CN104031927A - Gene OsPRO related to content of fragrance of fragrant rice and application of encoding protein of gene OsPRO - Google Patents
Gene OsPRO related to content of fragrance of fragrant rice and application of encoding protein of gene OsPRO Download PDFInfo
- Publication number
- CN104031927A CN104031927A CN201410251807.2A CN201410251807A CN104031927A CN 104031927 A CN104031927 A CN 104031927A CN 201410251807 A CN201410251807 A CN 201410251807A CN 104031927 A CN104031927 A CN 104031927A
- Authority
- CN
- China
- Prior art keywords
- ospro
- gene
- rice
- fragrance
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the technical field of plant genetic engineering and discloses a gene OsPRO related to content of fragrance of fragrant rice and application of an encoding protein of the gene OsPRO. The cDNA nucleotide sequence of the gene OsPRO is shown in SEQ ID NO:1; and an amino acid sequence of the encoding protein of the gene OsPRO is shown in SEQ ID NO:2. The application refers to application of the gene OsPRO and the encoding protein thereof in improvement of the content of fragrance of fragrant rice. The content of fragrance of fragrant rice in which the gene is introduced is obviously increased, a mechanism for increasing the content of fragrance of fragrant rice through the gene OsPRO is clear, the rice gene OsPRO can be inserted into a multiple cloning site of a plant expression vector to prepare a recombinant expression vector, and a transgenic plant is further constructed. The gene OsPRO has great guide application values for cultivating highly flavored type fragrant rice varieties during production and controlling the content of fragrance of fragrant rice through a transgenic method.
Description
Technical field
The invention belongs to plant gene engineering technology field.More specifically, relate to the relevant gene of a kind of and fragrant rice fragrance content
osPROand the application of proteins encoded.
Background technology
The so-called scented rice of fragrant rice, is the treasure in paddy rice, and fragrant rice is rich in various trace elements, amino acid and protein.Especially eight kinds of necessary amino acid whose content are very abundant, show good nutritional quality.On market, high, the rice matter good famous brand rice of sale price is all mixed with scented rice now, scented rice not only has edible meaning, and have very high economic worth (You Qingru and Huang Tingxu. the research of rice aroma and breeding utilization. Fujian rice wheat science and technology, 2003,20 (3): 30-33).Although the selling price of scented rice is higher more than 2 times than conventional good quality rice, the consumption of world's scented rice, still at increase year after year, has caused each rice producing country scientific research personnel's of the world great attention.So in recent years, India, Pakistan, Japan, Korea S, Thailand, Australia, tw Taiwan, South Africa and Bangladesh etc., strengthening the seed selection process of aromatic rice, so that seize international fragrant rice trade market (Xie Lihong etc. the fragrant rice of Thailand. Chinese agriculture information, 2004, (8): 16-17).
Along with the improving constantly of living standards of the people, China increases year by year and causes the attention of China to fragrant rice research the demand of scented rice in recent years.Particularly Post-WTO rice is unique product benefited in liberalization of trade process in China's grain, from development trend, China by be good quality rice market main beneficiary (Yang Geng. China fine quality rice exploitation current situation and development. Chinese rice, 2001, (5): 11-12), therefore the fragrant rice of exploitation of seizing the opportunity produces, and improves kind of a rice benefit, to making one's country rich and powerful so that its people can enjoy a prosperous life, has important practical significance.In view of fragrant rice has higher edibleness and fabulous market trend, be extremely necessary to carry out the research of fragrant rice fragrance, to improve China's rice in the competitive power of international rice market, advance China's rice industrialization, increase peasant economy income.
Song Wenchang etc. think control fragrant rice fragrance proterties be single recessive gene (Song Wenchang etc. the genetic analysis of autotetraploid and diploid rice fragrance. Acta Agronomica Sinica, 1989,15 (3): 273～277).Ren Guangjun etc. have analyzed the genetic characteristics of the aromatic rices such as Scented lemont, result shows, British plain spirits is dominant character, and show xenia phenomenon (Ren Guangjun and Li Qingmao. the heredity of rice scent. Sichuan Agricultural University's journal, 1994,12 (3): 392-395).Gu Minghong etc. think that meter fragrance is controlled by a pair of recessive key-gene, there are some minor gene participation roles, some combination in show dosage effect (Gu Minghong. cereal crop quality trait Advance in Genetic Studies. Nanjing: Jiangsu science tech publishing house, 1990,93-99).Simultaneously, some investigators point out because of aromatic rice difference, there is difference in the genotype of controlling fragrance, between aromatic rice, there is nonallelic scent gene (Berner and Hoff. In heritance of Scent in American longgra in rice. CropSci. 1986,26 (5): 876-878).Why there are the different opinions to fragrance heredity, may be the implication of F1 to understand differently, the different aromas composition of aromatic rice, the sense organ of fragrance are differentiated inaccurate, cause the deviation of heredity on inferring (Tang Shengxiang. rice breeding is learned. Beijing: Chinese agriculture press, 1996,337-339).
How to guarantee, on the basis of fragrant rice yield and quality, improving the fragrance content of the fragrant rice of China, just becoming the difficult problem that the fragrant rice Breeding and cultivation scientific research personnel of China and the producer face at present.Most scholars is unanimously thought 2-acetyl-1-pyrroline (2-Acetyl-1-pyrroline, be called for short 2-AP) be main component (the Giovanni et al. Identification of microsatellite markers for fragrance in rice by analysis of the rice genome sequence. Molecular Breeding of fragrant rice fragrance, 2002,9:245-250; Sugunya et al.Effects of drying methods and storage time on the aroma and milling quality of rice (Oryza sativar L.) cv. Khao Dawk Mali 105. Food Chemistry, 2004,87:407-414).Someone infers that fragrant rice may contain the biosynthetic anaenzyme of a kind of promotion 2-acetyl-1-pyrroline, and the multiple allelomorphos of single fragrance base can change this kind of enzyme a little, cause and produce the dense rice varieties of diverse fragrant flavour, the change of the various additional steps of pathways metabolism by compound fragrant because causing (Pinson He Xie state Lu. the fragrance heredity of six rice varieties. external crop breeding, 1995, (1): 1-3).Yet, about 2-AP, in fragrant rice body, be that the research how to form is very few.Forefathers find the research of thailand scented rice KDML105, while there is more proline(Pro), ornithine and L-glutamic acid in extracting solution, the content of 2-AP increases, and along with the increase of proline(Pro), the content of 2-AP is (the Tadashi Y. more than 3 times of contrast, Nguyen T., and Hideo I. Precursors of 2-Acetyl-1-pyrroline, a Potent Flavor Compound of an Aromatic Rice Variety. Journal of Agricultural and Food Chemistry, 2002,50:2001-2004).Tracer experiment result shows, the nitrogenous source of 2-AP comes from proline(Pro), so he thinks that proline(Pro) is the synthetic main precursor substance of 2-AP, secondly be L-glutamic acid and ornithine (Jin et al. Tagging of a gene for aroma in rice by R2-APD and RFLP (II). Acta agriculture Zhejiang gensis, 1996,8 (1): 19-23).So far, also about proline(Pro), to 2-AP building-up process and machine-processed research, do not report.
