wild type (figure 15A). In addition, the fresh weight of the aerial parts (fig. 15B) and the chlorophyll content (fig. 15C) of each line of the native tobacco after 10 days of salt stress treatment were measured by using clear water irrigation as a control, and as a result, it was found that the fresh weight of the aerial parts and the chlorophyll content of the transgenic lines after 10 days of salt stress treatment were both significantly higher than those of the wild type, while the fresh weight of the aerial parts and the chlorophyll content of each line were both decreased after 10 days of salt stress treatment, and the fresh weight of the aerial parts and the chlorophyll content of the transgenic lines were significantly lower than those of the wild type. This indicates that overexpression of ZmACY-1 in the present tobacco weakens the salt tolerance of the plants.

Response of ZmACY-1 transformed native tobacco to drought stress.

This study is on T₃Drought treatment was performed on the first month old tobacco leaves, and water was used as a control. As a result, it was found that the wilting degree of the transgenic line was more severe after 7 days of drought treatment compared to the wild type native tobacco, and the recovery degree of the wild type native tobacco was also significantly higher than that of the ZmACY-1 transgenic line after two days of rehydration (FIG. 16A). In addition, the fresh weight of the overground part of each strain of the tobacco is measured under the conditions of no treatment and drought treatment, and the result shows that the drought stress obviously causes the fresh weight of the overground part of the wild type and the transgenic strain to be reducedAnd, in the untreated case, the fresh weight of the aerial part of the transgenic line was significantly higher than that of the wild type, whereas, in the drought stress treatment, the fresh weight of the aerial part of the transgenic line was lower than that of the wild type (fig. 16B). The results show that, different from the expression in Escherichia coli BL21, the overexpression of ZmACY-1 in the nicotiana benthamiana weakens the drought resistance of plants.

(1) Malondialdehyde (MDA) content determination

Shearing 0.2g of Nicotiana benthamiana leaf, adding 3mL of 5% trichloroacetic acid (TCA), grinding into slurry, centrifuging for 10min at 5,000rmp, adding supernatant into test tube, adding isovolumetric 0.5% thiobarbituric acid (TBA), mixing, placing into boiling water bath, cooling after 30min, and measuring absorbance at 450nm, 532nm and 600nm^[5]。

MDA content (nmol/L) ═ 6.45 × (A)₅₃₂-A₆₀₀)-0.56×A₄₅₀

The results are shown in FIG. 17D, where it can be seen that ZmACY-1 transformed benthic-tobacco has a stronger peroxidase activity after salt and drought stress than wild benthic-tobacco.

(2) Determination of relative conductivity

Shearing about 0.2g of the leaves of the raw tobacco, transferring the leaves into a test tube, adding 20mL of deionized water until the leaves are immersed, standing at room temperature for 4h, fully shaking up, and measuring the conductivity of the leaves to be R by using a conductivity meter₁Boiling in boiling water bath for 25min, cooling, shaking, and measuring electric conductivity R again₂ ^[6]。

Relative conductivity ═ R₁/R₂×100％

Results referring to fig. 17E, it can be seen that the relative conductivity of the ZmACY-1 transformed benthic-tobacco was much stronger after salt and drought stress than the wild benthic-tobacco.

(3) Determination of protective enzyme Activity

Extracting a crude enzyme solution: shearing 0.2g of the Nicotiana benthamiana leaves, putting the Nicotiana benthamiana leaves into a mortar, adding 2mL of precooled 0.1mol/L Tris-HCL buffer solution, sucking the mixture into a 2mL centrifuge tube after grinding, washing the rest substances in the mortar with 1mL of buffer solution, and sucking the substances into the centrifuge tube. Centrifuging at 8,000rpm at 4 deg.C for 30min, collecting supernatant as crude enzyme solution, packaging, and storing in refrigerator at-20 deg.C.

① determination of superoxide dismutase (SOD) Activity

The SOD activity is measured by Nitrogen Blue Tetrazolium (NBT) method, and the absorbance of the sample at 560nm is measured by enzyme-labeling instrument^[7]. SOD activity (U/mg protein) ═ A₀-A)×V_T×(0.5A₀×W×V₁) (ii) a Wherein A is₀: the light absorption value of the control tube at 560 nm; a: the light absorption value of a sample tube at 560 nm; v_T: total volume of enzyme extract (mL); v₁: volume of enzyme solution (mL) added at the time of measurement; w: fresh weight of sample (g).

The results are shown in FIG. 20B, from which it can be seen that ZmACY-1 transformed benthic-tobaccos have stronger peroxidase activity after salt and drought stress than wild benthic-tobaccos.

