LU102487B1 - Use of Aminoacylase-1 - Google Patents

Abstract

The present invention provides a use of Aminoacylase-1 in improving plant characters, improving plant characters is selected from any one of the group consisting of: increasing the germination rate of plant seeds; increasing plant height; increasing leaf area; increasing stem diameter; increasing root length; increasing the number of leaves; increasing root area; increasing pod weight; and increasing plant fresh weight. The present invention further provides a use of Aminoacylase-1 in enhancing polyethylene glycol-resistance (anti-polyethylene glycol) for bacterium. The protein of Aminoacylase-1 is selected from the protein indicated as SEQ ID NO.1, or the protein having more than 90% sequence homology with the protein indicated as SEQ ID NO.1 and having the enzymatic activity of Aminoacylase-1.

Description

BL-5199 LU102487

SPECIFICATION Use of Aminoacylase-1

BACKGROUND Fieid of Invention The present invention belongs to the field of agricultural biotechnologies and relates to the use of maize Aminoacviase-1 gene in aspect of enhancing the capability of polyethylene glycol-resistance (anti-polyethylene glycol. anti-PEG) for bacterium and improving the growth performances for plants. Background of the invention Aminoacylase-1 has the zinc binding domain for binding Zn" and the main domain for facilitating the dimcrization of the zinc binding domains. and its activity site locates between the two zinc binding domains! I. By facilitating the binding of N- acvl-L-amino acid substrate, the binded zinc causes the conformational shift, the subunits of protein aggregate around the substrate, and thus the catalvsis can occur! Aminoacvlase-1 (Acylase I; N-acyl-L-Amino Acid Amidohydrolase) participates in the hydrolysis of N-acylated or N-acctylated amino acids (except for L-aspartic acid). When the N-terminal of an L-amino acid is covalently bond to an acyl group, an N-acyl-l.-amino acid 1s formed. Acyl groups provide stability for amino acids and make them more resistant to degradation. However, N-acyl-L-amino acids cannot be directly used as base blocks for constructing proteins. N-acyl-1.-amino acids must be firstly converted to L.-amino acids through Aminoacviase-1. and the [-amino acid products can be used for biosynthesis or catabolism energy. Aminoacyvlase-1 is involved in adjusting the action of cells to oxidative stress in animal bodies. and involved in amino acid metabolism and urea evcle. Whereas. in |

BL-199 LU102487 plants, the significance of urea cycle lies in the synthesis of arginine, and individual plants can also produce urea, which is decomposed to ammonia under action of urease, for synthesizing nitrogen compounds comprising nucleic acids, hormones. chloroplast, heme. amine, alkaloid and the like. However, the study on Aminoacylase-1 in plants is rare. Huafang SHI et al. purified and obtained rice Aminoacylase {rom rice, which has maximum activity to N-acetyl-L-Methionine, followed by N-acetyl-DL-Serine and N-acetyl-L- Alanine.

References

[1] Lindner-HA. Lunin-VV, Alary-A, et al. Essential Roles of Zinc Ligation and Enzyme Dimerization for Catalysis in the Aminoacylase-1/M20 Family[J]. Journal of Biological Chemistry, 2003, 278(45): 44496-44504.

[2] Fones-WS. Lee-M. Hydrolysis of N-acyl derivative of alanine and phenylalanine by acylase I and carboxypeptidase|J|. Journal of Biological Chemistry, 1953, 201(2): 847-856.

[3] Lindner-H, Alary-A, Wilke-M, ef al. Probing the acyl-binding pocket of aminoacylase-1[11. Biochemistry, 2008, 47(14): 66-75.

j4] Huafang Shi, Weida Huang, Hongjie Li. The Classification, Purification and Property Analysis of Rice Aminoacylase[J]. Biochemical Journal. 1997, 13(1): 54-58.

[5] Fougere-F, Le-RD, Streeter-JG. Effects of salt stress on amino acid, organic acid, and carbohydrate composition of roots, bacteroids, and cytosol of alfalfa (Medicago sativa L.)|J]. Plant Physiology. 1991, 96(4): 1228-1236.

[6] Zorb-C. Schmitt-S, Neeb-A. The biochemical reaction of maize (Zea mays L.) to salt stress is characterized by a mitigation of symptoms and not by a specific adaptation[J]. Plant Science. 2004. 167(1): 91-100.

[7] Zhi-7. Cui-YM. Zheng-S, ef al, The amino acid metabolic and carbohydrate metabolic pathway play important roles during salt-stress response in tomato[J]. Frontiers in Plant Science. 2017. 8: 1231.

[8] Khedr-AH, Abbas-MA, Wahid-AA. et al. Proline induces the expression of

BL-5199 LU102487 salt-stress-responsive proteins and may improve the adaptation of pancratium maritimum 1. to salt-stress|J|. Journal of Experimental Botany, 2003, 54(392): 2553-2562.

[9] Abbasi-AR, Hajirezaei-M, Hofius-D, et al. Specific roles of-and gamma- ocopherol in adminbiotic stress responses of transgenic tobacco[J]. Plant Physiology, 2007, 143(4): 1720-1738.

SUMMARY The first aspect of the present invention provides a use of Aminoacvlase-1 in improving plant characters. improving plant characters is selected from any one of the group consisting of. increasing the germination rate of plant seeds: increasing plant height: increasing leaf area: increasing stem diameter: increasing root length: increasing the number of leaves: increasing root area; increasing pod weight; and increasing plant fresh weight. In some embodiments. the Aminoacylase-1 is a plant- derived Aminoacviase-1. In some embodiments, the Aminoacvlase-! is maize Aminoacvlase-!. In some embodiments. the protein of the Aminoacviase-1 is selected from the protein indicated as SEQ ID NO.1. or the protein having more than 90% (for example. 91%, 92%, 93%, 94%, 95%, 96%. 97%. 98%. 99%. 99.5%) sequence homology to the protein indicated as SEQ 1D NO.1 and having the enzymatic activity of Aminoacvlase-1. In the present invention. the Aminoacvlase- I protein having the sequence homology 10 the protein indicated as SEQ ID NO.1 includes. but not limited to. natural protein. genetic engineering modified protein (for example. fusion protein) or mutant protein under artificial environment (for example. radiation mutation) existing in maize and other plants (for example. sorghum). which have the protein activity of Aminoaecvlase-!. When large fragments of proteins arc fused. for example. green fluorescent protein is fused with Aminoacylase-! protein. the homology may be close to 50%. and the present invention 1s not limited to more than 90% of sequence homology. In some embodiments. the nucleotide sequence encoding the Aminoacviase-1 is indicated

BL 199 LU102487 as SEQ ID NO.2. In some embodiments, improving plant characters is the improvement of tobacco characters. In some embodiments, improving plant characters is improvement of characters by increasing expression quantities of NBEXPAI gene and/or NBEIN2 gene.

