CN112125966A

CN112125966A - Application of stress-resistance-related protein bHLH85 in regulation and control of plant stress resistance

Info

Publication number: CN112125966A
Application number: CN202011031610.XA
Authority: CN
Inventors: 隋娜; 吴凤慧; 郑洪祥
Original assignee: Shandong Normal University
Current assignee: Shandong Normal University
Priority date: 2020-09-27
Filing date: 2020-09-27
Publication date: 2020-12-25
Anticipated expiration: 2040-09-27
Also published as: CN112125966B

Abstract

The invention provides application of stress-resistance-related protein bHLH85 in regulation and control of plant stress resistance, and belongs to the technical field of biology. The invention reports a salt resistance negative regulation related protein bHLH85 and a coding gene thereof for the first time. According to the invention, researches show that the expression level of the bHLH85 gene in the sweet sorghum is obviously reduced under the condition of salt stress, the bHLH85 gene is introduced into arabidopsis thaliana, and the function identification is carried out on the arabidopsis thaliana, so that the excessive expression of the bHLH85 can increase the number and the length of plant root hairs, the salt resistance of the plant can be reduced, the negative regulation and control effect on the salt resistance of the plant can be shown, and a foundation can be provided for cultivating resistant plants.

Description

Application of stress-resistance-related protein bHLH85 in regulation and control of plant stress resistance

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a stress-resistance-related protein bHLH85 in regulation and control of plant stress resistance.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

In the past, soil salinization is one of the main problems faced by China, and threatens multiple industries such as agriculture, animal husbandry and the like. Salt stress has great influence on the growth and development of plants, and has influence on physiological indexes of the plants, such as growth speed, plant height, biomass and the like. Under salt stress conditions, it initially appears that the growth is slow, leaves yellow, plants are short, biomass is reduced, etc., and when the salt concentration reaches a certain level, even the plants die. Therefore, the reaction mechanism of the plant to the stress is determined, and scientific data is provided for the research and application of the stress-resistant gene engineering. At present, the research on plant stress resistance is gradually deepened to the cellular and molecular level, and combined with the research on genetics and genetic engineering, the plant growth characteristics can be improved by utilizing biotechnology, and the adaptability of plants to stress is further improved.

The transcription factor is a regulatory gene, is an important molecule in a regulatory network, is almost involved in all life processes of organisms through signal transduction and regulation of adversity response genes, wherein bHLH (basic helix-loop-helix) is a large family of transcription factors, is widely involved in plant response to biotic and abiotic stress, and plays a key role in the process of plant response to the stress. However, the inventors found that studies have been mainly conducted on a small number of model organisms such as Arabidopsis thaliana and the like, and studies on bHLH transcription factors in other plants have been very rare.

Disclosure of Invention

In order to overcome the technical problems, the invention provides application of an anti-stress related protein bHLH85 in regulation and control of plant stress resistance. According to the invention, researches show that the expression level of the bHLH85 gene in sweet sorghum is obviously reduced under the condition of salt stress, the bHLH85 gene is introduced into arabidopsis thaliana, and the function identification is carried out on the arabidopsis thaliana, so that the excessive expression of the bHLH85 can increase the number and the length of plant root hairs, the salt resistance of a plant is reduced, and the negative regulation and control effect on the salt resistance of the plant is shown.

In order to achieve the technical purpose, the technical scheme adopted by the invention is as follows:

in a first aspect of the invention, there is provided a protein, designated bHLH85, which is any one of a1) -a3) as follows:

a1) protein shown as a sequence 1 in a sequence table;

a2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 1 in the sequence table, has the same function and is derived from the sequence 1;

a3) the protein which is encoded by other genes and has more than 50 percent of similarity with the amino acid sequence composition shown in the sequence 1 and has the activity of the protein shown in the sequence 1;

the above-mentioned a2), wherein the "substitution and/or deletion and/or addition of one or more amino acid residues" is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The proteins in a1) -a3) can be artificially synthesized, or can be obtained by synthesizing the coding genes and then performing biological expression.

In a second aspect of the invention, nucleic acid molecules encoding the above-described proteins are also within the scope of the invention.

The nucleic acid molecule may be any one of the following DNA molecules b1) to b 4);

b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;

b2) the nucleotide sequence is a DNA molecule shown in a sequence 2 in a sequence table;

b3) a DNA molecule having 75% or more 75% identity to the nucleotide sequence defined by b1) or b2) and encoding the protein bHLH 85;

b4) a DNA molecule which hybridizes with the nucleotide sequence defined by b1) or b2) under strict conditions and codes for the protein bHLH 85.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In addition, recombinant vectors, expression cassettes, transgenic cell lines, host bacteria or transgenic plants which contain a nucleic acid molecule which encodes the protein bHLH85 described above are also within the scope of the present invention. Wherein the host bacteria can be eukaryotic or prokaryotic bacteria, such as, but not limited to, agrobacterium, yeast, escherichia coli, and the like.

The recombinant vector comprises a nucleic acid molecule which encodes the protein bHLH85 and is inserted into an expression vector pROKII-GFP, and is named as pROKII-SbbHLH85-GFP for overexpression of a bHLH85 gene vector.

Primer pairs for amplifying the full length of the nucleic acid molecule encoding the protein bHLH85 or any fragment thereof are also within the scope of the invention. The primer comprises a sequence 3 and a sequence 4 in a sequence table.

The application of the protein, the nucleic acid molecule or the recombinant vector, the expression cassette, the transgenic cell line, the host bacterium or the transgenic plant in regulating and controlling the stress resistance of the plant is also within the protection scope of the invention;

in the application, the regulation and control of the stress resistance of the plants can be the reduction of the stress resistance of the plants or the increase of the stress resistance of the plants; preferably, stress resistance of the plant is increased. According to the invention, the research finds that the deletion or inhibition of bHLH85 gene expression in plants can improve the stress resistance of the plants, and particularly shows that the salt resistance of the plants is improved.

It is emphasized that, in the above applications, the bHLH85 gene includes a gene having a high homology thereto, such as the RSL2 gene in arabidopsis thaliana. And the invention verifies in the embodiment that the homologous gene RSL2 in Arabidopsis has the same function as bHLH 85. Therefore, the protein sequence homologous with the sweet sorghum bHLH85 amino acid sequence, the coding nucleotide sequence and the stress resistance application thereof are all within the protection scope of the invention.

In the above applications, the stress resistance may be salt resistance and/or oxidation resistance.

In particular, increasing salt resistance is manifested by a reduction in the number and length of root hairs of the plant.

In the above application, the plant may be dicotyledonous plant (such as arabidopsis thaliana, cotton, castor-oil plant, pumpkin, peanut, cassava, morning glory, etc.), or monocotyledonous plant (such as sorghum, sweet sorghum, corn, rice, wheat, etc.).

In a fifth aspect of the present invention, there is provided a method for plant breeding, which comprises knocking out or inhibiting the expression of the bHLH85 gene, thereby reducing the number and length of root hairs of a plant and improving stress resistance of the plant.

It is emphasized that, in the above method, the bHLH85 gene includes a gene having a high homology thereto, such as RSL2 gene in Arabidopsis thaliana. And the invention verifies in the embodiment that the homologous gene RSL2 in Arabidopsis has the same function as bHLH 85. Therefore, the protein sequence homologous with the sweet sorghum bHLH85 amino acid sequence, the coding nucleotide sequence and the application of regulating and controlling the stress resistance of plants are all within the protection scope of the invention.

In the above method, the stress resistance may be salt resistance and/or oxidation resistance.

In the above method, the plant may be dicotyledonous plant (such as arabidopsis thaliana, cotton, castor-oil plant, pumpkin, peanut, cassava, morning glory, etc.), or monocotyledonous plant (such as sorghum, sweet sorghum, corn, rice, wheat, etc.).

The beneficial technical effects of one or more technical schemes are as follows:

the technical scheme reports a salt resistance negative regulation related protein bHLH85 and a coding gene thereof for the first time, and particularly, the technical scheme screens a bHLH85 gene from sweet sorghum, reduces the expression level of the gene under a salt treatment condition, introduces the gene into arabidopsis thaliana, and performs functional identification on the gene, so that the overexpression of the bHLH85 causes the number and the length of plant root hairs to be increased, the salt resistance of a plant is reduced, the plant salt resistance is subjected to a negative regulation effect, and a foundation is provided for cultivating resistant plants.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1 is a secondary structure prediction of the sweet sorghum bHLH85 protein in example 1 of the present invention.

FIG. 2 shows the hydrophilicity prediction of the SbbHLH85 protein in example 1 of the present invention.

FIG. 3 shows the signal peptide and transmembrane structure prediction of the SbbHLH85 protein in example 1 of the present invention, A, signal peptide prediction; and B, transmembrane structure prediction.