② Peroxidase (POD) Activity assay

The POD activity was measured by guaiacol chromogenic assay, and the absorbance at 470nm was measured with a microplate reader for a crude enzyme sample (5 times) every 1 min. The change per minute is 0.01 to be 1 enzyme activity unit^[8]。

POD Activity of 10⁵×△A₄₇₀/C·V_S·t；△A₄₇₀: change in light absorption value over reaction time (t); c: concentration of enzyme solution protein (. mu.g/. mu.L); v_S: volume (mL) of enzyme solution taken up at the time of measurement; t: reaction time (min).

The results are shown in FIG. 17A, from which it can be seen that ZmACY-1 transformed benthic-tobaccos have stronger peroxidase activity after salt and drought stress than wild benthic-tobaccos.

③ Catalase (CAT) Activity assay

The crude enzyme solution is subjected to spectrophotometry to determine the absorbance at 470nm, and the absorbance is determined once every 1min (5 times). The change per minute is 0.01 to be 1 enzyme activity unit.

3. Catalase (CAT)

Aspirate 22.5. mu.L of enzyme extract, add 1.5mL of 100mM PBS and 3.75uL of 30% H₂O₂And mixing to eliminate bubble. Absorbance was recorded every 10sec at 240nm, finallyThe absorbance change value represents the magnitude of enzyme activity. The results are shown in FIG. 17C, from which it can be seen that ZmACY-1 transgenic benthic tobacco has a stronger catalase activity after salt and drought stress than wild benthic tobacco.

In summary, under the adverse conditions of salt stress and drought stress, superoxide dismutase (SOD) can transform harmful substances in cells into H₂O₂And O₂And CAT and POD can eliminate the products, so that the three antioxidases can reduce the damage of adversity stress to plants under the synergistic action. MDA is the final breakdown product of lipid peroxidation, and the level of MDA reflects the degree of plant damage. In order to further verify that the drought resistance and salt tolerance of the plants are weakened by the over-expression of ZmACY-1 in the nicotiana benthamiana, the research determines the contents of protective enzymes POD, SOD and CAT, the MDA content and the relative conductivity in leaves of each strain after the leaves are treated for two days by clear water (CK), 20% PEG600 and 350mmol/L NaCl. As a result, it was found that both drought stress and salt stress increased the activities of the protective enzymes POD, SOD and CAT and the MDA content and relative conductivity of the transgenic lines and wild-type nicotiana benthamiana (FIGS. 17A-E). Wherein, under salt stress and drought stress, the activities of protective enzymes POD, SOD and CAT of the transgenic line are lower than that of the wild type, but the MDA content and the relative conductivity are higher than that of the wild type.

Data acquisition 2^-△△CtRelative quantitative analysis method^[9]And (4) calculating. The data were collated using Microsoft Excel 2007 for graphical analysis.

It can be seen that ZmACY-1 transformed Bunsen suffered more severe damage after salt stress and drought stress.

It will be appreciated by those skilled in the art that the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The embodiments disclosed above are therefore to be considered in all respects as illustrative and not restrictive. All changes which come within the scope of or equivalence to the invention are intended to be embraced therein.

Sequence listing

<110> Qingdao agricultural university

<120> use of aminoacylase-1

<130>C1CNCN191049

<160>14

<170>SIPOSequenceListing 1.0

<210>1

<211>439

<212>PRT

<213> corn (Zea mays)