The second aspect of the present invention provides a method for improving plant characters, the method is to transgene the expressible Aminoacylase-1 gene into plants, improving plant characters is sclected from any one of the group consisting of: increasing the germination rate of plant seeds; increasing plant height; increasing leaf arca: increasing stem diameter: increasing root length: increasing the number of leaves; increasing root area; increasing pod weight; and increasing plant fresh weight. In some embodiments. the Aminoacylase-1 is a plant-derived Aminoacylase-1. In some embodiments, the Aminoacylase-l is maize Aminoacylase-1. In some embodiments, the protein of the Aminoacviase-1 is selected from the protein indicated as SEQ ID NO.1, or the protein having more than 90% (for example, 91%. 92%, 93%, 94%, 95%. 96%, 97%, 98%, 99%,

99.5%) sequence homology to the protein indicated as SEQ ID NO.1 and having the enzymatic activity of Aminoacvlase-1. In some embodiments, the nucleotide sequence encoding the Aminoacylase-1 is indicated as SEQ ID NO.2. In some embodiments, improving plant characters is the improvement of tobacco characters. In some embodiments, improving plant characters is improvement of characters by increasing expression quantities of NBEXPA1 gene and/or NBEIN2 genc.

The third aspect of the present invention provides a use of Aminoacylase-1 in enhancing polyethylene glycol-resistance for bacterium. In some embodiments, the polyethylene glycol-resistance for bacterium means that the bacterium grows in the liquid medium containing 1 wt%-20 wi% (for example, 2 wt%, 3 wt%. 5 wl%. 8 wt%. 10 wit%. 12 wt%. 15 wi%, 18 wt%). preferably 5 wt%-15 wi% polyethylene glycol. In some embodiments. the Aminoacylase-1 is a plant-derived Aminoacviase-1. In some embodiments, the Aminoacylase-1 is maize Aminoacviase-1. In some embodiments. the protein of the Aminoacvlase-1 is 4

BI-5199 LU102487 selected from the protein indicated as SEQ ID NO.1, or the protein having more than 90% (for example, 91%. 92%, 93%, 94%, 95%. 96%. 97%, 98%. 99%. 99.5%) sequence homology to the protein indicated as SEQ ID NO.1 and having the enzymatic activity of Aminoacylase-!. In some embodiments, the nucleotide sequence encoding the Aminoucylase-1 is indicated as SEQ ID NO.2. In some embodiments, the bacterium is Escherichia coli, preferably. Escherichia coli BI 21. The fourth aspect of the present invention provides a method for enhancing the capability of polyethylene glycol-resistance for bacterium. and the method is to transgene the expressible Aminoacvlase-! gene into the bacterium. In some embodiments. the polvethylene glycol-resistance for bacterium means that the bacterium grows in the liquid medium containing 1 wt%-20 wt% (for example. 2 wt%, 3 wi%. 5 wt%. 8 wt%. 10 wt%. 12 wt%. 15 wi%. 18 wt%), preferably 5 wt%- wt% polvethylene glvcoi. In some embodiments. the Aminoacylase-1 is a plant- derived Aminoacylase-!. In some embodiments. the Aminoacylase-1 1s maize Aminoacylase-1. In some embodiments. the protein of Aminoacylase-1 is selected from the protein indicated as SEQ ID NO.1, or the protein having more than 90% (for example. 91%, 92%, 93%. 94%, 95%. 96%. 97%. 98%. 99%. 99.5%) sequence homology to the protein indicated as SEQ ID NO.1 and having the enzymatic activity of Aminoacvlase-1. In some embodiments. the nucleotide sequence encoding the Aminoacvlase-1 is indicated as SEQ ID NO.2. In some embodiments, the bacterium is Escherichia coli. more preferably, Escherichia coli BL21.

The filth aspect of the present invention provides a recombinant genetic engineering vector containing expressible Aminoaevlase-! gene. In some embodiments. the Aminoacviase-1 1s a plant-derived Aminoacvlase-!. In some embodiments. the Aminoacylase-1 is maize Aminoacviase-1. In some embodiments. the protein of Aminoucviuse-1 is selected from the protein indicated as SEQ ID NO.1. or the protein having more than 90% (for example. 91%, 92%. 93%. 94%.

9594. 96%. 97%. 98%. 99%. 99.5%) sequence homology to the protein indicated as SEQ ID NO.1 and having the enzymatic activity of dminoacviase-1. In some

BL-5199 LU102487 embodiments, the nucleotide sequence encoding the Aminoacylase-! is indicated as SEQ ID NO.2. In some embodiments, the recombinant genetic engineering vector is a recombinant prokaryotic gene expression vector; preferably, the vector of the recombinant prokaryotic gene expression vector is pET28a. In some embodiments, the recombinant genetic engineering vector is a recombinant eukaryotic gene expression vector; preferably. the vector of the recombinant eukaryotic gene expression vector is pPCAMBIA1300. In some embodiments, the recombinant genetic engineering vector is a recombinant gene expression shuttle vector.

The sixth aspect of the present invention provides a host containing the above- mentioned recombinant genetic engineering vector. In some embodiments, the host is bacterium or plant; preterably, the bacterium Escherichia coli; more preferably. Escherichia coli BL21. The plant is preferably tobacco.