Summary of the invention
The technical problem to be solved in the present invention is the deficiency that overcomes existing paddy rice proline oxidase OsPRO functional study, provides a kind of and fragrant rice fragrance content relevant gene
osPROapplication in improving fragrant rice fragrance content.
The object of this invention is to provide albumen OsPRO that a kind of and fragrant rice fragrance content the is relevant application in improving fragrant rice fragrance content.
Another object of the present invention is to provide a kind of method that fragrant rice fragrance content is transformed.
Still a further object of the present invention is to provide a kind of method of preparing the improved-type transgenic paddy rice of fragrance.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
The invention provides the gene relevant to fragrant rice fragrance content
osPROand with the application of fragrant rice fragrance content associated protein OsPRO in improving fragrant rice fragrance content.
Described gene
osPROcDNA full length sequence as shown in SEQ ID NO:1; The aminoacid sequence of described OsPRO albumen is as shown in SEQ ID NO:2.
In preparation, improve the application in fragrant rice fragrance content medicament with fragrant rice fragrance content associated protein OsPRO, also within protection scope of the present invention.
In addition, the present invention also provides a kind of method that fragrant rice fragrance content is transformed, and is by gene
osPROrice transformation cell, then the rice cell after transforming is cultivated into plant; Described gene
osPROnucleotide sequence as shown in SEQ ID NO:1.
The present invention also provides a kind of method of preparing the improved-type transgenic paddy rice of fragrance, comprises the steps:
S1. construction of expression vector
S11. utilize primer OsPRO-R shown in primer OsPRO-F shown in SEQ ID NO:3 and SEQ ID NO:4, the rice cDNA of take is carried out pcr amplification as template, reclaim, quantitatively, be connected in the plant expression vector of identical double digestion;
S12. connect product after dialysis membrane dialysis (to remove salt ion), transform DH10B competent cell;
S13. with double digestion, detect, contained
osPROthe sun plant expression vector of gene;
S2. transformed calli
S21. utilize agriculture bacillus mediated method, by above-mentioned, contain
osPROthe callus of the plant expression vector rice transformation mature embryo of gene;
S22. the callus after transforming, through pre-differentiation, differentiation, obtains transformed plant.
S3. positive transfer-gen plant is identified
Utilize primer 2 shown in primer 1 shown in SEQ ID NO:5 and SEQ ID NO:6, transformed plant described in S22 is carried out to PCR evaluation, obtain positive transfer-gen plant;
S4. homozygous screening
Positive transfer-gen plant described in S3 is carried out to ectogenesis, extract T1 for rotaring gene plant blade genomic dna, by Southern Blot, detect the copy number that inserts gene, select the transfer-gen plant of single copy to divide individual plant to collect seed, then will after seed germination, utilize Totomycin to screen, what survive be homozygote.
Preferably, described in step S11, plant expression vector is pCAMBIA1380, pCAMBIA3301, pCAMBIA1300, pCAMBIA2301 or pBI121.More preferably, described plant expression vector is pCAMBIA1380; Described in step S11, double digestion is
hindIII and
mlui enzyme is cut.
Preferably, the reaction system cumulative volume connecting described in S11 is 10 μ L, reacts 3h left and right in connecting instrument, connects: 10 ℃ of 3 min, 16 ℃ of 3 min, 18 ℃ of 1 min according to follow procedure; 17 circulations, 65 ℃ of deactivation 5 min.
The method transforming described in S21 is as follows:
(1) by above-mentioned, contain
osPROthe plant expression vector of gene transforms Agrobacterium EHA105 competent cell, after checking is correct, and ℃ preservation of bacterium liquid-80.
(2) a small amount of bacterium of picking streak culture on YM culture medium flat plate (EHA105 microbiotic used is Kan and Chl) from be kept at the bacterium liquid of-80 ℃ of agrobacterium strains EHA105 refrigerator.Being placed in the incubator of 28 ℃ is cultured to and grows single bacterium colony.
(3) select 4～5 of single bacterium colonies and mix in 150 μ L liquid nutrient mediums, on YM culture medium flat plate, be coated with dull and stereotyped.Cultivate after 1 day, scrape appropriate bacterium, the NB liquid nutrient medium that is placed in the 30mL that contains 100 μ mol/L AS carries out constant temperature culture, and (28 ℃, 180rpm), record OD
550nm value is 0.5～0.6 to can be used for infecting of callus.
(4) ready callus is immersed to bacterium liquid 20min, after blotting bacterium liquid with aseptic filter paper, transfer in the culture dish that is lined with aseptic filter paper, 25 ℃, under light, be dried 1 day, transfer to solid and be total to (at an aseptic filter paper of media surface paving) in culture medium, 25 ℃, after cultivating 3 days under dark condition, the callus of common cultivation is transferred in screening culture medium, and screening in every two weeks once, is screened twice.
Described solid altogether culture medium formula is: organic composition+caseinhydrolysate 500mg/L+ inositol 2g/L+ maltose/sucrose 30g/L+ gelatin 0.24% (w/w)+2 of the trace element+B5 medium of the macroelement+B5 medium of MS substratum, 4-D 2mg/L+Syringylethanone 100 μ mol/L, pH5.5.
Described screening and culturing based formulas is: organic composition+caseinhydrolysate 300mg/L+ sucrose 30g/L+ gelatin 0.28% (w/w)+proline(Pro) 500mg/L+2 of trace element+B 5 substratum of the macroelement+B5 medium of N6 substratum, 4-D 2.5mg/L+200mg/L sodium CEZ+200mg/L carbenicillin sodium+Hyg 50mg/L, pH5.8.
Wherein, the macroelement of MS substratum is:
1900mg/L saltpetre (KNO
3)+1650mg/L ammonium nitrate (NH
4nO
3)+170mg/L potassium primary phosphate (KH
2pO
4)+370mg/L magnesium sulfate (MgSO
47H
2o)+440mg/L calcium chloride (CaCl
22H
2o).
The trace element of B5 medium is:
0.75 mg/L KI+3.0 mg/L H
3BO
4+1.0 mg/L MnSO
4·4H
2O+2.0 mg/L ZnSO
4·7H
2O+0.25 mg/L Na
2MoO
4·2H
2O+0.025 mg/L CoCl
2·6H
2O+0.025 mg/L CuSO
4·5H
2O。
The organic composition of B5 medium is:
100 mg/L pyridoxine hydrochloride+10, mg/L nicotinic acid+1.0, mg/L inositol+1.0 mg/L Tyiamine Hds.
The macroelement of N6 substratum is:
2830 mg/L saltpetre (KNO
3)+463 mg/L ammonium sulfate (NH
4sO
4)+166 mg/L calcium chloride (CaCl
22H
2o)+185 mg/L magnesium sulfate (MgSO
47H
2o)+400 mg/L potassium primary phosphate (KH
2pO
4).