FIG. 4 shows the functional domains of the SbbHLH85 protein in example 1 of the present invention.

FIG. 5 is a diagram showing the prediction of the tertiary structure of the SbbHLH85 protein in example 1 of the present invention.

FIG. 6 shows the homology analysis of the bHLH85 protein sequence in example 1 of the present invention.

FIG. 7 shows the expression level of SbbHLH85 in roots at different NaCl concentrations in example 2 of the present invention.

FIG. 8 shows the subcellular localization of SbbHLH85 in example 2 of the present invention.

FIG. 9 shows Kanna screening and PCR characterization of Arabidopsis transformed seedlings according to example 3 of the present invention.

FIG. 10 shows T in example 3 of the present invention₃Kana screening of transformed seedlings of Arabidopsis thaliana.

FIG. 11 shows the genomic PCR identification of transgenic Arabidopsis lines in example 3 of the present invention.

FIG. 12 shows the relative expression levels of SbbHLH85 in different transgenic Arabidopsis lines according to the invention in example 3.

FIG. 13 is the expression of RSL2 in Arabidopsis leaves and roots under different salt concentration treatment in example 3 of the present invention, wherein A: leaves; b, root.

FIG. 14 shows the phenotype of Arabidopsis thaliana strains treated with different concentrations of NaCl for 7 days in example 4 of the present invention.

FIG. 15 is a graph showing the effect of NaCl treatment at different concentrations on germination rate and root length of Arabidopsis thaliana lines in example 4 of the present invention.

FIG. 16 is a graph showing the phenotype of individual lines of Arabidopsis thaliana after different treatments for 7d in example 4 of the present invention.

FIG. 17 is a graph showing the effect of different treatments on germination rate and root length of different Arabidopsis lines in example 4 of the present invention.

FIG. 18 is a graph showing the effect of NaCl treatment on the fresh and dry weight of seedlings of different Arabidopsis lines in example 4 of the present invention.

FIG. 19 shows the effect of NaCl treatment on the MDA content in leaves of different Arabidopsis lines in example 4 of the present invention.

FIG. 20 shows the staining of DAB and NBT in the leaves of different Arabidopsis thaliana strains according to the present invention after NaCl treatment.

FIG. 21 shows the expression level of a salt stress-related gene in Arabidopsis thaliana roots in example 4 of the present invention.

FIG. 22 shows the expression level of the salt stress-related gene in Arabidopsis thaliana leaves in example 4 of the present invention.

FIG. 23 is a table showing the root hair phenotype of each strain of Arabidopsis thaliana in example 4 of the present invention.

FIG. 24 is a graph showing the effect of the bHLH85 gene on the number and length of Arabidopsis thaliana root hairs in example 4 of the present invention.

FIG. 25 shows the expression of root hair development-related genes in Arabidopsis roots in example 4 of the present invention.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise. It is to be understood that the scope of the invention is not to be limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention.

In order to make the technical solutions of the present disclosure more clearly understood by those skilled in the art, the technical solutions of the present disclosure will be described in detail below with reference to specific embodiments.

Example 1: bioinformatics analysis of sweet sorghum bHLH85 Gene

1 materials of the experiment

Sweet sorghum (Sb08G019780), and HLH domain sequences of proteins of Japanese rice (LOC107276154), castor bean (LOC8272269), upland cotton (LOC107930558), corn (LOC103653155), pumpkin (LOC111455548), morning glory (LOC 1091699792), cassava (LOC110618953), Arabidopsis (AT4G33880) and the like obtained by BLAST on NCBI.

The data are derived from the bHLH85 protein of the salt-tolerant high-sugar-content inbred line M-81E of the sweet sorghum from the NCBI website and the BLAST results of the bHLH85 structural domains of other species.

2 method of experiment

Firstly, finding a cDNA sequence of a sweet sorghum gene bHLH85 on an NCBI website, translating the cDNA sequence into an amino acid sequence, and then analyzing the primary structure, hydrophobicity and the like of protein by utilizing ExPASy software according to the amino acid sequence; performing three-level structure analysis on the protein by using SWISS-MODEL online software; the prediction and analysis of the transmembrane domain of the protein were performed using TMHMM software. Finally, homologous sequences of the SbbHLH85 are obtained from NCBI website BLASTp, and then the homologous sequences are constructed into a phylogenetic tree reflecting the genetic relationship by using DNMAN and other software.

3 results and analysis of the experiments

3.1 analysis of the amino acid sequence of SbbHLH85 and its physicochemical Properties

MEAGGLITEVGWTEFDFLSHGEESEAMMAQLLGAFPSHADEGQHELLHWPDQASNAYSDSIPPSCGGYYFLSNSNEALGSSSCTAPTDALPFQEEHGAGAAEYLDVTANHSFNCYGNGDPSYEDLDDPMSVSMLGSISTAPDKSKRKHMVEERDGQTQKRGRKSARNVGEAKRAKRAKKSGDEDSSMAIRNGSPTSCCTSDSDSNASLESADGDGDADARRPKGKGRAGRSATTEPQSIYARKRRERINERLKILQNLVPNGTKVDISTMLEEAVHYVKFLQLQLRLLSSDDTWMYAPIAYNGMNIGIGIDLNMDR(SEQ ID NO.1)

The gene registration number of SbbHLH85 is Sb08g019780, and the total code number of the SbbHLH85 is 951 bases and 316 amino acids.By analyzing the physicochemical properties of the sequence, the theoretical isoelectric point (pI) of the sequence is 5.05, and the molecular weight: 34429.93. the molecular Formula (Formula) of the SbbHLH85 protein is C₁₄₆₅H₂₃₀₀N₄₃₂O₄₉₇S₁₆And a total of 4710 atoms. The serine (Ser) accounts for the highest proportion, reaching 11.1 percent. There are 48 negatively charged residues (Asp + Glu) and 34 positively charged residues (Arg + Lys). Average hydrophilicity of the protein (GRAVY): -0.715, aliphatic index: 60.95, instability index 52.62, greater than 40, indicates protein instability.

The sequence of the SbbHLH85 gene is as follows:

ATGGAGGCTGGAGGGTTGATCACCGAGGTCGGTTGGACCGAGTTCGACTTCCTGTCGCACGGCGAGGAGTCGGAGGCGATGATGGCGCAGCTGCTCGGTGCCTTCCCGTCCCATGCCGATGAAGGTCAACATGAGCTGCTGCATTGGCCTGATCAAGCTTCCAATGCATACAGTGACAGTATCCCACCTTCATGTGGGGGCTACTATTTTTTGAGCAACTCAAATGAGGCCCTTGGGAGCAGCTCCTGCACTGCACCAACAGATGCCCTGCCGTTTCAGGAGGAGCATGGTGCAGGTGCAGCTGAGTACCTGGATGTGACTGCAAACCATTCCTTCAACTGTTATGGGAATGGTGATCCGAGCTATGAGGATCTGGATGATCCGATGAGCGTCAGCATGCTTGGCTCAGTAAGCACCGCTCCAGACAAGAGCAAGAGGAAGCACATGGTAGAAGAACACGATGGCCAAACCCAAAAGAGGGGCCGGAAAAGCGCGCGGAATGTTGGTGAAGCTAAGCGAGCCAAGAGGGCCAAGAAGAGTGGAGACGAAGACTCCAGCATGGCCATCCGGAATGGAAGCCCGACCAGCTGCTGCACCTCTGACAGCGATTCAAATGCCTCTCTGGAGTCTGCAGATGGCGATGGCGATGCCGATGCTCGTCGTCCCAAAGGCAAGGGCCGGGCAGGCCGTAGCGCGACGACTGAACCCCAGAGCATCTATGCAAGGAAGAGGAGGGAGAGGATCAATGAGAGGCTGAAGATCCTGCAGAACCTGGTGCCCAACGGGACCAAGGTGGACATCAGCACCATGCTTGAGGAGGCAGTGCACTACGTGAAGTTCCTGCAGCTCCAGATCAGGCTCCTGAGCTCTGACGACACGTGGATGTATGCGCCCATCGCGTACAACGGGATGAACATCGGCATCGGGATCGATCTCAACATGGACAGATGA(SEQ ID NO.2)

3.2 Secondary Structure analysis of the SbbHLH85 protein

The most common secondary structures of proteins are alpha-helices and beta-sheets, in addition to which the secondary structure of the protein includes beta-turns, random coils, etc. The secondary structure of SbbHLH85 protein was predicted by Sopma online software, and as can be seen from the analysis in fig. 1, the proportion of Random coil (Random coil) in the secondary structure of SbbHLH85 protein was 62.66% at the maximum, 23.42% in the second order of α -helix (Alpha helix), 10.44% in the second order of β -sheet (Extended strand), and 3.48% in the minimum order of β -turn (Beta turn).