The Aminoacylase-1 of the present invention is a zinc-binding enzyme, which is involved in urea cycle and ammonia (NHy') elimination in animal bodies. and regulates the reaction of cells to oxidative stress. But the study on zinc-binding enzyme in plants is rare. The present invention uses the maize inbred line ZHENG 58 as material to clone the maize Aminoacylase-1 gene ZmACY-1. and conducts biological functional analysis and research to ZmACY-/ on prokaryotic and eukaryotic levels, the results are as follows.

1. The bioinformatics analysis indicates that ZmACY-1 (LOC100283955) belongs to zinc peptidase superfamily, the gene of M20 Aminoacvlase-1 subfamily: the sequence length of the open reading frame encoded by ZmACY-1 genc is 1317 bp, encoding 439 amino acids; the relative molecular weight of protein encoded thereby is 48.33 KD. and the theoretical isoelectric point is 6.02.

2. The prokaryotic expression vector pET28a-ZmACY-1 is constructed. which is transformed into Escherichia coli BE21 to conduct salt tolerance and polyethylene glycol resistance analysis. The result indicates that. compared with pET28a control 0

RL-5199 LU102487 group strain, under the stresses of 5%, 10% and 15% PEG6000, the recombinant pET28a-ZmACY-1 Escherichia coli strain shows certain resistance capability; while under the stress of 0.4 mol/L. 0.6 mol/L and 0.8 mol/l. NaCl. with the increase of salt concentration, the overexpression of pET28a-ZmACY-1 in Escherichia coli strain severely inhibits the salt tolerance of the strain. Tt is speculated that the recombinant Escherichia coli BL21 (pl:T28a-ZmACY-1) has different tolerance patterns to NaCl stress and polyethylene glycol stress,

3. The plant binary express vector pCAMBIA1300-ZmACY-1 is constructed, agrobacterium is used to infect Nicotiana benthamiana tobacco. and the phenotype of the transgenic tobacco is identified. The result indicates that, compared with wild type. the overexpression of ZmACY-1 in Nicotiana benthamiana tobacco promotes the growth and development of transgenic plants. including increasing the germination speed of seeds. increasing leaf area, plant height, stem diameter. weight of the overground portion. weight of underground portion, root length, root arca. and pod size of the mature plant. In addition, in the one-month-old transgenic Nicotiana benthamiana. the expression levels of plant growth related genes both NbEXPA land NbEIN2 are higher than that of wild type dramatically.

4, NaCl treatment and natural drought treatment arc performed on the tobacco Ts generation transgenic strain and wild type. it is discovered that, after salt stress treatment. both the fresh weight of the overground portion and chlorophyll content of transgenic strain arc lower than those of wild type dramatically: after drought stress treatment, the fresh weight of the overground portion of transgenic strain is lower than that of wild type dramatically. and the wilting degree is more severe. Morcover. it is discovered by determining stress-related physiological indices that. under the salt stress and drought stress. the contents of the protective enzymes POD. SOD and CAT in the transgenic strain are all lower than those in wild type. while both MDA and relative conductivity are higher than those in wild type. These results indicate that the overexpression of ZmACY-7 in Nicotiana benthamiana tobacco negatively regulates drought resistance and salt tolerance capability in the

BL-5199 LU102487 transgenic strain. It meanwhile indicates that, the overexpression of ZmAC}-/ in Escherichia coli and tobacco has different polyethylene glycol resistance patterns. All the results indicate that, ZmACY-1 is involved in various life activites of plants and responses to adversity stresses. Although it promotes growth and development of plants, it inhibits the drought resistance and salt tolerance capability of plants.

BRIEF DESCRIPTION OF THE DRAWINGS Fig.l is a gel photo of ZmACY-! gene amplified by PrimerSTAR Max DNA Polymerase. Note: M: Takara DL 2000 DNA marker: lances 1-4: the results of ZmACY-1 gene amplification. Fig.2 shows PCR identification gel photo (A) and double enzyme digestion verification gel photo (B) of pMD/9T-ZMACY-1 plasmid colony. Note: lanes M1. M2: Takara DI. 2000 DNA marker: lanes 1-7: PCR identification of pMDI9T-ZmACY-1 plasmid colony: lanes 8-11: double enzyme digestion verification of pMD19T-ZmACY-1 plasmid. Fig.3 is a schematic diagram of the conserved domain prediction of ZmACY-/ protein. Fig.4 is a schematic diagram of the evolutionary analysis of ZmACY-/ gene. Fig.5 shows PCR verification gel photo (A) and double enzyme digestion gel photo (B) of pET28a-ZmACY-1. Note: M1: Takara DL 2000 DNA marker. M2: Takara DL 5000 DNA marker: lanes 1-4: PCR identification of pET28a-ZmACY-1 plasmid colony: lanes 5-6: double enzyme digestion verification of pET28a-ZmACY-1 plasmid. Fig.6 is a gel photo of prokaryotic expression product analysis of pET2Sa-ZmACY-

1. Note: M: protein Marker: | and 2 are the induced supernatant and precipitation of pET28a-ZmACY-1 strain. respectively: lanes 3 and 4 are the uninduced supernatant

X

BL-5199 LU102487 and precipitation of pET28a-ZmACY-1 strain, respectively; lanes 5, 6 are the induced supernatant and precipitation of empty vector strain, respectively; lanes 7 and 8 arc the supernatant and precipitation of empty vector strain induced. respectively; the target protein 1s indicated by the arrow.