The method of breaking up in advance described in S22, breaking up is:
From screening culture medium, select 1～2mm well-grown, compact structure, flaxen resistant calli (removing brownization part), on the culture dish that contains 1～2 layer of aseptic filter paper, 25 ℃, under illumination condition, drying treatment 1 day, then breaking up on its transposition division culture medium, now, the propagation that resistant calli meeting is a large amount of, and there is green point to produce, seedling to be differentiated grows to 3～4cm left and right, cultivating on its transposition Rooting and hardening-off culture base, treat that seedling grows a large amount of root systems, seedling is approximately during 8～10cm, take out seedling, clean substratum, be transplanted to outdoor.
Described differentiation culture based formulas is: organic composition+1mg/L NAA+3mg/L BA+30g/L sucrose+20g/L sorbyl alcohol+200mg/L carbenicillin sodium+200mg/L sodium CEZ+Hyg 50mg/L+0.28% gelatin of the trace element+B5 medium of the macroelement+B5 medium of N6 substratum, pH5.8.
Described Rooting and hardening-off culture based formulas is: 1/2MS+0.5mg/L NAA+0.5mg/L IAA+3mg/L paclobutrazol+15g/L sucrose+0.3% gelatin+200mg/L carbenicillin sodium+200mg/L sodium CEZ+Hyg50mg/L, pH5.8.
Wherein, 1/2MS refers to: 950mg/L saltpetre (KNO
3)+825mg/L ammonium nitrate (NH
4nO
3)+85mg/L potassium primary phosphate (KH
2pO
4)+185mg/L magnesium sulfate (MgSO
47H
2o)+220mg/L calcium chloride (CaCl
22H
2o)+0.415mg/L potassiumiodide (KI)+3.1mg/L boric acid (H
3bO
3)+11.15mg/L manganous sulfate (MnSO
44H
2o)+4.3mg/L zinc sulfate (ZnSO
47H
2o)+0.125mg/L Sodium orthomolybdate (Na
2moO
42H
2o)+0.0125mg/L copper sulfate (CuSO
45 H
2o)+0.0125mg/L cobalt chloride (CoCl
26H
2o)+18.65mg/L disodium ethylene diamine tetraacetate (Na
2eDTA)+13.9mg/L ferrous sulfate (Fe
2sO
47H
2o)+50mg/L inositol+1mg/L glycine+0.05mg/L vitamin (VB1)+0.25mg/L pyridoxine hydrochloride (VB6)+0.25mg/L nicotinic acid (VB5 or VPP).
Preferably, described in S3, the amplification condition of PCR is: 94 ℃ of 2 min; 94 ℃ of 30 sec, 58 ℃ of 30 sec, 72 ℃ of 1 min, 35 circulations; 72 ℃ of 5 min.
In addition, carry paddy gene of the present invention
osPROplant expression vector can also lead by Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity, the conventional biological method such as agriculture bacillus mediated is transformed into vegetable cell or tissue in.The host plant being converted can be paddy rice or other crop.
In addition, use gene of the present invention
osPROwhile building plant expression vector, can also use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser regions can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can synthesize.Translation initiation region can be from transcription initiation region or structural region.
For the ease of transgenic plant cells or plant are identified and are screened, can process plant expression vector used, as being added in plant, express and can produce the enzyme of colour-change or the gene of luminophor (as gus gene, luciferase gene etc.), have the antibiotic marker thing (gentamicin marker, kantlex marker etc.) of resistance or anti-chemical reagent marker gene (as anti-except elegant agent gene) etc.
The present invention, by a large amount of research and exploration, successfully prepares overexpression
osPROthe transgenic paddy rice of gene, and found through experiments, in the PRO activity of this transgenic paddy rice and paddy, the content of fragrance (2-AP) all obviously increases.Clear and definite
osPROrelation and the mechanism of action of gene and fragrant rice fragrance content, for fragrant rice breeding provides theoretical direction, have very large theory and practice and be worth.
The present invention has following beneficial effect:
The invention provides and fragrant rice fragrance content genes involved
osPROand the application of proteins encoded.Described gene
osPROcDNA nucleotide sequence as shown in SEQ ID NO:1; Gene
osPROthe aminoacid sequence of proteins encoded is as shown in SEQ ID NO:2.The present invention is clear and definite
osPROgene can increase fragrant rice fragrance content, and to producing the aromatic rice of upper cultivation Luzhou-flavor, the fragrance content that regulates and controls fragrant rice has the very large using value that instructs.
Fragrant rice of the present invention
osPROgene can be inserted into the multiple clone site of plant expression vector, is prepared into recombinant expression vector, further builds transgenic plant.Experimental result shows, turns
osPROgene plant shows as fragrant rice fragrance (2-AP) content to be increased, and OsPRO albumen and encoding gene thereof have important practical significance to regulating and controlling the content of fragrant rice fragrance (2-AP), in actual applications can be by
osPROgene proceeds in different aromatic rices to cultivate more desirable fragrant rice growing kind, or regulates
osPROthe expression of gene obtains the rice varieties of corresponding fragrant rice fragrance (2-AP) content.OsPRO albumen and encoding gene thereof have wide application and market outlook at agriculture field.
The present invention is also clear and definite
osPROthe OsPRO albumen (proline oxidase) of genes encoding increases the mechanism of fragrant rice fragrance content, wherein under the effect of proline oxidase, proline(Pro) is converted into pyrroline-5-carboxylic acid, this is the first step that proline(Pro) is converted into 2-AP, also be must through a step, more enriched the impact mechanism of fragrant rice fragrance content, for research and the cultivation of aromatic rice provides abundanter approach and target spot.
Accompanying drawing explanation
Fig. 1 is paddy rice
osPROthe amplification electrophorogram of gene; Swimming lane M is that molecular weight marker DL2000 plus(is purchased from TAKARA); Swimming lane 1～3 is goal gene.
Fig. 2 expresses
osPROthe measurement result of the PRO activity of the transgenic paddy rice of gene; WT is wild-type paddy rice cloud round-grained rice excellent 14; Line6 was the Transgenic Rice Plants of expressing OsPRO.
Fig. 3 expresses
osPROthe measurement result of transgenic paddy rice fragrance (2-AP) content of gene; WT is wild-type paddy rice cloud round-grained rice excellent 14; Line6 expresses
osPROtransgenic Rice Plants.
Fig. 4 is the mechanism that proline oxidase affects paddy rice fragrance (2-AP) content.
Embodiment
Below in conjunction with Figure of description and specific embodiment, further illustrate the present invention, but embodiment does not limit in any form to the present invention.Unless stated otherwise, reagent, the method and apparatus that the present invention adopts is the conventional reagent of the art, method and apparatus.
Unless stated otherwise, agents useful for same of the present invention and material are commercial.