3.3 analysis of the hydrophilicity and hydrophobicity of the SbbHLH85 amino acid sequence

The hydrophilicity and the hydrophobicity of the target protein are analyzed through software, and the hydrophilicity of the SbbHLH85 protein is predicted in figure 2, and from the amino acid distribution of the protein in the figure, a negative value region is obviously larger than a positive value region, and the protein is indicated to be a hydrophilic protein according to the rule that the hydrophilicity is stronger when the amino acid value is lower, and the hydrophobicity is stronger when the amino acid value is higher, and vice versa. Therefore, the protein encoded by SbbHLH85 is a hydrophilic protein.

3.4SbbHLH85 Signal peptide and transmembrane Structure prediction and analysis

From the analysis in FIG. 3, it was found that the SbbHLH85 protein had no signal peptide present. It has no transmembrane region, so that the SbbHLH85 protein has no transmembrane helical region and is a mature protein which is secreted to the outside of cells.

3.5 conserved Domain of SbbHLH85 protein

As can be seen from the analysis in FIG. 4, the SbbHLH85 protein has a typical HLH conserved domain between amino acids 238-287, so that the SbbHLH85 protein belongs to the bHLH family.

3.6 prediction of the tertiary Structure of the SbbHLH85 protein

As can be seen from the analysis in fig. 5, the tertiary structure of SbbHLH85 protein is further coiled and folded on the basis of the secondary structure to form a specific basic/Helix-Loop-Helix (basic/Helix-Loop-Helix) region, and different protein structural elements are represented by different colors, thereby further indicating that SbbHLH85 belongs to the bHLH family.

3.7 homology analysis of the SbbHLH85 protein with proteins of other species

And (3) carrying out homology analysis on the amino acid sequence coded by the cloned sweet sorghum bHLH85 gene and the amino acid sequences of homologous genes in other plants. As shown in FIG. 6, it was found that the amino acid sequence of SbbbHLH 85 has high homology with the subspecies of Japanese rice, impatiens balsamina and Musa basjoo and low homology with bHLH85 in Arabidopsis thaliana by analyzing the phylogenetic tree. The results show that the sweet sorghum bHLH85 has a close relationship with japonica rice, impatiens balsamina and plantain subspecies and a far relationship with arabidopsis thaliana.

Example 2 cloning, vector construction and subcellular localization of the sorghum saccharatum bHLH85 Gene

1 Experimental materials and Material treatment

1.1 Experimental materials

The method comprises the following steps of (1) salt-tolerant high-sugar-content sweet sorghum inbred line M-81E seeds (new seeds in the previous year), Bunsen tobacco seeds, pEASY-Blunt3 simple cloning vector, pROKII-GFP expression vector (driven by CaMV35S promoter), DH5 alpha escherichia coli strain, GV3101 agrobacterium strain and the like.

1.2 treatment of materials

And selecting the sweet sorghum salt-tolerant inbred line M-81E seeds with consistent size and complete and full seeds, placing the seeds in a net bag, and washing the seeds for about 10 hours by running water. And cleaning river sand, and filling the river sand into flowerpots with uniform sizes for later use. And then uniformly sowing the washed seeds in a flowerpot, sowing 8 seeds in each pot, placing in a greenhouse, and watering for 1 time every day until seedlings emerge. And (3) after emergence, changing to 1/2Hoagland nutrient solution for watering, thinning when the seedlings grow to 3-leaf stage, selecting 5 seedlings with good and consistent growth vigor in each pot, and pulling out the rest seedlings. After that, irrigation with complete Hoagland nutrient solution was started, and salt treatment was carried out when the cells grew to 3 leaves and 1 heart. Complete Hoagland nutrient solutions with 0mM, 50mM, 100mM, 150mM and 200mM NaCl concentrations were prepared to treat the seedlings, respectively, and the NaCl solutions were gradually increased in a gradient of 50mM to prevent salt shock effects, and treatment was continued for 48h after reaching the final concentration.

2 method of experiment

2.1 Collection of materials and preservation

Taking down the treated sweet sorghum material, removing parts with poor vigor such as yellow leaves, wilting and the like, cleaning with clear water, cleaning with deionized water once, then sucking water on the surface of the plant with absorbent paper, and cutting the material into small sections with scissors for later use. 0.1g of the material was weighed into a sterilized 1.5mL EP tube, then snap frozen with liquid nitrogen, and stored in a freezer at-80 ℃.

2.2 extraction of RNA

RNA was extracted using a rapid universal plant RNA extraction kit 3.0 from Biotech, Inc., of Beijing Huayuyo.

2.3 Synthesis of cDNA

The extracted RNA was reverse transcribed into cDNA using the Vazyme reverse transcription kit (R212).

2.4 analysis of expression of the sorghum saccharatum bHLH85 Gene under salt treatment at various concentrations

Finding the sequence of the sweet sorghum bHLH85 gene from an NCBI website according to the gene number Sb08g019780, designing a primer of fluorescence quantitative PCR according to a cDNA sequence by using Beacon Designer7 software, wherein an internal reference primer selects Sb beta-actin gene, and the primer sequence is as follows:

Sb actin-S:ACGGCCTGGATGGCGACGTACATG(SEQ ID NO.5)

Sb actin-A:GCAGAAGGACGCCTACGTTGGTGAC(SEQ ID NO.6)

85-S:ATGCAAGGAAGAGGAGGGAGAG(SEQ ID NO.7)

85-A:GAGCCTGATCTGGAGCTGC(SEQ ID NO.8)

preparing a fluorescent quantitative PCR reaction system.

2.5 cloning of the full Length sweet sorghum bHLH85 Gene

Primers for gene cloning were designed based on the CDS sequence of the sweet sorghum bHLH85 gene. Two restriction sites, XbaI and KpnI, were selected in the expression vector pROK II-GFP and added to the 5' ends of the forward and reverse primers, respectively. The specific primers are as follows:

bHLH85-F:GCTCTAGAATGGAGGCTGGAGGGTTGAT(SEQ ID NO.3)

bHLH85-R:GGGGTACCTCTGTCCATGTTGAGATCGATCC(SEQ ID NO.4)

and (3) configuring a 25 mu L PCR reaction system by taking the cDNA as a template and the bHLH85-F, bHLH85-R as a primer, and carrying out PCR reaction on the target fragment. Connecting and transforming the target fragment with pEASY-Blunt3 Vector, taking the screened positive clone single colony as a template, carrying out colony PCR verification by using two primers for cloning the bHLH85 target fragment, selecting a bacterial liquid storage strain with correct sequencing, and storing the bacterial liquid storage strain in a refrigerator at the temperature of minus 80 ℃ for a long time. Then, the residual bacterial liquid is subjected to Plasmid extraction by using a TIANPrep Mini Plasmid Kit (centrifugal column type), and the specific steps are carried out according to the instruction. 1 mu L of plasmid solution is sampled on a NanoDrop 2000 nucleic acid protein detector, and the concentration and purity of the extracted plasmid are detected.

2.6 construction of expression vectors

The expression vector used in this experiment was pROK II-GFP. Selecting two restriction sites of XbaI and KpnI, carrying out double restriction on the extracted plasmid and the expression vector respectively, connecting the target fragment bHLH85 with the expression vector pROKII-GFP to obtain a pROKII-SbbHLH85-GFP connecting product, and transforming the pROKII-SbbHLH85-GFP connecting product into escherichia coli (DH5 alpha). Because of the kanamycin resistance in the expression vector, 50mg/mL of kanamycin antibiotic was added to the medium to select successfully transformed E.coli. After culturing, selecting the positive single colony of the escherichia coli for PCR verification. And carrying out agarose gel electrophoresis on the obtained PCR product, then carrying out liquid culture on the positive single colony of the target fragment, and finally sending the obtained bacterial liquid to sequencing to verify whether the bacterial liquid is the target gene. The bacterial liquid with correct sequencing is firstly preserved by glycerol, then expression vector plasmids are extracted, and the extracted plasmids are preserved in a refrigerator at the temperature of 20 ℃ below zero according to the specification of the kit.

2.7 transformation of Agrobacterium with expression vector

And (3) uniformly mixing 10 mu L of pROKII-SbbHLH85-GFP connection product with 100 mu L of agrobacterium competent cell GV3101, carrying out transformation culture, and selecting a positive single colony of the agrobacterium competent cell GV3101 for PCR verification, wherein the specific method is as above. And carrying out agarose gel electrophoresis on the obtained PCR product, then carrying out liquid culture on the positive single colony of the target fragment, and finally sending the obtained bacterial liquid to sequencing to verify whether the bacterial liquid is the target gene.