Fig.7 is the growth curves of the bacterium under the stresses of different concentrations of NaCl or different concentrations of PEG6000. Note: A-C: the growth curves of recombinant bacterium and control bacterium under the stresses of NaCl concentrations (0.4 mol/L, 0.6 mol/L and 0.8 mol/L), respectively. D-F: the growth curves of recombinant bacterium and control bacterium in (5%, 10%. and 15%) PEG6000 aqueous solutions, respectively. Fig.8 shows the gel photos of the result of PCR identification (A) and double enzyme digestion to plasmid (B) of plant expression vector pCambial300-ACY-1 plasmid. Note: lane M1: Takara DL 2000 DNA marker, lane M2: Takara DL15000 DNA marker: lanes 1-6: the PCR result of screened positive clone; lanes 7-9: the result of double enzyme digestion to recombinant plasmid. Fig.9 is the schematic diagram of the infection and screen process of Nicotiana benthamiana leaf. Note: A: leaves in vitro; B: calluses; C-D: adventitious buds; E: seedlings: F: transplanted tobacco plant. Fig.10 is the PCR amplification result of screened scedling genome (A) and the relative expression level of ZmACY-! in T3 generation of transgenic Nicotiana benthamiana (B). A: lane M: Takara DL 2000 DNA marker: lane 1: wild-type Nicotiana benthamiana: Janes 2-7: the PCR results of TO generation of ZmACY-! transgenic screened seedling of Nicotiana benthamiana: B: WT is wild-type Nicotiana benthamiana tobacco. OE1. OL3, OLS arc the T3 gencrations of the three ZmACY-/ transgenic strains.

9

BL-5199 LU102487 Fig. 11 shows the results of the phenotype identification of wild type and ZmACY-/ transgenic Nicotiana benthamiana seedings.

Note: A: the germination rate of tobacco in the plate added with MS medium: B-D: the tobacco growth for 10 days in the plate added with MS medium; **"; P<0.05. #7; P<OOT. Fig. 12 shows the phenotype identification results of one-month-old wild-type and ZmACY-1 transgenic Nicotiana benthamiana plant. Note: A: onc-month-old tobacco growth: B-H: the phenotype identification of one-month-old tobacco: +": P<0.05, 7447 P<0.01. lig. 15 1s a schematic diagram of the expression level of the growth related gene in transgenic and wild-type Nicotiana benthamiana. Note: A: the relative expression level of NbEXPAT gene: B: the relative expression level of NbEIN2 gene: **": P<0.05. 7" P<0.01. Fig.14 shows the phenotype identification results of wild-type and Znr4CY-/ transgenic Nicotiana benthamiana pods. Note: A: the photos of fully developed pods of wild-type and transgenic strains: B: the pod weights of wild-type and transgenic strains; “#7: P<0.05, ***"; P<0.01. Fig.15 shows that the salt-tolerance analysis result of ZmACY-1 transgenic Nicotiana benthamiana, Note: A: the phenotype of each tobacco strain under 350 mmol/L. NaCl stress and clean water treatment: B: the fresh weight of overground portion of each tobacco strain under 350 mmol/l. NaCl stress and clean water treatment; C: the chlorophyll content of cach tobacco strain under 350 mmol/l. NaCl stress and clean water treatment: 7*"; P<0,05, #7; P<OOT. Fig.16 is the photos of drought resistance analysis of ZmACY-/ transgenic Nicotiana benthamiana. Note: A: the phenotype of cach tobacco strain under natural drought and clean water treatment: B: the fresh weight of overground portion of cach tobacco strain under natural drought and clean water treatment.

BL-5199 LU102487 Fig.17 is a schematic diagram of the measurement results of the stress-related physiological indices of the wild-tvpe and transgenic Nicotiana benthamiana tobacco under salt stress and drought stress. Note: A: POD activity: B: SOD activity: C: CAT activity: D: MDA activity: F: relative conductivity; 7*7: P<0.05, **"; P<0.01.

DETAILED DESCRIPTION OF THE EMBODYMENTS In order to make the objectives, technical solutions and advantages of the present invention clearer, the embodiments of the present invention will be further described in detail below in conjunction with the accompanying figures. Materials and Methods Test materials: the seeds of maize inbred line “Zheng 58° and wild-type Nicotiana henthamiana tobacco are provided by Crop Breeding Laboratory of Qingdao Agricultural University. Strains: Escherichia coli competent cell BL21(DE3) and DH5a, and agrobacterium (Agrobacterium rhizogenes) competent cell LBA4404 arc provided by Bokang Biotechnnology Co. L'TD(Qingdao). Plasmids: pMD19-T is purchased from Takara. plant expression vector pPCAMBIA1300 and prokaryotic expression vector pHl28a are provided by Molecular Laboratory of Qingdao Agricultural University. Reagents: isopropanol, anhydrous ethanol. AMP. X-gal, IPTG, kanamycin Kana. rifampicin Rif. hveromycin vg, cephalosporin Ccf. 2000 DNA Marker, 15000 DNA Marker, nucleic acid dve. MS medium. 1/2MS medium. LB. and YEB medium arc all conventional reagents. Instruments: Real-time fluorescent quantitative PCR instrument. constant temperature incubator. shaker. refrigerated centrifuge. ultra-clean worktable. spectrophotometer. and nucleic acid concentration analvzer (NANODrop 2000) are all conventional instruments. Primer sequences: the GenBank number of Anrinoacvlase-! gene (ZimACY-1 gene) of Zheng 58 maize 1s: NP 001150525.2. Its protein sequence is indicated as SEQ I'l

BL-5199 LU102487 ID NO.1 in sequence listings. Its nucleotide coding sequence is indicated as SEQ ID NO.2 in sequence listings. On the basis of the information of ZmACY-1 gene sequence and the like, the primers are designed by software Primer Premiers and synthesized by Qingdao Qingkezixi Biotechnology Co. LTD, and the primers are as follows (Table 1). Table | primer sequence _ Primer Primer sequence (57-37) Name Lise D ACY-1-H ATGCCGCCGCCGCCTCTCCGCTOT SEQ ID gene clone

NOL ZmACY-1-R TCAGCCTTGOAACGAGCTTAGT GC SEQ ID NO.4 gRI-ZmACY- AAGACATCGAGCAGATCAAGE SEQ ID fluorescent 1-f NOS quantitative

PCR gRT-ZmACY- TCOCTGTGGATACGGGAC SEQ ID 1-R NO.6 Xbal-/mACY- GCICTAGAATGCCGCCGCCGCCTCICCG SEQ ID gene 1-F CHGT NOT amplifieat on BamHI- CGGGATCCTCAGOUTTGHAACGAGOT TA SEQ ID /mACY-1-R GIGC NOR SEQ ID Internal ref NOY crenee gene of NbEFla-F COICAAGAAGOTEGOATACAAC Nicoliana benthamian al