The primer synthesizes and examining order is completed by Beijing AudioCodes Bioisystech Co., Ltd.
the fragrant rice of embodiment 1
osPROthe acquisition of gene
1, design of primers
According to NCBI(http: //www.ncbi.nlm.nih.gov/) provide about
osPROhomogenic cDNA primers, primer sequence is as follows:
OsPRO-F(is as shown in SEQ ID NO:3, and underscore is restriction enzyme
hindIII recognition site)
5’ -ACTTGG
AAGCTTCAGGCACAAGTCCGACCTTC- 3'；
OsPRO-R(is as shown in SEQ ID NO:4, and underscore is restriction enzyme
mlui recognition site)
5' -AATATC
ACGCGTTTACCGGAGCAGCTGTCTGT- 3'。
2, pcr amplification
The japonica rice variety cloud round-grained rice seedling leaves cDNA of excellent No. 14 2 weeks of take is template, uses primer OsPRO-F1 and OsPRO-R1 to carry out pcr amplification
osPROgene.Pcr amplification is ordinary method.
After reaction finishes, pcr amplification product is carried out to 1% agarose gel electrophoresis, reclaim the also DNA fragmentation (as shown in Figure 1) of the about 1428bp of purifying left and right.After this fragment purification is reclaimed, be cloned into pMD18-T carrier (purchased from TAKARA company) above, obtain pMD18-T-OsAT1 carrier, send the order-checking of Beijing AudioCodes Bioisystech Co., Ltd, order-checking obtains
osPROgene cDNA full length nucleotide sequence is as shown in SEQ ID NO:1.The aminoacid sequence of its proteins encoded OsPRO is as shown in SEQ ID NO:2.
osPROsuitable restriction enzyme site has been introduced at gene DNA two ends
hindIII and
mlui.
embodiment 2 genetic transformations are identified the function of goal gene
The present embodiment is crossed expression by structure
osPROthe transgenic paddy rice of gene, studies the content of fragrance (2-AP) in its PRO activity and paddy, inquires into
osPROimpact and the mechanism thereof of the fragrant rice fragrance of gene pairs content.
1, construction of expression vector
Will
osPROgene clone enters plant over-express vector pCAMBIA1380(purchased from Australian CAMBIA company) multiple clone site
hindIII and
mlubetween I restriction enzyme site, contained
osPROthe plant expression vector of gene.
(1) structure of expression vector
OsPRO-F and OsPRO-R primer have been introduced respectively
hindiII and
mlutwo restriction enzyme sites of I also have single on composing type carrier pCAMBIA1380
hindiII and
mlui restriction enzyme site, therefore utilizes primer OsPRO-F and OsPRO-R, and the japonica rice variety cloud round-grained rice seedling leaves cDNA of excellent No. 14 2 weeks of take carries out pcr amplification as template, reclaims corresponding with test kit
osPROtotal length object fragment, then through quantitatively, be connected in the pCAMBIA1380 carrier that same enzyme enzyme cuts, ligation system cumulative volume is 10 μ L, reacts 3h left and right in connecting instrument, connects: 10 ℃ of 3 min, 16 ℃ of 3 min, 18 ℃ of 1 min according to follow procedure; 17 circulations, 65 ℃ of deactivation 5 min.
Get connection product and on dialysis membrane, dialyse about half an hour, to remove salt ion, transform DH10B competent cell.The plasmid having loaded after connecting is selected
hindiII and
mluafter I double digestion detects, can find out the about 1.4Kb of the fragment left and right that has cut out corresponding size, so far confirm that OsPRO overexpression recombinant vectors successfully builds.
2, transformed calli
Utilize agriculture bacillus mediated method, by above-mentioned, contain
osPROthe plant expression vector of gene transforms the callus of the mature embryo of excellent No. 14 of japonica rice variety cloud round-grained rice, method articles of reference Hiei et al, Efficient transformation of rice (
oryza satival.) mediated by
agrobacteriumand sequence analysis of the boundaries of the T-DNA. Plant J, 1994,6 (2): 271-282.
Concrete conversion process is as follows:
(1) by above-mentioned, contain
osPROthe plant expression vector of gene transforms Agrobacterium EHA105 competent cell, after checking is correct, and ℃ preservation of bacterium liquid-80.
(2) a small amount of bacterium of picking streak culture on YM culture medium flat plate (EHA105 microbiotic used is Kan and Chl) from be kept at the bacterium liquid of-80 ℃ of agrobacterium strains EHA105 refrigerator.Being placed in the incubator of 28 ℃ is cultured to and grows single bacterium colony.
(3) select 4～5 of single bacterium colonies and mix in 150 μ L liquid nutrient mediums, on YM culture medium flat plate, be coated with dull and stereotyped.Cultivate after 1 day, scrape appropriate bacterium, the NB liquid nutrient medium that is placed in the 30mL that contains 100 μ mol/L AS carries out constant temperature culture, and (28 ℃, 180rpm), record OD
550nm value is 0.5～0.6 to can be used for infecting of callus.
(4) ready callus is immersed to bacterium liquid 20min, after blotting bacterium liquid with aseptic filter paper, transfer in the culture dish that is lined with aseptic filter paper, 25 ℃, under light, be dried 1 day, transfer to solid and be total to (at an aseptic filter paper of media surface paving) in culture medium, 25 ℃, after cultivating 3 days under dark condition, the callus of common cultivation is transferred in screening culture medium, and screening in every two weeks once, is screened twice.
Described YM substratum and NB liquid culture based formulas are with reference to this area conventional formulation.
Described solid altogether culture medium formula is: organic composition+caseinhydrolysate 500mg/L+ inositol 2g/L+ maltose/sucrose 30g/L+ gelatin 0.24% (w/w)+2 of the trace element+B5 medium of the macroelement+B5 medium of MS substratum, 4-D 2mg/L+Syringylethanone 100 μ mol/L, pH5.5.
Described screening and culturing based formulas is: organic composition+caseinhydrolysate 300mg/L+ sucrose 30g/L+ gelatin 0.28% (w/w)+proline(Pro) 500mg/L+2 of trace element+B 5 substratum of the macroelement+B5 medium of N6 substratum, 4-D 2.5mg/L+200mg/L sodium CEZ+200mg/L carbenicillin sodium+Hyg 50mg/L, pH5.8.
(5) callus after conversion breaks up in advance, breaks up
From screening culture medium, select 1～2mm well-grown, compact structure, flaxen resistant calli (removing brownization part), on the culture dish that contains 1～2 layer of aseptic filter paper, 25 ℃, under illumination condition, drying treatment 1 day, then breaking up on its transposition division culture medium, now, the propagation that resistant calli meeting is a large amount of, and there is green point to produce, seedling to be differentiated grows to 3～4cm left and right, cultivating on its transposition Rooting and hardening-off culture base, treat that seedling grows a large amount of root systems, seedling is approximately during 8～10cm, take out seedling, clean substratum, be transplanted to outdoor.