2.8 subcellular localization analysis of SbbHLH85

The experiment adopts a tobacco instantaneous transformation method, selects a seedling of the bengeneration tobacco, injects agrobacterium liquid with a target gene into the tobacco, observes the positioning condition of the target gene, and refers to an experimental operation method of Wu Yingjie and the like (2010).

3 results and analysis of the experiments

3.1 expression levels of the sorghum saccharatum bHLH85 Gene under salt treatment at different concentrations

The expression level of the bHLH85 gene in the sweet sorghum M81-E is determined after the sweet sorghum is treated for 48 hours by different salt concentrations, so that the expression level of the bHLH85 is reduced under the salt treatment condition, wherein the expression level is the lowest under the treatment of 100mM NaCl. The sweet sorghum bHLH85 gene may play a negative regulatory role in salt stress response.

3.2 cloning of the sorghum saccharatum bHLH85 Gene

The sbbHLH85 gene was amplified with bHLH85-F, bHLH85-R primers, the target bands were 951bp each, the resulting product DNA was ligated with the cloning vector pEASY-Blunt3 after gel recovery, and the ligation product was transformed into E.coli DH5 α and cultured overnight at 37 ℃. And selecting positive monoclonal colonies for PCR verification. Whether the band was intended was observed by agarose gel. And (4) carrying out LB liquid medium culture on the positive single colony with the target strip, and sending the cultured bacterial liquid to a company for sequencing. And (4) preserving the strain and extracting the plasmid from the correctly sequenced bacterial liquid for the next experiment.

3.3 construction of expression vectors

The cloning vector plasmid with the correct sequence and the empty expression vector pROK II-GFP were subjected to double digestion at Xba I and Kpn I sites, respectively. Compared with the enzyme-cleaved expression vector, the enzyme-cleaved vector has a larger band, which indicates that the target vector is cut open. And (3) recovering the gene target fragment and the cut vector fragment by glue, then connecting, converting escherichia coli competence DH5 alpha, carrying out colony PCR verification, carrying out shake culture on a single colony verified to be correct, and preserving the strain.

3.4 subcellular localization analysis of SbbHLH85

The expression condition of SbbHLH85 is sub-cellularly positioned by a tobacco transient transformation method, pROK-SbbHLH85-GFP expression vector with target genes is used for constructing GFP fusion protein, bacterial liquid of the pROK II-GFP expression vector is injected into tobacco leaves, and the positioning condition of the target genes can be observed under a two-photon confocal microscope. The results showed that the green fluorescence signals of tobacco lower epidermal cells of pROK II-GFP empty vector were distributed throughout the cells. And after the pROK II-SbbHLH85-GFP expression vector with the target gene is transformed into tobacco, the green fluorescence signals of the lower epidermal cells are only distributed in cell nucleus. Therefore, it was preliminarily concluded that the SbbHLH85 gene is expressed in the nucleus, and that transcription factors mostly play a regulatory role in the nucleus, so that the gene is a nuclear transcription factor.

Example 3: obtaining of Arabidopsis thaliana SbbHLH85 overexpression lines and AtbHLH85 mutant lines

1 materials of the experiment

Columbia ecotype (Col-0) Arabidopsis thaliana and bHLH85(RSL2/AT4G33880) mutant Arabidopsis thaliana were selected, and examples of T-DNA insertion mutants purchased from Tair website include RSL2-1(SALK _048849), RSL2-2(SALK _048857), RSL2-3(SALK _101872) and RSL2-4(SALK _ 143203).

2 method of experiment

2.1 obtaining of the SbbHLH85 overexpression line from Arabidopsis thaliana

After finishing the agrobacterium with pROK II-SbbHLH85-GFP staining Arabidopsis inflorescence, wrapping the Arabidopsis inflorescence by using a black preservative film, carrying out dark culture for about 24h, and then uncovering the black preservative film for normal culture. And (5) performing secondary infection after about 7 days, wherein the infection time is 10s, and continuously infecting for 3 times. And (3) maturing and seed setting of the to-be-infected arabidopsis, collecting seeds, recording as T0 generation, and drying in a dry environment for about 2 weeks. Screening a homozygous arabidopsis thaliana overexpression strain, identifying the arabidopsis thaliana overexpression strain at a DNA level, and specifically, taking DNA extracted from Kana screened positive arabidopsis thaliana seedlings as a template, and taking a 35S design primer and a bHLH85 downstream primer on an expression vector as primers to perform PCR amplification so as to verify whether the modified seedlings carry target genes. And (3) obtaining the screened positive seedlings, and performing a real-time fluorescent quantitative PCR experiment to analyze the expression conditions of the target genes in different over-expressed arabidopsis strains. An arabidopsis internal reference gene Action primer and a fluorescent quantitative PCR primer 85-S and 85-A of SbbHLH85 are respectively selected as primers, and cDNA of each arabidopsis overexpression strain is taken as a template for testing.

ActinA AAGCTGGGGTTTTATGAATGG(SEQ ID NO.9)

ActinS TTGTCACACACAAGTGCATCAT(SEQ ID NO.10)

2.2 screening of Arabidopsis thaliana bHLH85 homozygous mutants

Most of the mutants purchased on Tair site are heterozygotes, and further screening is required to obtain homozygotes. The mutant corresponding to the Arabidopsis thaliana bHLH85 is of a T-DNA insertion type, and the insertion sites are on the promoter. The screening and identification are carried out by adopting a two-primer method, namely different specific primers on genes and a primer LBb1.3 on T-DNA are designed according to different insertion positions of the T-DNA so as to screen homozygous mutants. The primers used were as follows:

and (3) respectively carrying out PCR verification on each mutant by taking the DNA of each mutant as a template and two pairs of primers, namely LBb1.3+ Antisense and Sense + Antisense, of each mutant primer.

2.3 expression of bHLH85 Arabidopsis thaliana homologous gene RSL2 under different salt treatment conditions

Firstly, uniformly mixing nutrient soil and vermiculite with water according to a certain proportion until the humidity is proper, and subpackaging the mixture into square flowerpots (the diameter is 10 cm). Then, seeds of wild type (Columbia ecotype) Arabidopsis are evenly sown in nutrient soil, covered with a film and placed in an artificial climate incubator (16h light/8 h dark, 22/18 ℃, 70% relative humidity). And (3) after true leaves grow out, uncovering the membrane and thinning, reserving 5 arabidopsis thaliana strains in each pot, continuously culturing for about 2 weeks, treating seedlings of each arabidopsis thaliana strain for 48 hours by using 1/2Hoagland nutrient solution with 0mM, 50mM, 100mM, 150mM and 200mM NaCl, and then respectively taking the roots and the leaves of each strain for later use. Then, RNA extraction and cDNA transformation were performed, as described above. And (3) carrying out fluorescence quantitative PCR on different samples treated by different salts, wherein the specific steps and PCR system are as described above. Searching an arabidopsis RSL2 gene sequence from a Tair website, and designing a fluorescent quantitative PCR primer, wherein the PCR primer is as follows:

3 results and analysis of the experiments

3.1 obtaining of the SbbHLH85 overexpression line from Arabidopsis thaliana

3.1.1 screening of overexpression lines by Carna and identification at the DNA level

Culturing with a culture medium containing Kana antibioticOver-expressing the Arabidopsis seeds, and after a period of time, most seedlings are yellowed and wilted and die gradually; only a few seedlings can grow normally. Transplanting the well-grown seedlings into nutrient soil to continue growing, taking materials to perform PCR identification on DNA level after true leaves grow out, and performing agarose gel electrophoresis to indicate that the strains with target bands contain target genes. Wait for T₀Mature seed setting of mutant plant, single plant collection, seed marking as T₁And continuously screening until homozygous over-expression plants are screened.

3.1.2 fluorescent quantitative PCR analysis of different overexpression lines of Arabidopsis

The results of fluorescent quantitative PCR on different over-expressed Arabidopsis strains are shown in FIG. 12, and compared with wild type Arabidopsis (WT), the expression levels of SbbHLH85 in the over-expressed Arabidopsis strains are obviously increased, so that the strains used in the experiment can be analyzed to successfully transfer target genes, and the genes are over-expressed. The expression level of OX13 strain is increased most remarkably. Therefore, two strains of OX13 with the most significant expression amount and OX4 with the medium expression level are selected for further experimental study.

3.2 screening of Arabidopsis thaliana bHLH85 homozygous mutants

3.2.1 identification of homozygous mutants in Arabidopsis

Taking DNA of different AtbHLH85 Arabidopsis thaliana mutants as a template, and screening four mutant strains by using corresponding primers: rsl2-1, rsl2-2, rsl2-3 and rsl2-4, and then the four mutant strains are identified on the DNA level until homozygotes of the strains are obtained.