SEO ID NbEFlu-R TCTTOGOOGUTOATTAANTC TOGO] C

NOY TO 12

SEQ ID growth NBEXPALF TIGTTICTCTGCTTCTGGATGG NOY related gene

SEQ ID NbEXPAI-R CTTAATGCAGCAGTGTITGTACCA NO.12 SEQ ID growth NbEIN2-F GGCATAATAGATCOTGGCATTFICC NO.15 related gene

SEQ ID NBEIN2 -R TATCTAAGAGC AT CGUTGOAG TG NO.14 Acquisition of material cDNA: firstly. conducting RNA extraction according to the instruction provided by the kit of Plant RNA Extraction Kit of Takara Company: then utilizing spectrophotometer to detect the concentration of the extracted RNA. determining the purity and concentration of RNA. subsequently performing agarose gel clectrophoresis detection: and further conducting reverse transcription. the system is: Master mix 2.0pl., RNA 2.0-4.0 uL(<500 ng), RNasc Free water supplement to 10uL, PCR reaction procedure is: reacting at 37°C for 1Smin. reacting at 85°C for 3s. preserving at 4°C. The experimental material cDNA thus obtained 1s uscd for fluorescent quantitative PCR. Example 1: cloning maize ZmACY-1 gene (1) Extraction of RNA: conducting the extraction of the total RNA ofthe Icaf tissues of Zheng 58 maize according to the instruction provided by the kit of Plant RNA Extraction Kit of Takara Company. (II) RNA Quality detect: utilizing spectrophotometer to detect the concentration of the extracted RNA. determining the purity and concentration of the RNA. and subsequently performing agarose gel electrophoresis detection. (111) cDNA template synthesis: preparing reverse transcription system on ice. the specific step: adding 2.0 ul. Master mix. 2.0-4.0 ul (<500 ng) Total RNA. adding RNase Free water to make the reaction system reach 10 pl. Adding reaction 13

BL-3199 LU102487 solution according to the reaction system. and mixing uniformly and sufficiently, The reaction is conducted in PCR instrument, and the reaction procedure is: reacting at 37°C for] Smin, reacting at 85°C for 3s, preserving at 4°C.

(IV) amplifying ZmACY-1 gene with high-fidelity enzyme: extracting the RNA in leaf. and conducting reverse transcription. Taking the total cDNA reverse- transcribed from the RNA in step (IT) as reaction template. utitizing high-fidelity enzyme (PrimerSTAR Max DNA Polymerase) to conduct gene amplification, to amplifv ZmACY-1 gene. The system (Takara) is: adding 25 ul. Takara PrimerSTAR Max DNA Polymerase, | pL ZmACY-1-F shown in Table 1. 1 pl. ZmACY-1-R shown in table 1. 2 pL. cDNA. adding RNase free water to make reaction system reach 50 pl. The PCR reaction steps are: denaturing at 98 °C for 10 s: annealing at 58 °C for 30 s: clongating at 72 °C for 15 s: cycling number 35; preserving at 4 °C. The single band with a size of approximately 1320 bp as shown in Fig.1 is obtained. The results indicate that the primer has good specificity. the amplified fragment is clear and the size of the band is consistent with the size of the target gene, and further cloning experiments can be performed. (V) amplifving product. conducting recycle and adding A tail The operation steps according to the gel recycling kit (Nanjing Vazyme Biotech Co. Ltd. type DC301-01) are as follows:

1. Using pipette to suck up 100 pl. PCR product and transfer it into sterilized 1.5 ml, centrifuge tube. 2. Adding equal volume of Buffer GDP. reversing or swirling to mix uniformly. 3. After putting the DNA adsorption column into the collection tube. transferring the mixed solution into the DNA adsorption column. and centrifuging at 10.000>¢ for 1 min. 4. Discarding filtrate, after putting the adsorption column back into the collection tube, adding 600 pL Buffer GW (which is added with anhydrous ethanol) into adsorption column. and centrifuging at

12.000-g for] min. 5. Repeating step 4. 6. Disgarding filtrate. putting the adsorption column back into collection tube. and centrifuging at 12.000<e for 2 min. 7. Putting the adsorption column into the sterilized 1.5 ml. centrifuge tube. 14

BL-3199 LU102487 adding 30 pL Elution Buffer into the center of adsorption column, after standing for 2 min. centrifuging at 12.000>¢ for 1 min. Disgarding the adsorption column. preserving the purified DNA solution in a refrigerator at -20 °C. 8. Adding “A"(deoxyadenosine) to product. taking the recycled PCR product as a template, taking 14.5 pl. PCR product, adding 2 pL Taq Buffer. 3 pl. dNTPs, 0.5 ul. Taq enzyme, and reacting at 72°C for 30 min.

(VI) Construction of clone vector pPMD19T-ZmACY-1 The construction steps of intermediate vector pMDIOT-ZmACY-/ are as follows. The DNA is purilied and recovered after the adding “A” reaction is completed for the amplification product. (1) ligating the recycled fragment to the linear pMD19-T vector Preparing ligation reaction solution in trace centrifuge tube. pMDI9T-ZMACY-1 system is: adding 1 ul. I-Vector pMD19: 1 ul, PCRproduct; 5 pl. DNA Ligase: adding RNase free water to make the system reach 10 pi. Adding the above reaction system into EP tube. and mixing uniformly and sufficiently. Placing it in a PCR instrument and setting the temperature to 16°C. the reaction time to 30 min. Upon reaction terminates. adding the reaction solution into 100 pul. Escherichia coli competent cell BL21(DE3) in a volume ratio of 1:10, and quickly placing it onto ice to react for 40 min. Upon further placing it in a 42°C water bath to perform heating treatment for 90 s. quickly placing it into ice water to react for 2 min. Finally. adding the reaction solution into antibiotic-free LB liquid medium. and placing it in a vibrating shaker for shaking culture at 37°C for 60 min. (VI) Screen of clone vector pPMD19T-ZmACY-7 (1) Blue white plaque screening. In ultra clean worktable. adding 30 pl. X-gal and 3 pL IPTG on LB plate containing Amp and coating them uniformly. standing for I hour. and subsequently coating the transformed Escherichia coli onto plate. standing for 30 minutes. and then inverting it for overnight culturing at 37°C. (2) Positive bacterium screening, Selecting white single colony. conducting bacterium solution PCR to screen positive recombinant plasmid. The reaction

BEAT LU102487 system is: adding 25 pL 2xTagPlusMasterMixII(DycPlus); 1 pL ZMACY-1-F; 1 ul. ZmACY-1-R: 2 ul. Strain solution; adding RNase free water to make the system reach 50 pl.