Described differentiation culture based formulas is: organic composition+1mg/L NAA+3mg/L BA+30g/L sucrose+20g/L sorbyl alcohol+200mg/L carbenicillin sodium+200mg/L sodium CEZ+Hyg 50mg/L+0.28% gelatin of the trace element+B5 medium of the macroelement+B5 medium of N6 substratum, pH5.8.
Described Rooting and hardening-off culture based formulas is: 1/2MS+0.5mg/L NAA+0.5mg/L IAA+3mg/L paclobutrazol+15g/L sucrose+0.3% gelatin+200mg/L carbenicillin sodium+200mg/L sodium CEZ+Hyg50mg/L, pH5.8.
Callus after conversion, through pre-differentiation, differentiation, obtains 16 strain transformed plants.
3, positive transfer-gen plant is identified
Above-mentioned 16 strain transformed plants are carried out to PCR evaluation, and PCR primer sequence is as follows:
Primer 1:(is as shown in SEQ ID NO:5)
5’- GACGAAGCTGCCATGGAAAG-3'；
Primer 2: (as shown in SEQ ID NO:6)
5’- AGCTGCCCGGACTCGACGTT -3’；
Pcr amplification condition is: 94 ℃ of 2 min; 94 ℃ of 30 sec, 58 ℃ of 30 sec, 72 ℃ of 1 min, 35 circulations; 72 ℃ of 5 min.
Result demonstration, 16 strain transformed plants are all positive.
4, homozygous screening
Above-mentioned process PCR is accredited as to positive transfer-gen plant and carries out ectogenesis, extract T1 for rotaring gene plant blade genomic dna, by Southern Blot, detect the copy number that inserts gene, select the transfer-gen plant of single copy to divide individual plant to collect seed, then after getting 100 above seed germinations, utilize Totomycin to screen, if do not have death to show that seed isozygotys.
5, the content of fragrance (2-AP) in PRO activity and paddy in transgenic paddy rice
(1) PRO determination of activity
After the transgenic seed and excellent 14 seed germinations of wild-type paddy rice cloud round-grained rice of selecting to have isozygotied, utilize Kimura B nutritive medium (adjusting pH is 4.8) to cultivate paddy rice to 4 leaf phase, the content of PRO activity in sampling and measuring rice leaf.
The concrete formula of described Kimura B nutritive medium is: (NH
4)
2sO
4(0.365mM), KH
2pO
4(0.182 mM), KNO
3(0.183 mM), K
2sO
4(0.086 mM), Ca (NO
3)
2(0.366 mM), MgSO
4(0.548 mM), EDTA-Fe
iII(0.020 mM), MnCl
2 .4H
2o (0.091 * 10
-3mM), ZnSO
4 .7H
2o (0.77 * 10
-3mM), CuSO
4 .5H
2o (0.32 * 10
-3mM), H
3bO
3(0.0462 mM), (NH
4)
6mo
7o
24 .4H
2o (0.145 * 10
-3mM).
Blade PRO activity determination method is as follows:
S1. accurately take rice leaf material 0.2 g and add appropriate liquid nitrogen grinding to become broken end, it is extracting solution (the pH7.4 0.1 mol L of 3 mL that gradation adds total amount
-1potassium phosphate buffer, 0.5% (v/v) triton X-100), continue to grind to form homogenate, 4 ℃, 3000 r min
-1centrifugal 10 min, supernatant liquor had been both proline oxidase liquid.
S2. in centrifuge tube, add successively 0.3 mL reaction system (pH8.0 0.1 mol L
-1potassium phosphate buffer, 0.5% (v/v) triton X-100; 15 mmol L
-1proline(Pro)), 0.15 mmol L
-1cytochrome C 20 μ L, 0.20 mL zyme extract; In 37 ℃ of water-baths, react 30 min.
S3. add 0.5 mL 10% trichoroacetic acid(TCA) stopped reaction, then add 0.4 mL 0.5% alpha-amino group phenyl aldehyde (be dissolved in 95% ethanol in) to develop the color, after reaction 30 min, 9000 r min
-1centrifugal 10 min, colorimetric under 440 nm.
(2) mensuration of fragrance (2-AP) content
After transgenic rice harvests drying, preserve 3 months, survey fragrance (2-AP) content in paddy.The measuring method of fragrance in paddy (2-AP) content is as follows:
S1. utilize distillation extraction instrument simultaneously to carry out distillation extraction, distillation extraction instrument one end flask is put into 50 g brown rice and 145 mL distilled water at the same time, and 100 ℃ add thermal distillation, and the other end flask is put into 50 mL ether, and 40 ℃ add thermal distillation, circulation distillation 90 min.
S2. by leakage place, take out ether extraction liquid, with anhydrous sodium sulphate filtrations of anhydrating, underpressure distillation to 2 mL, mistake 0.2 μ m filter membrane.
S3. get 1 mL in 1.5 mL sample bottles, add 2,4 of 0.2 ppm, 6-trimethylammonium pyrimidine, as interior mark, carries out makings mensuration.
The condition that makings is measured is:
GC-MS：Shimadzu 2010 plus；
Chromatographic column: RESTEK Rxi-5ms length is 30 m, internal diameter 0.32 mm, thickness 0.25 μ m, 220 ℃ of injector temperatures, carrier gas is He gas 2 mLmin
-1, ion source: EI, 70 eV, 350 V; Quality of scanning: 30～160.
Heating schedule: 40 ℃ keep 1 min, is warmed up to 65 ℃ with 2 ℃/min and keeps 1 min, is warmed up to 220 ℃ keeps 10 min with 10 ℃/min.
6, result shows, crosses and expresses
osPROthe positive plant of transfer-gen plant of gene.The PRO activity of transfer-gen plant has improved (as shown in Figure 2) more than 3 times compared with wild-type.Rice harvested drying storage after 3 months, and the content that records fragrance in Transgenic Rice (2-AP) is 2 times more than (as shown in Figure 3) of wild-type.
By above experiment, we have determined
osPROthe expression of gene can increase the content of fragrant rice fragrance, simultaneously also clear and definite
osPROthe mechanism of the fragrant rice fragrance of effect gene content is
osPROgene, by participating in proline(Pro) to the building-up process of 2-AP, affects the content of fragrance in paddy rice (2-AP).
embodiment 3
osPROthe synthesis mechanism of the fragrant rice aroma substance of effect gene 2-AP
1, contriver, through a large amount of research, has explored
osPROthe concrete mechanism of the fragrant rice fragrance of effect gene content, as shown in Figure 4, wherein,
osPROthe OsPRO albumen (proline oxidase) of genes encoding has been brought into play vital effect, and under the effect of proline oxidase, proline(Pro) is converted into pyrroline-5-carboxylic acid, and this is the first step that proline(Pro) is converted into 2-AP, be also must through a step.