3.2.2 fluorescent quantitative PCR analysis of different Arabidopsis mutants

The fluorescent quantitative PCR result of each strain of the AtbHLH85 Arabidopsis mutant is obviously reduced compared with that of the wild Arabidopsis WT; among them, rsl2-1 was expressed in the lowest amount, rsl2-3 times, so rsl2-1 and rsl2-3 were selected as subjects for further experiments.

3.3.1 expression of bHLH85 Arabidopsis thaliana homologous gene RSL2 under different salt treatment conditions

The expression of the RSL2 gene in Arabidopsis thaliana leaves by 0mM, 50mM, 100mM, 150mM, 200mM NaCl was shown as A in FIG. 13, and decreased with increasing salt concentration, showing a negative correlation. The expression of the RSL2 gene in Arabidopsis roots was negatively correlated with the decrease in salt concentration as shown by B in FIG. 13.

The method comprises the steps of infecting agrobacterium tumefaciens with pROK II-SbbHLH85-GFP with a wild type Arabidopsis inflorescence, screening obtained seeds to a homozygous strain by using Kana antibiotics to obtain 23 SbbHLH85 overexpression homozygous strains, overexpressing SbbHLH85 overexpression Arabidopsis strains with good growth, analyzing the relative expression quantity condition of SbbHLH85 by fluorescent quantitative PCR detection, finding that the relative expression quantity of SbbHLH85 in the overexpression strains is obviously higher than that of the wild type Arabidopsis, fully proving that SbbHLH85 is successfully transferred into Arabidopsis plants and overexpressed, and selecting OX13 with the highest expression quantity and OX4 with the medium expression quantity to carry out next experiment. T-DNA insertion conditions of 4 mutants rsl2-1, rsl2-2, rsl2-3 and rsl2-4 of Arabidopsis AtbHLH85(AT4G33880) are screened according to a two-primer method to obtain homozygous mutants, and the expression level of AtbHLH85 in the mutants is lower than that of wild Arabidopsis through fluorescent quantitative PCR detection, particularly lower in rsl2-1 and rsl 2-3. Therefore, rsl2-1 and rsl2-3 were selected for further experiments. Fluorescent quantitative PCR experiments are carried out on the homologous gene RSL2 of the bHLH85 gene in Arabidopsis thaliana under different salt treatment conditions, and the results show that the expression of the gene is reduced along with the increase of the salt concentration no matter in leaves or roots, which indicates that the gene has negative regulation and control effects under the salt stress condition.

Example 4: functional analysis of SbbHLH85 Gene under salt stress

2SbbHLH85 overexpression homozygous strains (OX4 and OX13) with relatively high expression level and good growth condition of SbbHLH85 and 2 homozygous mutants (rsl2-1 and rsl2-3) with lower expression level of Arabidopsis T-DNA insertion are selected for next step of experiments.

1 Experimental materials and treatments

1.1 Experimental materials

Arabidopsis thaliana Columbia ecotype (Col-0) seeds, overexpression homozygous seeds screened in the above experiment (OX4 and OX13), and Arabidopsis thaliana homozygous mutant seeds with AtbHLH 85T-DNA inserted (rsl2-1 and rsl 2-3).

1.2 treatment of materials

Subpackaging prepared 1/2MS culture medium, adding NaCl to the concentration of 0, 100 and 150mM respectively, autoclaving at 120 deg.C for 20 min. Taking out after sterilization, pouring the culture medium into a sterile square dish of 13cm multiplied by 13cm when the culture medium is cooled to be not hot to the hands, and standing for solidification. Seeds of WT, OX4, OX13, rsl2-1 and rsl2-3 were disinfected separately in the same manner as in the above experiment, and seeds of each strain were sown in prepared culture media with different salt concentrations, 2 rows were planted in each culture dish, and 5 strains in each row were distributed uniformly. And (4) airing the excessive moisture on the surface of the culture dish, sealing, and then putting the culture dish in a refrigerator at4 ℃ in an environment of 3 for vernalization. After 3d, the culture dish is taken out and placed in an artificial climate chamber (25 ℃, the illumination intensity is 4000Lx, the illumination is 16h, and the darkness is 8h) for vertical culture.

In addition, each strain was individually seeded on 1/2MS medium containing no NaCl, vernalized as described above, and then vertically cultured in a climatic chamber under the same conditions. After the seedlings grow to 4 true leaves, transferring the seedlings of each line into nutrient soil, transferring 5 seedlings in each small pot, marking, and culturing in an artificial climate incubator. After 2 weeks, seedlings of the lines with better growth and consistent size were selected and treated, and the Arabidopsis seedlings of each line were treated with 0mM and 100mM NaCl 1/2Hoagland nutrient solutions, respectively. Wherein, the material is obtained after a part of treatment for 48 hours; another part was treated for 2 weeks to draw material.

1.3 data processing

Data analysis was performed using biological software such as Excel, ImageJ, SPSS17.0, and sigmaplot 10.0.

2 method of experiment

2.1 experiment of germination period of Arabidopsis wild type, overexpressed, mutant plants treated with NaCl

2.1.1 measurement of seed germination percentage and Main root length of each line under salt treatment

Seeds of WT, OX4, OX13, rsl2-1, rsl2-3 were first sterilized and then evenly dibbled in 1/2MS medium containing 0mM, 100mM and 150mM NaCl each, 3 replicates per treatment. After 3d of vernalization, the strains are placed in an artificial climate culture chamber for vertical culture, and the germination rate of each strain is counted after the strains germinate for 24 hours. The germination rate is expressed as the percentage of the number of seeds germinated in each strain to the total number of seeds in the strain. After the strain grows for 7d, the length of each strain main root is counted by using biological software such as ImageJ and the like, and the average value of the lengths of each strain main root is used for representing.

2.1.2 determination of germination Rate and Main root Length of Each line under different stress conditions

The abiotic stress to which a plant is subjected generally includes ionic stress, osmotic stress and the like. In order to determine the toxicity of NaCl to individual lines of Arabidopsis in this experiment, the germination phase experiments of individual lines under different stresses were determined. Na (Na)⁺Poison being Li⁺One tenth of that, 1/2MS medium was prepared and 10mM LiCl, 100mM NaCl, 1.8mM mannitol with the same osmotic potential was added to 1/2MS medium. The seeds of each strain were then sterilized and dibbled onto each medium as described above. And (4) vernalizing the mixture in a refrigerator at4 ℃ for 3d, and then transferring the mixture to a phytotron for vertical culture. And after 24h, counting the germination conditions of each strain. And 7d, counting the length of the main root of each strain. The specific method is as described above.

2.2 seedling stage experiments on Arabidopsis wild type, overexpressed, mutant plants treated with NaCl

2.2.1 measurement of Biomass

Seeds of WT, OX4, OX13, rsl2-1 and rsl2-3 are directly sown in nutrient soil, after the seeds grow to 4 true leaves, the seedlings are thinned, and after 2 weeks, seedlings of various lines with good growth vigor and consistent size are selected and treated with 0mM and 100mM NaCl 1/2Hoagland nutrient solution for 2 weeks respectively. Then the materials are taken, the arabidopsis thaliana of each strain is carefully taken out of the nutrient soil, the arabidopsis thaliana is washed by deionized water, and finally the water on the surface of the plant is absorbed by absorbent paper. At this point, the Fresh weight (Fresh weight) is weighed, then placed in an oven (70 ℃) until oven-dried, and the Dry weight (Dry weight) is weighed again. Multiple replicates per line were performed per treatment to avoid over-error.

2.2.2 determination of the degree of peroxidation of Membrane lipids (MDA content)

The degrees of membrane lipid peroxidation (MDA content) after treatment of WT, OX4, OX13, rsl2-1 and rsl2-3 leaves under different treatments are measured according to the following formula,

MDA content (mmol/g FW) ═ Δ A × N/(155 × W)

In the formula, Delta A: difference between a532 and a600, N: total volume of supernatant, 155 is the absorption coefficient at 532nm of 1mmol of reaction product (trimethine), W: weighing fresh weight (g) of plant material

2.2.3 salt treatment of Arabidopsis thaliana wild type, overexpression, and oxidative stress related experiments of mutants

Under salt treatment conditions, plants produce H₂O₂And the like, which can cause certain damage to plants. Therefore, whether RSL2 can improve the salt-resistant function of plants or not is detected by testing the toxic products.

The seeds of WT, OX4, OX13, rsl2-1 and rsl2-3 are dibbled in nutrient soil by the method described above. After the seedlings grow for 3 weeks, selecting seedlings with good growth and consistent size, respectively treating the seedlings with 0mM and 100mM NaCl 1/2Hoagland nutrient solution for 2 weeks, then taking materials, and carrying out NBT and DAB staining experiments.