(VII) The identification of clone vector pMD19T-ZmACY-/ (1) Plasmid extraction Sclecting white single colony. inoculating it into LB medium (containing Amp), and culturing overnight at 37°. Sucking up the bacterium solution into a centrifuge tube. centrifuging at a rotation rate of 10.000 rpm for 1 min, and collecting the thallus. Extracting the plasmid according to the steps of plasmid extracting kit: 1. Taking 2 ml of the recombinant Escherichia coli bacterium solution cultured overnight (12-16 h). adding it into a 2ml. centrifuge tube, centrifuging at 10.000xg for 1 min. and placing the centrifuge tube upside down on a filter paper to absorb the residual liquid. 2. Adding 250 pl. Buffer Pl{check whether RNase A has been added prior to use) inte the centrifuge tube with thallus precipitation, swirl- vibrating to mix uniformly. 3. Adding 250 ul. Buffer P2 in step 2. and mildly reversing the centrifuge tube up and down 10 times to fully lyse the thallus. 4. Adding 350 pL Buffer P3 in step 3. immediately mildly reversing the centrifuge tube up and down 10 times to neutralize Buffer P2 thoroughly and sufficiently. and centrifuging at 13.000~¢g for 10 min. 5. Placing the FastPure DNA Mini Columns of adsorption column in the 2 mL collection tube. Using a pipette to transfer the supernatant in step 4 into the adsorption column carefully, avoiding sucking up the precipitation, and centrifuging at 13.0002 for I min. Discarding the waste liquid in the collection tube, and putting the adsorption column back into the collection tube. 6. Adding 600 uL Buffer PW2 (which is diluted by anhydrous ¢thanol) into the adsorption column. and centrifuging at 13.000>g for I min. Disgarding the waste liquid. and putting the adsorption column back into the collection tube. 7. Repeating step 6. 8, Putting the adsorption column back into the collection tube. Centrifuging the dry adsorption column at 13.000>g for 1 min to thoroughly climinate the residual rinsing liquid in the adsorption column. 9. Putting the 16

BL-5199 LU102487 adsorption column back into the new sterilized 1.5 ml. centrifuge tube. Adding 50 ul. Elution Buffer into the center of the adsorption column membrane. Standing at room temperature for 2 min. and centrifuging at 13,000xg for 1 min to clute the plasmid. 10. Discarding the adsorption column. preserving the plasmid at -20 °C to prevent DNA degrading.

(2) Enzymatic digestion verification (Restriction enzyme digestion verification): Using the restriction endonucleases BamH | and Hind IH to conduct double enzyme digestion identification to plasmid. the system for enzymatic digesting pMD/9T- ZmACY-1 plasmid is: adding 5 ul 10<K Buffer: 1 pl. Bambi I; 1 pl. Hind 111: 15 pl. Plasmid: adding RNase free water to make the system reach 50 uL. The PCR identification result of pMDI19T-ZmACY-1 plasmid colony is shown in Fig. ZA, the single band with a size of approximately 1320 bp is obtained by amplification. The plasmid is extracted from the correct transformant by bacterium solution PCR. and the result of plasmid double enzyme digestion verification is shown in Fig.2B. The identified positive clone is sent to Qingdao Qingkezixi Biotechnology Co.. LTD for sequencing. The result of sequencing shows that the part of the PCR product related to the coding sequence is the same as that of SEQ ID NO.2, indicating that the cloning is successful. Example 2: bioinformatics analysis Using DNAMAN software to conduct amino acid sequence alignment to the sequencing result, using MEGA 5.1 software to conduct phylogenetic tree analysis to the gene. Utilizing Bioxm software to conduct sequence analysis to the cloned ZmACY-1 gene. The analysis indicates that the sequence length (excluding the stop codon) of the open reading frame encoded by the gene is 1317 bp. encoding 439 amino acids. Prediction analysis IS performed by ProtParam(https://web.expasy.org/protparam/) online software. the result indicates that the molecular formula of the protein encoded by ZmAC}-] gene is C2173Hz307Ns99O62sS14, the relative molecular weight is 48.33 kD. the theoretical isoelectric point is 6.02. the total number of the positive charge residue (Arg+lvs) i.

BL-5199 LU102487 is 42. the total number of the negative charge residue (Asp+Glu} is 50, and the instability coefficient is 46.03. which belongs to an unstable-type protein. The conserved domains of the amino acid sequence encoded by the ZmACY-1 gene are analyzed by the conservative functional region analysis program CDS (conserved domains) of NCBI as shown in Fig.3. indicating that ZmACY-/ belongs to the zinc peptidase superfamily. and M20 Aminoacylase-1 subfamily, and has M20-acylase domain and five zinc-binding sites. The ZmACY-1 evolutionary analysis is referred to Fig. 4.