2, contriver is by inciting somebody to action
osPROgene RNAi is reticent, builds transgenic paddy rice
(1) vector construction
According to the primers of SEQ ID NO:1, primer sequence is as follows:
OsPRO-RNAi-F(is as shown in SEQ ID NO:7, and underscore is restriction enzyme
bamHi recognition site)
5'-ATAGTA
GGATCCGACGAAGCTGCCATGGAAAG-3'；
OsPRO-RNAi-R(is as shown in SEQ ID NO:8, and underscore is restriction enzyme
hindiII recognition site)
5'-ATATAC
AAGCTT AGCTGCCCGGACTCGACGTT-3'
Take rice cDNA as template, carry out pcr amplification.
Complete in two steps the loading process of composing type RNA interference vector and object fragment:
RNA interference vector pRNAi is presented by the Liu Yaoguang researcher of Agricultural University Of South China, the structure of RNA interference vector pRNAi is with reference to (Hu Xuxia, Liu Yaoguang. the structure of plant RNA interference vector and the application in paddy gene expression silencing thereof. Molecular Plant Breeding, 2006. 5 (4): 621-626).
S1. use
bamhI and
hindtwo kinds of restriction enzymes of III are above-mentioned freeze-draw method and the RNA interference vector pRNAi of double digestion respectively, then through recovery, quantitative, connection.Reaction system cumulative volume is 10 μ L, reacts 3h left and right in connecting instrument, connects: 10 ℃ of 3 min, 16 ℃ of 3 min, 18 ℃ of 1 min according to follow procedure; 17 circulations, 65 ℃ of deactivation 5 min.Get and connect product and on dialysis membrane, dialyse about half an hour, to remove salt ion, Electroporation TOP10 competent cell then.
S2. S1 is verified to the plasmid use of successful connection
mlui and
pstafter I double digestion, reclaim, as carrier; Intron derives from uses primed RNA i-
mlui and RNAi-
psti makes the product of pcr amplification to the plasmid of S1 successful connection; Press 1:3 mixed in molar ratio carrier and intron, then connect, transform DH10B competent cell.
Described primed RNA i-
mlui and RNAi-
psti is RNA interference vector pRNAi
bamhI and
hindthe universal primer of III both sides, sequence is as follows:
RNAi-
mlui(is as shown in SEQ ID NO:9, and underscore is restriction enzyme
mlui recognition site)
5’- GAGA
ACGCGTGGTACCCTTGACCATGGTAG -3’
RNAi-
psti(is as shown in SEQ ID NO:10, and underscore is restriction enzyme
psti recognition site) 5 '-AACTA
cTGCAGgGCCCTCAGATCTACCATGGTC-3 '
(2) vector expression
With reference to 2 and 3 steps in embodiment example 2.
(3) PRO activity, 2-AP content assaying method are with embodiment 2.
The measuring method of pyrroline-5-carboxylic acid content is as follows:
With reference to (2009) such as Wu) method measure the content of pyrroline-5-carboxylic acid, specific as follows:
S1. accurately taking rice leaf material 0.5 g adds appropriate liquid nitrogen grinding to become broken end, it is the extracting solution (PH 8.0 50mM Tris-HCl) of 4 mL that gradation adds total amount, continues to grind to form homogenate, 4 ℃, centrifugal 10 min of 3000 r/min, supernatant liquor had been both proline oxidase liquid.
S2. in centrifuge tube, add successively 0.20 mL zyme extract, the trichoroacetic acid(TCA) (TCA) of 500 μ L 10% mass ratioes, 125 μ L 40 mM 2-aminobenzaldehydes, keep 30min under room temperature, the centrifugal 10min of 8000rpm, in 440nm, measure, molar extinction coefficient is 2.58 mM
1m
1.
Measurement result is as shown in table 1.
Table 1
This is tested all data analyses and all adopts Excel software to carry out standardization to raw data, then with SPSS 19.0 softwares, carries out statistical study.The multiple comparisons of each mean number adopts the least significant difference (LSD), and comparative result adopts labelled notation mark, between two groups of data of same letter, does not reach 5% conspicuous level, between the different two groups of data of mark, reaches 5% conspicuous level.
From table 1 data, PRO activity, the content of pyrroline-5-carboxylic acid and the content of 2-AP are:
osPROthe normal paddy rice > of gene overexpression transgenic paddy rice >
osPROgene RNAi transgenic paddy rice, and there is significant difference, shown
osPROthe OsPRO albumen (proline oxidase) of genetic expression is that proline oxidase can be converted into pyrroline-5-carboxylic acid by catalysis proline(Pro) with the positively related mechanism of 2-AP content, and then synthetic paddy rice aroma substance 2-AP.
SEQUENCE LISTING
<110> Agricultural University Of South China
<120> gene OsPRO relevant to fragrant rice fragrance content and the application of proteins encoded thereof
<130>
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 1428
<212> DNA
The cDNA nucleotide sequence of <213> gene OsPRO
<400> 1
atggccatcg cctcccgcat ccagaagcgc gtgcttgcct ccttcgccgc cgccgccgca 60
gccaagctcc cggaggcggc cgtcgcggcc gccggaggcg ccgcagaggc ggtggaggag 120
gtcgcgtctt ccgtgcagga gcaggtgcag gcgcagggag cgcaggtgtt ggagtttggg 180
gataccgaga ggctgttcgc cggggagagg tcgacgtcgc tggtgcgcac gctcgccgtg 240
ctgcaggcgc tgtcggtggg cccgctcgtg gacgtggcga cggcggcgct gaggtcgccg 300
gcggtggccg ggagcgcggc ggggcgcgcc gcggcgaggg ccaccgcgta ccagcacttc 360