<400>1

Met Pro Pro Pro Leu Arg Cys Leu Leu Leu Ala Phe Val Val Val Leu

1 5 10 15

Ser Gly Phe Pro Arg Leu Ala His Pro Phe Thr Ala Leu Glu Ser Asp

20 25 30

Gln Ile Ala Arg Phe Gln Glu Tyr Leu Arg Ile Arg Thr Ala His Pro

35 40 45

Ser Pro Asp Tyr Ala Gly Ala Ser Ala Phe Leu Leu His Tyr Ala Ala

50 55 60

Ser Leu Gly Leu His Thr Thr Thr Leu His Phe Thr Pro Cys Lys Thr

65 70 75 80

Lys Pro Leu Leu Leu Leu Thr Trp Arg Gly Ser Asp Pro Ser Leu Pro

85 90 95

Ser Val Leu Leu Asn Ser His Met Asp Ser Val Pro Ala Glu Pro Glu

100 105 110

His Trp Ala His Pro Pro Phe Ala Ala His Arg Asp Pro Thr Thr Gly

115 120 125

Arg Ile Tyr Ala Arg Gly Ala Gln Asp Asp Lys Cys Leu Pro Val Gln

130 135 140

Tyr Leu Glu Ala Ile Arg Gly Leu Gln Ala Ala Gly Phe Ala Pro Ala

145 150 155 160

Arg Thr Ile His Ile Ser Leu Val Pro Asp Glu Glu Ile Gly Gly Ala

165 170 175

Asp Gly Phe Asp Lys Phe Ala Arg Ser Glu Glu Phe Arg Ala Leu Asn

180 185 190

Ile Gly Phe Met Leu Asp Glu Gly Gln Ala Ser Pro Thr Asp Val Phe

195 200 205

Arg Val Phe Tyr Ala Asp Arg Leu Val Trp Arg Leu Val Val Lys Ala

210 215 220

Ala Gly Ala Pro Gly His Gly Ser Arg Met Leu Asp Gly Ala Ala Val

225 230 235 240

Asp Asn Leu Met Asp Cys Val Glu Thr Ile Ala Ala Phe Arg Asp Ala

245 250 255

Gln Phe Arg Met Val Lys Ser Gly Glu Lys Gly Pro Gly Glu Val Val

260 265 270

Ser Val Asn Pro Val Tyr Met Lys Ala Gly Ile Pro Ser Pro Thr Gly

275 280 285

Phe Val Met Asn Met Gln Pro Ser Glu Ala Glu Val Gly Phe Asp Leu

290 295 300

Arg Leu Pro Pro Thr Glu Asp Ile Glu Gln Ile Lys Arg Arg Val Glu

305 310 315 320

Glu Glu Trp Ala Pro Ser His Lys Asn Leu Thr Tyr Glu Leu Val Gln

325 330 335

Lys Gly Pro Ala Thr Asp Val Ser Gly Arg Pro Val Ser Thr Ala Thr

340 345 350

Asn Ala Ser Asn Pro Trp Trp Leu Thr Phe Glu Arg Ala Ile Ala Ser

355 360 365

Ala Gly Gly Glu Leu Ser Lys Pro Glu Ile Leu Ser Ser Thr Thr Asp

370 375 380

Ser Arg Phe Ala Arg Gln Leu Gly Ile Pro Ala Leu Gly Phe Ser Pro

385 390 395 400

Met Thr Arg Thr Pro Ile Leu Leu His Asp His Asn Glu Phe Leu Glu

405 410 415

Asp Arg Val Phe Leu Arg Gly Ile Gln Val Tyr Glu His Val Ile Arg

420 425 430

Ala Leu Ser Ser Phe Gln Gly

435

<210>2

<211>1320

<212>DNA

<213> corn (Zea mays)

<400>2

atgccgccgc ctctccgctg tctccttctc gccttcgtcg tcgtcctctc cggcttcccc 60

cgtctcgccc accccttcac ggctctcgag tctgaccaga tcgcccgctt ccaggaatac 120

ctccgcatcc gaactgcgca cccatccccc gactacgccg gcgccagcgc cttcctccta 180

cactacgccg cttcgctcgg tctccacacc accacgctcc acttcacccc gtgcaagacc 240

aagcccctgc tcctcctcac ctggcgaggc tccgatccct ccctcccctc cgtgctcctc 300

aactcccaca tggactccgt ccccgcggag cccgagcact gggcgcaccc tccattcgcc 360

gcgcaccgcg acccgaccac gggccgcatc tacgcgcgcg gcgcacagga cgacaagtgc 420

ctccccgtcc agtacctcga ggcgatccgg ggcctgcagg ccgcggggtt cgctcccgcc 480

cgcaccatcc acatctcgct tgtccccgac gaggagatcg gcggcgcgga tgggttcgac 540

aagttcgccc gatcggagga gttccgcgcc ctcaacatcg ggtttatgct cgacgagggg 600

caggcgtcgc cgacggacgt gttcagagtc ttttacgcgg acaggctggt gtggaggctc 660

gtcgtgaagg cggcgggggc gccagggcat gggtcgagga tgttggacgg cgccgccgtt 720

gacaatttga tggattgcgt ggagaccatc gctgcgttca gggatgcgca gttcaggatg 780

gtgaagtccg gggagaaggg tcctggggag gtggtctcag tcaaccctgt gtacatgaag 840

gccggcatac caagccccac gggtttcgtg atgaacatgc aaccttcagaagcggaggtc 900

ggctttgacc tccgccttcc tccaaccgaa gacatcgagc agatcaagcg gagggtcgaa 960

gaggaatggg caccatctca caaaaacctg acctacgagc tggtgcagaa aggtccggcg 1020

acggatgtgt ccggacgtcc cgtatccaca gcgacgaacg cgtcgaaccc gtggtggctg 1080

acgttcgaga gggccatcgc ctccgcgggt ggggagctgt ctaagcctga gatcctgtct 1140

tcgaccacgg actcacgctt tgcgcggcag ctgggcatcc ctgccctcgg gttttctccg 1200

atgaccagga cgcccatact gctacatgac cataacgagt ttctggaaga cagagtgttc 1260

ctgaggggca tccaagtgta cgaacatgtc atcagagcac taagctcgtt ccaaggctga 1320

<210>3

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgccgccgc cgcctctccg ctgt 24

<210>4

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tcagccttgg aacgagctta gtgc 24