2.2.4 fluorescent quantitative PCR analysis of related genes under salt treatment

In the process of plant salt resistance, various related genes are used for controlling the generation of toxic substances and the ion transport, so that the regulation and control effect of bHLH85 on salt resistance related genes under the condition of salt stress is explored through the experiment of fluorescent quantitative PCR of various strains under the treatment of different concentrations of salt, and the functions of the genes are determined.

Under abiotic stress conditions, plant bodies are subjected to mainly ionic, osmotic and oxidative stress. . Fluorescent quantitative PCR tests of the relevant genes were performed in parallel to these three stresses. RD29B, P5CS1, SOS1, NHX1, HKT1, CLCC, SOD and APX are selected to carry out experiments, and the expression conditions of the genes in roots and leaves of WT, OX4, OX13, rsl2-1 and rsl2-3 strains under different treatment conditions are detected.

2.3 root-hair related experiments on Arabidopsis wild type, overexpression and mutants

2.3.1 phenotypic Observation of root hairs of Individual lines of Arabidopsis

In Arabidopsis thaliana, bHLH85, also known as RSL2, is a gene that is closely linked to root hair development and elongation, and it also has a functionally similar gene RSL 4. Therefore, wild type Arabidopsis thaliana (WT), overexpression (OX4, OX13), RSL2 mutant (RSL2-1, RSL2-3), RSL4 mutant (RSL4), and RSL2 and RSL4 double mutant (RSL2RSL4) were selected as the subjects, and the development and elongation of the main root hair were tested. As mentioned above, each strain of Arabidopsis seeds is dibbled in 1/2MS culture medium, and after it is cultured in artificial climate culture room for 7d, the root hair development and elongation at the position 5mm away from the root tip of each strain main root is observed under an electron microscope, and the microscope is uniformly amplified by 40 times.

2.3.2 fluorescent quantitative PCR analysis of root-hair related genes of individual strains of Arabidopsis

Root hair development and elongation are controlled by root hair related genes, and the influence of over-expression and deletion of RSL2 on the development and elongation of root hair is observed through the measurement of fluorescence quantitative PCR experiments of the root hair related genes CPK11, EXO70A1, GBF2, EXP7 and SAC1, and the phenotypic result observed through a microscope is further verified.

First, 0mM and 100mM NaCl treated for 48h of WT, OX4, OX13, rsl2-1, rsl2-3 roots were sampled, and then RNA was extracted and inverted into cDNA. Then, fluorescent quantitative PCR was performed.

3 results and analysis of the experiments

3.1 Arabidopsis thaliana wild type, overexpression and germination period experiments of mutant plants treated with NaCl

3.1.1 phenotypic analysis of wild type, overexpressed and mutant plants under salt treatment

As shown in FIG. 14, the seedlings of the respective lines showed significant differences after 7 days of treatment with 0mM, 100mM, 150mM NaCl. Growth of individual lines of Arabidopsis was inhibited as the salt concentration increased compared to seedlings in 0mM NaCl medium. In a 100mM NaCl culture medium, the seedlings of each strain have obvious difference in growth vigor and root length, and 2 strains rsl2-1 and rsl2-3 of the mutant have the best growth vigor and longer root length; secondly, wild type arabidopsis WT; the over-expressed Arabidopsis thaliana has the worst growth vigor and the shortest root length. In a 150mM NaCl culture medium, salt stress causes great inhibition on the growth of each strain, the strain is short and small, the leaves are yellow, and the root length is short; and the growth conditions of various strains also have larger difference, the mutant strains are inhibited minimally, and the over-expression strains are inhibited maximally.

3.1.2 Effect of salt treatment on seed Germination Rate and root Length of Arabidopsis thaliana

Under the condition of different salt concentrations, the germination rate of the arabidopsis seeds of each line is reduced along with the increase of the salt concentration. In the 0mM NaCl culture medium, the germination rates of seeds of various strains have little difference and no obvious difference. In the 100mM NaCl medium, the germination rates of the strains are obviously different, and it can be seen from FIG. 15 that the germination rate of the Arabidopsis mutant is higher than that of the wild Arabidopsis and higher than that of the over-expressed Arabidopsis. In 150mM NaCl medium, the germination rate of the individual lines is low, but the tendency of the germination rate is still that the mutants are more over-expressed than the wild type.

The length of the main root of each strain is determined under different salt concentrations, and the length of the main root is shortened along with the increase of the salt concentration. In 0mM NaCl culture medium, there was no obvious difference in the length of the main root of each strain Arabidopsis thaliana. In 100mM NaCl medium, there was a clear difference in the length of the main roots of the individual strains, with the longest main roots of the 2 strains of the mutant, followed by wild type Arabidopsis, and finally by the over-expressed 2 strains OX4 and OX 13. In 150mM NaCl medium, the length of the main root of each line was short, but the tendency was consistent with that of seedlings in 100mM NaCl medium.

3.1.3 phenotypic analysis of wild type, overexpressed and mutant plants under different stress treatments

Under abiotic stress conditions, plants are subjected to multiple stresses, including ionic, oxidative, osmotic, and the like, simultaneously. As shown in FIG. 16, it was found that the growth of seedlings in NaCl, LiCl and mannitol media was slow, the leaf yellowing and the main root length was short, compared with the growth of seedlings in 1/2MS media. Wherein, the seedling growth condition under NaCl treatment is the worst, and the main root length is the shortest; seedling growth under mannitol treatment; seedlings under LiCl treatment grew best among 3 groups of seedlings. From phenotype analysis of each strain under different stress conditions, plants in a germination period are subjected to various stresses such as ion stress, osmotic stress and the like under the salt stress condition, wherein the plants are mainly subjected to osmotic stress.

3.1.4 Effect of different stress treatments on Arabidopsis germination Rate and root Length

According to statistics of the germination rates of seeds of various strains under different treatment conditions, the germination rate of the seeds in 1/2MS is the highest, and no obvious difference exists among the strains; secondly, the germination rate of the seeds under the LiCl treatment is low, and the difference between various strains under the treatment is not obvious; the seed germination rate under the treatment of mannitol is shown again, and the seed germination rate of each strain shows the trend that the mutant arabidopsis is higher than that of wild arabidopsis and overexpression arabidopsis; the germination rate of the seeds under the NaCl treatment condition is the lowest, and the germination rate of the mutant seeds is higher than that of the wild type and over-expression strains, and is consistent with and more remarkably different from the germination trend of the seeds under the mannitol treatment. It is therefore speculated that the salt stress to the plant in the germination phase is mainly osmotic stress, consistent with the phenotypic outcome of each strain under different stress conditions.

Under different treatments, the main root growth of each strain is obviously different. Wherein in 1/2MS culture medium, the main root length of each strain has little difference and is basically consistent; the length of the main root of each line is shortened compared with that in 1/2MS under LiCl treatment, and the difference occurs among lines, the length of the main root of the mutant arabidopsis thaliana is longer than that of the wild type and is over-expressed; the length of the taproots of each line under treatment with mannitol and NaCl was shorter than that of the taproots of each line under treatment with LiCl, but the difference between the two treatments was not great, and a tendency appeared that the length of the taproots of the mutant was the longest, the wild type was the second shortest, and the length of the taproots of the over-expressed line was the shortest in each treatment. In terms of root length, plants are subjected to salt stress during germination, mainly from osmotic stress.

In conclusion, it was found through the determination of the phenotype, germination rate and root length of plants in germination stage under different stress conditions that plants in germination stage are affected by various stresses but mainly from osmotic stress under the condition of salt stress.

3.2 Arabidopsis wild type, overexpression and seedling stage experiments on mutant plants treated with NaCl

3.2.1 Effect of salt treatment on Arabidopsis thaliana seedling Biomass

According to the measurement of the biomass of each strain, the fresh weight and the dry weight of each strain have no significant difference under the 0mM salt treatment, and the dry weight and the fresh weight of each strain are obviously reduced under the 100mM salt treatment. Under the treatment of 100mM salt, the fresh weight of WT, rsl2-1, rsl2-3, OX4 and OX13 is reduced by 41%, 30%, 32%, 47% and 49% respectively; the dry weight was reduced by 55%, 48%, 47%, 61%, respectively. As can be seen from the change in dry weight, the mutants showed the least reduction in biomass and the most reduction in overexpressed biomass under salt treatment.

3.2.2 Effect of salts on the MDA content in Arabidopsis leaves

The MDA content of each strain is increased under the salt treatment through measuring the MDA content of each strain. Under the treatment of 0mM NaCl, the MDA content of each strain has no obvious difference and is lower. The MDA content of the individual lines increased with 100mM NaCl treatment, with the largest increase in the overexpression line and the smallest increase in the mutant line, with the wild type Arabidopsis being located between them. This indicates that the overexpression lines are more membrane lipid peroxidated and the mutant lines are the least membrane lipid peroxidated.