Example 3: the construction of prokaryotic expression vector pET28a- ZmACY-1 (1) Constructing recombinant bacterium Taking the Xbal-ZmACY-1-F and BamHI-ZmACY-1-R shown in table 1 as the primers. using the high-fidelity enzyme to conduct PCR amplification to the recombinant plasmid pMD19T-ZmACY-1, thereby adding protecting bases at both terminals of the plasmid. PCR reaction system is: adding 25 uL Takara PrimerSTAR Max DNA Polymerase: ! pl. Xbal-ZmACY-1-F: 1 pl. BamHI-ZmACY-1-R: 2 H[L(0.1-10 ng) pMDI9T-ZMACY-1; adding RNase free water to make the system to reach 50 pL. Recovering the target fragment from gel. Using Xba ! and BamlT 1 for enzymatic digesting prokaryotic expression vector pET28a and the amplification fragment of the positive clone PMDI9T-4CY-/ at 37°C for 5 h respectively. The enzymatic digestion reaction system is: adding 5 pL. 10<K Buffer; 1 pl. Xba I: 1 pl. BamH 1: pl. Plasmid: adding RNase free water to make the system to reach 50 ul. After the completion of enzymatic digestion reaction, recycling the product according to the gel recycling Kit. further ligating the target fragment and the vector fragment according to the following system. and putting them into the PCR instrument overnight for ligating at 16°C to obtain the prokarvotic expression Vector pE128a-ZmAC)-1. The ligating system is: adding 3 pl. Vector: 12 pl. PCR 18

B1-3199 LU102487 product: 1 ul. DNA Ligase; 2 pl. 10*Bufter: adding RNase free water to make the system reach 20 pl.

Transforming the recombinant plasmid into the prokaryotic expression host bacterium BL21 (DE3). and then coating it onto LB medium containing kanamycin (the concentration is 50 pg/ml.) for overnight culturing. After screening, extracting the plasmid to identify by enzymatic digestion, wherein the results of screening positive clones and conducting PCR verification are shown in Fig. 3A. Conducting amplifying and shaking to the strain after successful PCR verification and extracting the plasmid. The result of the identification of double enzyme digestion of the recombinant plasmid is shown in Fig.5B. And the result indicates that pET28a-ZmACY-1 prokaryotic expression vector has been successfully constructed. The positive plasmid is sent to Qingdao Qingkezixi Biotechnology Co. LTD for sequencing, and the same coding sequence shown in SEQ ID NO. 2 is obtained. (Il) Prokarvotic expression fusion protein The prokaryotic expression of ZmACY-1 gene in Escherichia coli BL21(DE3)

1. Inoculating the host bacterium BI21(DE3) cultured overnight into 10 ml. LB liquid medium containing Amp resistance in a volume ratio of 1:100. and putting it in a vibrate incubator for shaking culture 5 hours at a rotation rate of 200 rpm at 37 °C. and measuring the OD value until the ODen reaches 0.8. 2. Adding the IPTG with a concentration of 0.1 M to a final concentration of 0.05 mmol/L. and taking the absence of inducer IPTG as control in the experiment. Putting them in an incubator for inducing at 28°C for 5 h. Subsequently. taking 100 pL bacterium solution for centrifugation and then SDS-PAGE electrophoresis to determine whether the recombinant protein is expressed. 3. Taking 100 ul. BL21(pET28a- ACY-1) recombinant bacterium into 10 mL LB liquid medium. and conducting induced express according to the above method. centrifuging for 1 min at a rotation rate of 10.000 rpm, discarding the supernatant. and resuspending in PBS for precipitation, centrifuging for 10 min at a rotation rate of 10.000 rpm. repeating three times. Putting the collected thallus in an ice bath and subsequentlv 19

BL-3199 LU102487 ultrasonically breaking for 5 min, then repeating again. When the bacterium solution is comparatively clear, centrifuging for 20 min at a rotation rate of 10,000 rpm. 4. Taking 20 pl. of the supernatant and the precipitation suspension, adding pL 5xSDS loading buffer into the supernatant and the precipitation suspension respectively, putting them in 100°C boiling water to boil for 10 min, conducting SDS-PAGI electrophoresis analysis to determine whether the expression product is soluble (existing in the supernatant) or exists in a form of inclusion body (in the precipitation). The protein encoded by ZmACY-1 is induced by IPTG, and then subjected to centrifugation, resuspension and ultrasonically breaking. centrifugation, followed by SDS-PAGE detection. The result is shown in Fig. 6. the protein is about 48.53kD in size, which is consistent to the molecular weight of the /MACY-1 protein predicted by ProtParam, indicating that pET28a-ZmACY-1 can express protein in Escherichia coli BI21, thus the next step of salt tolerance and polvethylene glycol resistance analysis can be conducted.

Example 4: salt resistance and polyethylene glycol resistance test on recombinant host bacterium BL21 (pET28a-ZmACY-1) ‘The salt resistance analysis of recombinant host bacterium BL21 (pET28a-ZmACY- 1}: setting three LB liquid mediums containing different concentrations of NaCl (final concentrations of NaCl are 0.4 mol/L, 0.6 mol/l. and 0.8 mol/l. respectively). putting 1 ml. of IPTG-induced BL21(pET28a-ZmACY-1) host bacterium and control group BL21(pET28a) host bacterium respectively into mediums, and mixing them uniformiy. placing them in a vibrate incubator for vibrate- culturing at 37°C. and measuring OD values every other hour. Each treatment is measured 3 times. Polvethyvlene glveol resistance analysis of recombinant host bacterium BI21(pFT28a-ZmrACY-1); setting three LB liquid mediums containing different concentrations of PEG6000 (final concentrations of PEG6000 are 5%. 10% and 15% respectively), putting 1 ml. of induced BL21(pET28a-ZmACY-1) host bacterium and control group BL21(pl:T28a) host bacterium respectively into mediums. and

BL-3 199 LU102487 mixing them uniformly. placing them in a vibrate incubator for vibrate- culturing at 37°C. and measuring ODeoo values every other hour. Each treatment 1s measured 3 times.