<210>5

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

aagacatcga gcagatcaag c 21

<210>6

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tcgctgtgga tacgggac 18

<210>7

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gctctagaat gccgccgccg cctctccgct gt 32

<210>8

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

cgggatcctc agccttggaa cgagcttagt gc 32

<210>9

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cctcaagaag gttggataca ac 22

<210>10

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

tcttgggctc attaatctgg tc 22

<210>11

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ttgtttctct gcttctggat gg 22

<210>12

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

cttaatgcag cagtgtttgt acca 24

<210>13

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ggcataatag atctggcatt ttcc 24

<210>14

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

tatctaagag catcggtgca gttg 24

Claims

1. Use of aminoacylase-1 for improving plant traits selected from:

the germination rate of plant seeds is improved;

increasing the plant height;

increasing the leaf area;

increasing the stem thickness;

increasing the root length;

increasing the number of blades;

increasing the root area;

increasing pod weight; and

increasing any of the fresh weight of the plant.

2. Use according to claim 1, characterized in that: the aminoacylase-1 is aminoacylase-1 of plant origin;

preferably, the aminoacylase-1 is corn aminoacylase-1;

preferably, the protein of the aminoacylase-1 is selected from the protein shown in SEQ ID NO.1, or the protein which has more than 90 percent of sequence homology with the protein shown in SEQ ID NO.1 and has the enzymatic activity of aminoacylase-1;

preferably, the nucleic acid sequence for coding the aminoacylase-1 is shown as SEQ ID NO. 2;

preferably, the plant trait is tobacco trait;

preferably, the plant trait is a trait improved by increasing the expression level of NBEXPA1 gene and/or NBEIN2 gene.

3. A method for improving a plant trait by transferring an expressible aminoacylase-1 gene into a plant, the improving a plant trait selected from the group consisting of:

the germination rate of plant seeds is improved;

increasing the plant height;

increasing the leaf area;

increasing the stem thickness;

increasing the root length;

increasing the number of blades;

increasing the root area;

increasing pod weight; and

increasing any of the fresh weight of the plant.

4. The method of claim 3, wherein: the aminoacylase-1 is aminoacylase-1 of plant origin;

preferably, the aminoacylase-1 is corn aminoacylase-1;

preferably, the plant trait is tobacco trait;

5. An application of aminoacylase-1 in improving antibacterial polyethylene glycol is disclosed.

6. Use according to claim 5, characterized in that: said bacterial anti-polyethylene glycol is said bacteria grown in a liquid medium containing 1 wt% to 20 wt%, preferably 5 wt% to 15 wt%, polyethylene glycol;

preferably, the aminoacylase-1 is a plant-derived aminoacylase-1;

preferably, the aminoacylase-1 is corn aminoacylase-1;

preferably, the bacterium is escherichia coli, and more preferably, the bacterium is escherichia coli BL 21.

7. A method for improving the polyethylene glycol resistance of bacteria, which is to transfer an expressible aminoacylase-1 gene into the bacteria.

8. Use according to claim 7, characterized in that: said bacterial anti-polyethylene glycol is said bacteria grown in a liquid medium containing 1 wt% to 20 wt%, preferably 5 wt% to 15 wt%, polyethylene glycol;

preferably, the aminoacylase-1 is a plant-derived aminoacylase-1;

preferably, the aminoacylase-1 is corn aminoacylase-1;

preferably, the bacterium is escherichia coli, and preferably, the bacterium is escherichia coli BL 21.

9. A recombinant genetic engineering vector, which contains expressible aminoacylase-1 gene;

preferably, the aminoacylase-1 is a plant-derived aminoacylase-1;

preferably, the aminoacylase-1 is corn aminoacylase-1;

preferably, the recombinant gene engineering vector is a recombinant prokaryotic gene expression vector; preferably, the vector of the recombinant prokaryotic gene expression vector is pET28 a;

preferably, the recombinant gene engineering vector is a recombinant eukaryotic gene expression vector; preferably, the vector of the recombinant eukaryotic gene expression vector is pCAMBIA 1300;

preferably, the recombinant gene engineering vector is a recombinant gene expression shuttle vector.

10. A host comprising the recombinant genetically engineered vector of claim 9;

preferably, the host is a bacterium or a plant;

preferably, the bacterium is escherichia coli, more preferably, escherichia coli BL 21;

preferably, the plant is tobacco.