tgcgccgggg agaccgccga ggaggccgcc gcggcggtgc gccgcctctg gcgcggcggc 420
atgggcggga tcctcgacta cggcatcgag gacgccgagg acggccccgc ctgcgaccgc 480
aacgccgccg gattcctcgc cgccatcgac gtcgccgccg cgctgcctcc tggctcggcg 540
agcgtgtgca tcaagatcac ggcgctgtgc ccggtcgcgt tgctggagaa ggcgagtgat 600
ctgctgcggt ggcagcagaa gcacccggcg acgaagctgc catggaaagt gcacgggttc 660
ccggtgctgt gcgtctccag cccgctgtac ctgacggcgg cggagccgcc ggcgctggag 720
gcggaggagg agagggagct cgagatggcg cacgggcggc tgctggcgat cggcgagcgg 780
tgcgcggagt acgacatccc gctgctggtg gacgccgagt acgccaccgt gcagccggcg 840
atcgactact tcacgttcgc cggcgcgctg gcgttcaacg gcggcgggag gcccatcgtg 900
cacggcaccg tccaggccta cctccgcgac gcgcgcgacc ggctggaggc catggcgcga 960
gcggcgcagg gcgagcgcgt gtgcctcgcg ctcaagctgg tccgcggcgc gtacctggcg 1020
cgcgaggccc gcctcgcggc ctccctcggc gtgccgtcgc cggtccaccg cagcatccag 1080
gacacccacg actgctacaa cggctgcgcc gcgttcctcc tcgaccgcgt ccgccgcggc 1140
gccgccgccg tgacgctcgc cacgcacaac gtcgagtccg ggcagctcgc cgcggcgagg 1200
gcgctggagc tcggcatcgg cggcggcggc gaccgcggcc tgcagttcgc gcagctgatg 1260
ggcatggcgg atggcctctc gctcggcctc cgcaacgccg ggttccaggt gagcaagtac 1320
ctgccgtacg gtccagtgga gcagatcatc ccgtacctca tcagacgagc agaggagaac 1380
aggggattgc tctcgtcttc ctccttcgac agacagctgc tccggtaa 1428
<210> 2
<211> 475
<212> PRT
The aminoacid sequence of <213> gene OsPRO proteins encoded
<400> 2
Met Ala Ile Ala Ser Arg Ile Gln Lys Arg Val Leu Ala Ser Phe Ala
1 5 10 15
Ala Ala Ala Ala Ala Lys Leu Pro Glu Ala Ala Val Ala Ala Ala Gly
20 25 30
Gly Ala Ala Glu Ala Val Glu Glu Val Ala Ser Ser Val Gln Glu Gln
35 40 45
Val Gln Ala Gln Gly Ala Gln Val Leu Glu Phe Gly Asp Thr Glu Arg
50 55 60
Leu Phe Ala Gly Glu Arg Ser Thr Ser Leu Val Arg Thr Leu Ala Val
65 70 75 80
Leu Gln Ala Leu Ser Val Gly Pro Leu Val Asp Val Ala Thr Ala Ala
85 90 95
Leu Arg Ser Pro Ala Val Ala Gly Ser Ala Ala Gly Arg Ala Ala Ala
100 105 110
Arg Ala Thr Ala Tyr Gln His Phe Cys Ala Gly Glu Thr Ala Glu Glu
115 120 125
Ala Ala Ala Ala Val Arg Arg Leu Trp Arg Gly Gly Met Gly Gly Ile
130 135 140
Leu Asp Tyr Gly Ile Glu Asp Ala Glu Asp Gly Pro Ala Cys Asp Arg
145 150 155 160
Asn Ala Ala Gly Phe Leu Ala Ala Ile Asp Val Ala Ala Ala Leu Pro
165 170 175
Pro Gly Ser Ala Ser Val Cys Ile Lys Ile Thr Ala Leu Cys Pro Val
180 185 190
Ala Leu Leu Glu Lys Ala Ser Asp Leu Leu Arg Trp Gln Gln Lys His
195 200 205
Pro Ala Thr Lys Leu Pro Trp Lys Val His Gly Phe Pro Val Leu Cys
210 215 220
Val Ser Ser Pro Leu Tyr Leu Thr Ala Ala Glu Pro Pro Ala Leu Glu
225 230 235 240
Ala Glu Glu Glu Arg Glu Leu Glu Met Ala His Gly Arg Leu Leu Ala
245 250 255
Ile Gly Glu Arg Cys Ala Glu Tyr Asp Ile Pro Leu Leu Val Asp Ala
260 265 270
Glu Tyr Ala Thr Val Gln Pro Ala Ile Asp Tyr Phe Thr Phe Ala Gly
275 280 285
Ala Leu Ala Phe Asn Gly Gly Gly Arg Pro Ile Val His Gly Thr Val
290 295 300
Gln Ala Tyr Leu Arg Asp Ala Arg Asp Arg Leu Glu Ala Met Ala Arg
305 310 315 320
Ala Ala Gln Gly Glu Arg Val Cys Leu Ala Leu Lys Leu Val Arg Gly
325 330 335
Ala Tyr Leu Ala Arg Glu Ala Arg Leu Ala Ala Ser Leu Gly Val Pro
340 345 350
Ser Pro Val His Arg Ser Ile Gln Asp Thr His Asp Cys Tyr Asn Gly
355 360 365
Cys Ala Ala Phe Leu Leu Asp Arg Val Arg Arg Gly Ala Ala Ala Val
370 375 380
Thr Leu Ala Thr His Asn Val Glu Ser Gly Gln Leu Ala Ala Ala Arg
385 390 395 400
Ala Leu Glu Leu Gly Ile Gly Gly Gly Gly Asp Arg Gly Leu Gln Phe
405 410 415
Ala Gln Leu Met Gly Met Ala Asp Gly Leu Ser Leu Gly Leu Arg Asn
420 425 430
Ala Gly Phe Gln Val Ser Lys Tyr Leu Pro Tyr Gly Pro Val Glu Gln
435 440 445
Ile Ile Pro Tyr Leu Ile Arg Arg Ala Glu Glu Asn Arg Gly Leu Leu
450 455 460
Ser Ser Ser Ser Phe Asp Arg Gln Leu Leu Arg
465 470 475
<210> 3
<211> 32
<212> DNA
<213> primer OsPRO-F
<400> 3
acttggaagc ttcaggcaca agtccgacct tc 32
<210> 4
<211> 32
<212> DNA
<213> primer OsPRO-R
<400> 4
aatatcacgc gtttaccgga gcagctgtct gt 32
<210> 5
<211> 20
<212> DNA
<213> primer 1
<400> 5
gacgaagctg ccatggaaag 20
<210> 6
<211> 20
<212> DNA
<213> primer 2
<400> 6
agctgcccgg actcgacgtt 20
<210> 7
<211> 32
<212> DNA
<213> primer OsPRO-RNAi-F
<400> 7
atagtaggat ccgacgaagc tgccatggaa ag 32
<210> 8
<211> 32
<212> DNA
<213> OsPRO-RNAi-R
<400> 8
atatacaagc ttagctgccc ggactcgacg tt 32
<210> 9
<211> 30
<212> DNA
<213> primed RNA i-MluI
<400> 9
gagaacgcgt ggtacccttg accatggtag 30
<210> 10
<211> 33
<212> DNA
<213> RNAi-PstI
<400> 10
aactactgca gggccctcag atctaccatg gtc 33
Claims (7)
1. with fragrant rice fragrance content genes involved
osPROapplication in improving fragrant rice fragrance content; Described gene
osPROcDNA full length sequence as shown in SEQ ID NO:1.
2. with the application of fragrant rice fragrance content associated protein OsPRO in improving fragrant rice fragrance content; The aminoacid sequence of described OsPRO albumen is as shown in SEQ ID NO:2.
3. in preparation, improve the application in fragrant rice fragrance content medicament with fragrant rice fragrance content associated protein OsPRO.
4. a method of fragrant rice fragrance content being transformed, is characterized in that, by gene
osPROrice transformation cell, then the rice cell after transforming is cultivated into plant; Described gene
osPROnucleotide sequence as shown in SEQ ID NO:1.