3.2.3 salt treatment of Arabidopsis thaliana wild type, overexpression, and oxidative stress related experiments of mutants

Under salt stress conditions, the plant itself produces H due to oxidation₂O₂、O₂ ^-.Etc., which form a pigment precipitate with the corresponding dye. H₂O₂Can generate brown compounds with DAB under the catalysis of peroxidase; NBT at O₂ ^-.Reduced to blue dimethyl water insoluble under the action of (1). Individual lines were stained in DAB and NBT under 0mM NaCl treatmentThe difference in the degree is not large, indicating that the oxidative stress to the plants is about the same in the salt-free environment. Under 100mM NaCl treatment, the staining of each strain in DAB and NBT was increased compared to 0mM NaCl, with the most deeply stained overexpression lines and less stained mutants, and the staining of wild type Arabidopsis was in between. This indicates that oxidative stress of each strain was increased under 100mM NaCl treatment, and that the degree of stress was such that the over-expressed strain was heavier than the wild type Arabidopsis thaliana than the mutant strain.

3.2.4 fluorescent quantitative PCR analysis of related genes under salt treatment

Under salt treatment, plants are subjected to various stresses, such as ionic stress, osmotic stress, oxidative stress, and the like. The regulation and control effect of the bHLH85 gene on salt stress related genes in overexpression and mutants is demonstrated by analyzing the fluorescent quantitative PCR result of various stress related genes. As shown in the graph, the expression level of each gene was higher in the 100mM NaCl treatment than in the 0mM NaCl treatment (the expression level was 1), and the expression level of each gene was the highest in the mutant strain and the lowest in the overexpressed strain.

Similarly, in Arabidopsis thaliana leaves, fluorescent quantitative PCR experiments were also performed on salt stress genes. The expression level of each gene was increased by 100mM NaCl treatment as compared with the expression level of each gene by 0mM NaCl treatment. Each strain also exhibited a tendency that the expression level of the mutant strain was higher than that of the wild type Arabidopsis than that of the overexpression strain, consistent with the tendency in Arabidopsis roots.

3.3 root-hair related experiments on Arabidopsis wild type, overexpression and mutants

3.3.1 phenotypic Observation of root hairs of Individual lines of Arabidopsis

In Arabidopsis, RSL2 plays an important role in root hair development and elongation, and researches show that functional redundancy exists between Arabidopsis RSL2 and RSL4 genes (Feng et al 2017), so root hair conditions of wild type Arabidopsis, RSL2 mutant, RSL4 mutant, RSL2RSL4 double mutant and bHLH85 overexpression strain are observed. In the overexpression strains (OX4 and OX13), the root hairs are obviously increased and are longer; in wild type Arabidopsis (WT), the root hair density and length are lower than those of the over-expressed lines; in the RSL2 mutant (RSL2-1, RSL2-3) and the RSL4 mutant (RSL4), the length of root hairs is obviously much shorter than that of wild Arabidopsis, the number of root hairs is also reduced, but the difference between the two mutants is not large; in the case of double mutation of two genes (RSL2RSL4) of RSL2 and RSL4, root hair-free phenomenon appears in Arabidopsis roots.

In addition to the phenotypic observations of root hairs at 5mm from the root tip, statistics were also made regarding the number and length of root hairs in this region. The number of root hairs of over-expression strains (OX4 and OX13) is the largest in terms of the number of root hairs; wild type Arabidopsis thaliana (WT) next; minimal of mutant strains (rsl2-1, rsl2-3, rsl 4); whereas the double mutant strain (rsl2rsl4) had no root hairs. In terms of length, the root hair length of the overexpression strain is still the longest; the double mutant strain has no root hair; the root hair lengths of the wild type and single mutant lines are located at

positions

2 and 3, respectively.

In conclusion, the number and the length of root hairs are remarkably changed due to the over-expression and the deletion of the bHLH85 gene, and the phenomenon of no root hairs is generated in the double-process strain. It is presumed that this gene has an important influence on the growth of Arabidopsis root hair, and promotes the increase in the number of root hairs and the elongation of root hair length. The function of the sweet sorghum bHLH85 is similar to that of Arabidopsis RSL2 and RSL4 in the growth and development of root hair.

3.3.2 fluorescent quantitative PCR analysis of genes related to root hair development

The bHLH85 gene has obvious influence on the root hair of Arabidopsis thaliana, so real-time PCR analysis is carried out on the root hair development related gene, the result is shown in figure 25, the expression conditions of various strains in different genes are different, but the expression quantity of the 5 genes in an overexpression strain is higher than that of a wild type strain and a mutant strain. This trend is consistent with the phenotypic results observed previously. The expression levels of CPK11, GBF2 and PRX7 in the overexpression strain are relatively high and are about 3 times higher than that of wild Arabidopsis. The expression level of each gene in the mutant strain is reduced, but the reduction range is not large, probably because RSL2 and RSL4 are functional redundant genes, after the T-DNA is inserted into the RSL2 gene, the RSL4 gene still plays a role, and the downstream root hair related gene still has a regulation function.

Example 5 expression control analysis of SbbHLH85 Gene

In order to analyze the molecular mechanism of SbbHLH85 for regulating salt resistance and root hair development of sweet sorghum, RNA-seq is used for analyzing the conditions of wild type, overexpression and gene expression in mutant plants, 22 genes are selected and subjected to RT-PCR verification, and the result shows that the gene expression is consistent with transcriptome data. Analysis of transcriptome data yielded 597 differentially expressed genes in the wild type, 244 in the over-expressed lines and 204 and 278 in the mutant and double-mutant material, respectively. GO analysis was also performed on 156 genes of interest, and the results showed that these genes are mainly involved in several aspects of biological processes, molecular functions and cellular components. KEGG and KOG results indicate that these differentially expressed genes are mainly focused on phenylalanine metabolism, hormone signaling and secondary product metabolism, and further extensive analysis revealed that these genes are mainly in auxin signaling pathway (AtPIN3, AtSAUR50), ABA signaling (AtPYL6), Peroxidase (PER) (AtPRX33, AtPRX37, AtRCI3, AT4G08780), kinase-like Receptor (RLK) (AT4G00970, AT4G04570) and root hair development related genes.

Meanwhile, expression of homologous genes in sweet sorghum was also identified, and consistent with the results in Arabidopsis thaliana, an ABA signal transduction gene (SbPYL4), a auxin signal transduction gene (SbPIN3), three root hair development-related genes (SbRSH2, SbRSL4, SbRHL1),4 peroxidase genes (SbPER3, SbGLO1, SbPER4, SbPER35), and three kinase-like receptor proteins (SbRLK1, SbRLK2, SbRLK8) were obtained.

In order to find an interacting protein of SbbHLH85, a yeast two-hybrid system was used for screening, and it was found that only SbPHF1 stably bound SbbHLH85, and SbPHF1 was homologous to AtPHF1 and a partner of PHT1, which assisted PHT1 in transporting phosphorus to the membrane. In order to further verify the interaction relationship between SbbHLH85 and SbPHF1, yeast double-hybrid and double-molecular fluorescence complementation experiments are carried out, and the results show that SbbHLH85 and SbPHF1 can stably interact.

It should be noted that the above-mentioned embodiments are only preferred embodiments of the present invention, and the present invention is not limited thereto, and although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications and equivalents can be made in the technical solutions described in the foregoing embodiments, or equivalents thereof. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention. Although the present invention has been described with reference to the specific embodiments, it should be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention.