5. a method of preparing the improved-type transgenic paddy rice of fragrance, is characterized in that, comprises the steps:
S1. construction of expression vector
S11. utilize primer OsPRO-R shown in primer OsPRO-F shown in SEQ ID NO:3 and SEQ ID NO:4, the rice cDNA of take is carried out pcr amplification as template, reclaim, quantitatively, be connected in the plant expression vector of identical double digestion;
S12. connect product after dialysis membrane dialysis, transform DH10B competent cell;
S13. double digestion detects, and is contained
osPROthe sun plant expression vector of gene;
S2. transformed calli
S21. utilize agriculture bacillus mediated method, by above-mentioned, contain
osPROthe callus of the plant expression vector rice transformation mature embryo of gene;
S22. the callus after transforming, through pre-differentiation, differentiation, obtains transformed plant;
S3. positive transfer-gen plant is identified
Utilize primer 2 shown in primer 1 shown in SEQ ID NO:5 and SEQ ID NO:6, transformed plant described in S22 is carried out to PCR evaluation, obtain positive transfer-gen plant;
S4. homozygous screening
Positive transfer-gen plant described in S3 is carried out to ectogenesis, extract T1 for rotaring gene plant blade genomic dna, by Southern Blot, detect the copy number that inserts gene, select the transfer-gen plant of single copy to divide individual plant to collect seed, then will after seed germination, utilize Totomycin to screen, what survive be homozygote.
6. prepare according to claim 5 the method for the improved-type transgenic paddy rice of fragrance, it is characterized in that, plant expression vector is pCAMBIA1380, pCAMBIA3301, pCAMBIA1300, pCAMBIA2301 or pBI121 described in step S11.
7. prepare according to claim 6 the method for the improved-type transgenic paddy rice of fragrance, it is characterized in that, described plant expression vector is pCAMBIA1380; Described in step S11, double digestion is
hindIII and
mlui enzyme is cut.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410251807.2A CN104031927A (en) | 2014-06-09 | 2014-06-09 | Gene OsPRO related to content of fragrance of fragrant rice and application of encoding protein of gene OsPRO |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410251807.2A CN104031927A (en) | 2014-06-09 | 2014-06-09 | Gene OsPRO related to content of fragrance of fragrant rice and application of encoding protein of gene OsPRO |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104031927A true CN104031927A (en) | 2014-09-10 |
Family
ID=51462923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410251807.2A Pending CN104031927A (en) | 2014-06-09 | 2014-06-09 | Gene OsPRO related to content of fragrance of fragrant rice and application of encoding protein of gene OsPRO |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104031927A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109444314A (en) * | 2018-11-28 | 2019-03-08 | 中国农业科学院作物科学研究所 | The method and application of -1 pyrrolin content of soybean odor characteristic compound 2- acetyl group are quickly analyzed using GC-MS method |
| CN111662890A (en) * | 2020-07-27 | 2020-09-15 | 洛阳师范学院 | OsProDH gene and application thereof in negative regulation of rice heat resistance |
| CN116200405A (en) * | 2022-10-12 | 2023-06-02 | 广东省农业科学院水稻研究所 | Gene OsPAO4 for regulating content of rice aroma substances and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102027995A (en) * | 2010-10-26 | 2011-04-27 | 华南农业大学 | Flavor enhancer for fragrant rice and application method of flavor enhancer |
-
2014
- 2014-06-09 CN CN201410251807.2A patent/CN104031927A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102027995A (en) * | 2010-10-26 | 2011-04-27 | 华南农业大学 | Flavor enhancer for fragrant rice and application method of flavor enhancer |
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "putative praline oxidase [oryza sativa japonica group]", 《GENBANK：AAG13467.1》 * |
| 傅曼琴: "水稻脯氨酸代谢途径中关键基因与其香味的相关性研究", 《华南师范大学硕士学位论文》 * |
| 段美洋等: "香稻香气形成的生理特性初步研究", 《湖南农业大学学报（自然科学版）》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109444314A (en) * | 2018-11-28 | 2019-03-08 | 中国农业科学院作物科学研究所 | The method and application of -1 pyrrolin content of soybean odor characteristic compound 2- acetyl group are quickly analyzed using GC-MS method |
| CN111662890A (en) * | 2020-07-27 | 2020-09-15 | 洛阳师范学院 | OsProDH gene and application thereof in negative regulation of rice heat resistance |
| CN111662890B (en) * | 2020-07-27 | 2023-03-24 | 洛阳师范学院 | OsProDH gene and application thereof in negative regulation of rice heat resistance |
| CN116200405A (en) * | 2022-10-12 | 2023-06-02 | 广东省农业科学院水稻研究所 | Gene OsPAO4 for regulating content of rice aroma substances and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0559729A4 (en) | Control of plant cell proliferation and growth | |
| CN107602681A (en) | The wide gene GW5L of rice grain and its application | |
| CN114014917B (en) | FvbHLH36 protein, and encoding gene and application thereof | |
| CN109111514A (en) | And the breeding method and its relevant biological material of the transgenic wheat of anti-banded sclerotial blight and root rot | |
| CN110468150B (en) | Application of RGS1 gene as negative regulatory factor in improving tomato bacterial leaf spot resistance in low-irradiation environment | |
| CN115873086A (en) | Tomato transcription factor SlWOX13 gene and protein and application thereof | |
| CN109295070A (en) | A kind of and paddy rice anti contravariance related gene OsDTH1 and its coding albumen and application | |
| Chen et al. | Enhance sucrose accumulation in strawberry fruits by eliminating the translational repression of FabZIPs1. 1 | |
| CN108795956B (en) | Application of GmMDH12 gene in promoting nodulation and nitrogen fixation of soybeans | |
| CN104031927A (en) | Gene OsPRO related to content of fragrance of fragrant rice and application of encoding protein of gene OsPRO | |
| CN107287211B (en) | Tobacco cation/chloride ion co-transport gene and application thereof | |
| CN106749580B (en) | Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application | |
| CN103045639B (en) | Application of AtTGA 4gene in improving plant adverse resistance | |
| CN113512558A (en) | Method for improving resistance of tomatoes to bacterial wilt | |
| CN103570805A (en) | Active polypeptide and application of active polypeptide in plant root growth | |
| CN114752605B (en) | Rice OsOFP22 s Gene and method for increasing grain length, thousand grain weight and improving amylose content of rice by using same | |
| CN111979253A (en) | TrFQR1 gene, clone thereof, expression vector construction method and application | |
| CN104450757B (en) | Adjusting and controlling rice fringe type and the SL genes of grain type and its application | |
| CN111187784B (en) | Use of aminoacylase-1 | |
| CN109234290B (en) | Brassica napus BnKAT2 gene and promoter and application thereof | |
| CN107987139A (en) | A kind of Dof transcription factors and its application in terms of plant salt tolerance is improved | |
| CN106755068B (en) | Application of the amino acid transport gene OsANT1 in rice breeding | |
| CN113373158B (en) | Application of sesame SiWRKY67 gene in regulation and control of melatonin synthesis | |
| CN112430259B (en) | Wheat salt stress related protein TaCSN5, and coding gene and application thereof | |
| CN116622761B (en) | Application of corn auxin response protein IAA15 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140910 |
|
| RJ01 | Rejection of invention patent application after publication |