SEQUENCE LISTING

<110> university of Shandong Master

Application of <120> stress resistance associated protein bHLH85 in regulation and control of plant stress resistance

<130>

<160> 23

<170> PatentIn version 3.3

<210> 1

<211> 316

<212> PRT

<213> SbbHLH85 amino acid sequence

<400> 1

Met Glu Ala Gly Gly Leu Ile Thr Glu Val Gly Trp Thr Glu Phe Asp

1 5 10 15

Phe Leu Ser His Gly Glu Glu Ser Glu Ala Met Met Ala Gln Leu Leu

20 25 30

Gly Ala Phe Pro Ser His Ala Asp Glu Gly Gln His Glu Leu Leu His

35 40 45

Trp Pro Asp Gln Ala Ser Asn Ala Tyr Ser Asp Ser Ile Pro Pro Ser

50 55 60

Cys Gly Gly Tyr Tyr Phe Leu Ser Asn Ser Asn Glu Ala Leu Gly Ser

65 70 75 80

Ser Ser Cys Thr Ala Pro Thr Asp Ala Leu Pro Phe Gln Glu Glu His

85 90 95

Gly Ala Gly Ala Ala Glu Tyr Leu Asp Val Thr Ala Asn His Ser Phe

100 105 110

Asn Cys Tyr Gly Asn Gly Asp Pro Ser Tyr Glu Asp Leu Asp Asp Pro

115 120 125

Met Ser Val Ser Met Leu Gly Ser Ile Ser Thr Ala Pro Asp Lys Ser

130 135 140

Lys Arg Lys His Met Val Glu Glu Arg Asp Gly Gln Thr Gln Lys Arg

145 150 155 160

Gly Arg Lys Ser Ala Arg Asn Val Gly Glu Ala Lys Arg Ala Lys Arg

165 170 175

Ala Lys Lys Ser Gly Asp Glu Asp Ser Ser Met Ala Ile Arg Asn Gly

180 185 190

Ser Pro Thr Ser Cys Cys Thr Ser Asp Ser Asp Ser Asn Ala Ser Leu

195 200 205

Glu Ser Ala Asp Gly Asp Gly Asp Ala Asp Ala Arg Arg Pro Lys Gly

210 215 220

Lys Gly Arg Ala Gly Arg Ser Ala Thr Thr Glu Pro Gln Ser Ile Tyr

225 230 235 240

Ala Arg Lys Arg Arg Glu Arg Ile Asn Glu Arg Leu Lys Ile Leu Gln

245 250 255

Asn Leu Val Pro Asn Gly Thr Lys Val Asp Ile Ser Thr Met Leu Glu

260 265 270

Glu Ala Val His Tyr Val Lys Phe Leu Gln Leu Gln Leu Arg Leu Leu

275 280 285

Ser Ser Asp Asp Thr Trp Met Tyr Ala Pro Ile Ala Tyr Asn Gly Met

290 295 300

Asn Ile Gly Ile Gly Ile Asp Leu Asn Met Asp Arg

305 310 315

<210> 2

<211> 951

<212> DNA

<213> SbbHLH85 nucleotide sequence

<400> 2

atggaggctg gagggttgat caccgaggtc ggttggaccg agttcgactt cctgtcgcac 60

ggcgaggagt cggaggcgat gatggcgcag ctgctcggtg ccttcccgtc ccatgccgat 120

gaaggtcaac atgagctgct gcattggcct gatcaagctt ccaatgcata cagtgacagt 180

atcccacctt catgtggggg ctactatttt ttgagcaact caaatgaggc ccttgggagc 240

agctcctgca ctgcaccaac agatgccctg ccgtttcagg aggagcatgg tgcaggtgca 300

gctgagtacc tggatgtgac tgcaaaccat tccttcaact gttatgggaa tggtgatccg 360

agctatgagg atctggatga tccgatgagc gtcagcatgc ttggctcagt aagcaccgct 420

ccagacaaga gcaagaggaa gcacatggta gaagaacacg atggccaaac ccaaaagagg 480

ggccggaaaa gcgcgcggaa tgttggtgaa gctaagcgag ccaagagggc caagaagagt 540

ggagacgaag actccagcat ggccatccgg aatggaagcc cgaccagctg ctgcacctct 600

gacagcgatt caaatgcctc tctggagtct gcagatggcg atggcgatgc cgatgctcgt 660

cgtcccaaag gcaagggccg ggcaggccgt agcgcgacga ctgaacccca gagcatctat 720

gcaaggaaga ggagggagag gatcaatgag aggctgaaga tcctgcagaa cctggtgccc 780

aacgggacca aggtggacat cagcaccatg cttgaggagg cagtgcacta cgtgaagttc 840

ctgcagctcc agatcaggct cctgagctct gacgacacgt ggatgtatgc gcccatcgcg 900

tacaacggga tgaacatcgg catcgggatc gatctcaaca tggacagatg a 951

<210> 3

<211> 28

<212> DNA

<213> bHLH85-F

<400> 3

gctctagaat ggaggctgga gggttgat 28

<210> 4

<211> 31

<212> DNA

<213> bHLH85-R

<400> 4

ggggtacctc tgtccatgtt gagatcgatc c 31

<210> 5

<211> 24

<212> DNA

<213> Sb actin-S

<400> 5

acggcctgga tggcgacgta catg 24

<210> 6

<211> 25

<212> DNA

<213> Sb actin-A

<400> 6

gcagaaggac gcctacgttg gtgac 25

<210> 7

<211> 22

<212> DNA

<213> 85-S

<400> 7

atgcaaggaa gaggagggag ag 22

<210> 8

<211> 19

<212> DNA

<213> 85-A

<400> 8

gagcctgatc tggagctgc 19

<210> 9

<211> 21

<212> DNA

<213> ActinA

<400> 9

aagctggggt tttatgaatg g 21

<210> 10

<211> 22

<212> DNA

<213> ActinS

<400> 10

ttgtcacaca caagtgcatc at 22

<210> 11

<211> 19

<212> DNA

<213> LBb1.3

<400> 11

attttgccga tttcggaac 19

<210> 12

<211> 18

<212> DNA

<213> rsl2-1S

<400> 12

tcataagagg cgagaagc 18

<210> 13

<211> 18

<212> DNA

<213> rsl2-1A

<400> 13

tgaatacggc caccacaa 18

<210> 14

<211> 18

<212> DNA

<213> rsl2-2S

<400> 14

tcataagagg cgagaagc 18

<210> 15

<211> 18

<212> DNA

<213> rsl2-2A

<400> 15

tgaatacggc caccacaa 18

<210> 16

<211> 22

<212> DNA

<213> rsl2-3S

<400> 16

ttttgatcct aaatatgcag tg 22

<210> 17

<211> 18

<212> DNA

<213> rsl2-3A

<400> 17

atacaagcct tggtggtc 18

<210> 18

<211> 22

<212> DNA

<213> rsl2-4S

<400> 18

ttttgatcct aaatatgcag tg 22

<210> 19

<211> 18

<212> DNA

<213> rsl2-4A

<400> 19

atacaagcct tggtggtc 18

<210> 20

<211> 22

<212> DNA

<213> rsl2-S

<400> 20

gcctctatgc aaggaaaaga ag 22

<210> 21

<211> 22

<212> DNA

<213> rsl2-A

<400> 21

cgtaatgaac tgcttcctca ag 22

<210> 22

<211> 21

<212> DNA

<213> AT-Action-S

<400> 22

aagctggggt tttatgaatg g 21

<210> 23

<211> 22

<212> DNA

<213> AT-Action-A

<400> 23

ttgtcacaca caagtgcatc at 22

Claims

1. A protein which is any one of a1) -a3) as follows:

a1) protein shown as a sequence 1 in a sequence table;

a3) the other genes code proteins which have more than 50 percent of similarity with the amino acid sequence composition shown in the sequence 1 and have the activity of the protein shown in the sequence 1.

2. A nucleic acid molecule encoding the protein of claim 1;

preferably, the nucleic acid molecule is a DNA molecule of any one of b1) -b 4);

3. A recombinant vector, expression cassette, transgenic cell line, host bacterium or transgenic plant comprising a nucleic acid molecule encoding a protein according to claim 1.

4. A primer for amplifying the whole length of a nucleic acid molecule encoding the protein of claim 1 or any fragment thereof; preferably, the primer comprises a sequence 3 and a sequence 4 in a sequence table.

5. Use of the protein of claim 1, the nucleic acid molecule of claim 2, the recombinant vector, the expression cassette, the transgenic cell line, the host bacterium or the transgenic plant of claim 3 for modulating stress resistance in a plant.

6. The use as claimed in claim 5, wherein the regulation of plant stress resistance is the reduction of plant stress resistance or the increase of plant stress resistance; preferably, stress resistance of the plant is increased.

7. Use according to claim 5, wherein the stress resistance is salt and/or oxidation resistance;

preferably, the specific trait of increased salt resistance is manifested by a reduction in the number and length of root hairs of the plant.

8. The use of claim 5, wherein the plant is a dicot or monocot;

preferably, the dicotyledonous plants include arabidopsis, cotton, castor, squash, peanut, cassava, and morning glory, and the monocotyledonous plants include sorghum, sweet sorghum, corn, rice, and wheat.

9. A method of plant breeding, the method comprising: the method comprises knocking out or inhibiting the expression of the nucleic acid molecule of claim 2, thereby reducing the number and length of plant root hairs and improving plant stress resistance.

10. A breeding method according to claim 9, characterised in that the stress resistance is salt and/or antioxidant resistance;

the plant is a dicot or a monocot;

preferably, the dicotyledonous plants include arabidopsis, cotton, castor, pumpkin, peanut, cassava, and morning glory; the monocotyledonous plants include sorghum, sweet sorghum, maize, rice and wheat.