Observing the effects of different stress times on the growth of the host bacterium. Taking the culture time as the abscissa. and the average Ogg value as the ordinate to plot growth curve. The results indicate that, compared with the host bacterium transformed with pET28a, the host bacterium transformed with pET28a-ZmACY-] grows well in the carly stage of low-concentration salt stress (Fig. 7A). however. under middle-concentration salt stress (Fig. 7B) and high-concentration salt stress (Fig.7C). the growth condition of the host bacterium transformed with pET28a- /mACY-1 is weaker than that of the control host bacterium, and under 0.8 mol/L high-concentration salt stress, the growth curve of pET28a-ZmACY-7 host bacterium cannot continue to grow over time. High concentration of salt weakens the host bacteria's ability to tolerate middle-concentration salt stress and high- concentration salt stress. However, under different concentrations of PEG6000 stress (Figs. 7D-F). the growth conditions of pET28a-ZmACY-1 host bacterium are all better than those of pET28a host bacterium. which indicates that the overexpression of ZmACY-1 in Escherichia coli BL21 makes the host bacterium have a certain polyethylene glycol resistance capability. and the OD difference is greater at high PEG concentration than at low PEG concentration. For example, at 5%PLG concentration. the OD value of PEG transgenic strain only rises slightly. while at 15% PEG concentration. the OD value of PEG transgenic strain increases about 50%. This indicates that. within the PEG concentration range used in the present invention, as the PEG concentration increases. the PEG resistant capability of the ZmACY-1 gene against Escherichia coli is increasing. Example 5: ZmACY-1 transgenic tobacco (1) The construction of plant expression vector pCambial 300-ZmACY-/ Taking PMD19-4C}-7 as a template. taking ZmACY-1-Xbal-F(the sequence is 21

BL-5199 LU102487 identical to the Xbal-ZmACY-1-F shown in table 1) and ZmACY-1-BamHI-R(the sequence is identical to the Bamill-ZMACY-1-R shown in table 1) as primers. conducting PCR amplification with high-fidelity enzymes to add protecting bases at both terminals of the plasmid thereby to recover the target fragment. Using Xbal and Bamlil for double enzymatic digesting pCambial300 expression vector and the amplification fragment of the positive clone PMD19T-ZmACY-1 at 37°C for 3h respectively. The enzymatic digestion system is as follows: adding 5 pl. 10xK Buffer: 1 ul. Xba E 1 pb Bamll I; 20 pl. Plasmid; adding RNasc free water to make the system reach 50 pl. The ligation system is as follows: 3 ul. [= Vector pCambial300 (after enzymatic degestion): 12 pl. PCR product (after enzymatic degestion): 1 ul. DNA Ligase: 2 uL 10xBuffer: adding RNase free water to make the system reach 20 pl.

Using the recombinant plasmid to transform Escherichia coli DHSa. culturing it in LB medium containing kanamycin (the concentration is 50 pg/mL) overnight at 57°C. and extracting the plasmid for identification by enzymatic digestion. The PCR identification and enzymatic digestion map are shown in Fig.8. As can be seen. the plant expression vector pCambial300-7mACY-1 is successfully constructed. The positive plasmid is sent to Qingdao Qingkezixi Biotechnology Co.. LTD for sequencing. which verified the correctness of the vector construction.

(II) ZmAC}-1 gene genetically transformed Nicotiana benthamiana Transforming LBA4404 competent cell

1. Taking the agrobacterium 1.BA4404 competent cell out of -80°C ultra-low temperature refrigerator. The competent bacterium solution is slightly melted. and then inserted into an ice bath for 10 min. 2. In ultra-clean worktable. adding 1 pl. expression vector plasmid pCambial 300-ZmACY-1 into the competent cell. blowing them gently to mix uniformly. Putting it in an ice bath for 5 min. translerring it in liquid nitrogen for 5 min. and transferring it in 37°C water bath kettle for water bath 5 min. further in an ice bath for 2 min. 3. Adding 600 pl. LB liquid medium into the competence agrobacterium after ice bath. and placing it into

BL-5199 LU102487 a vibrate incubator, wherein the condition settings are: 28°C. a rotation rate of 200 rpm, shaking culture 2-3h. 4. Centrifuging at a rotation rate of 10,000 rpm for 3 min, disgarding the supcrnatant. and using 100 pL YEB(or LB) liquid medium to resuspend and precipitate the thallus. 5. Coating the resuspended bacterium solution onto YEB solid medium containing 50 mg/l. kanamycin and 20 mg/l. rifampicin, placing it upside down in an incubator. culturing at 28°C for 36-48h. 6. Picking the agrobacterium single colony alter culturing for 36-48h and inoculating it to YEB(or LB) liquid medium (50 mg/L. Kan+20 mg/l.Ril) in a centrifuge tube for culturing overnight (>16 h). and conducting PCR verification after the bacterium solution is muddy. Conducting the bacterium preservation for the bacterium solution and the sterilized 50% glycerol in a proportion of 1:1. and keeping it in the -80°C refrigerator.

(III) Genetically transformed Nicotiana benthamiana (leaf disc method)

1. Taking 200 ul. of the agrobacterium 1LBA4404 strain containing expression vector pCambial300-ZmACY-1 stored in -80 °C ultra-low temperature refrigerator. inoculating it into 10 ml. YEB liquid medium (50 mg/l. Kan+20 me/LRif) and conducting shake-culturing overnight (>16 h) to activate the strain.

2. Continuing shake-culturing the activated bacterium solution in YEB liquid medium (50 mg/l. Kan) at a volume ratio of 1:50. and after culturing Overnight, collecting the sample by centrifugation (centrifuging at 7.000 rpm for 3 min). 3. In ultra-clean worktable, using 5% sucrose 1/2 medium (without agar) to resuspend the bacterium solution (ODggovalue: 0.6-0.8), and placing the Nicotiana benthamiana leaves after two days of pre-culture in the resuspension solution to soak for 5-10 min. drying on the filter paper after soaking. and subsequently transfering leaves into the coculture medium (MS+3 mg/l. 6BA+0.2 mg/L NAA+150 umol/l, acetosyringone. PH=5.8) coated with two lavers of filter papers to coculture for 3 days in dark place. 4. Transfering the tobacco leaves after coculturing for 3 days to the callus induction medium containing hygromycin and cephalosporm (MS+3 mg/LOBA+0.2 mg/LNAA125 mg/l Hye+250 mal Cet

BL-5199 LU102487 PH=5.8) for screening and culturing (25°C, light for 16h), and changing the medium once a week. 5. After the adventitious buds grow from the callus, cutting off the buds in ultra-clean worktable, and transferring them to a budding medium (MS+20 mg/LHye+200 mg/[.Cef, pH=5.8) for screening. When the buds form 3-5 cm seedlings, cutting the plants off, transferring them to (1/2MS+15 mg/l. Hyg+150 mg/l Cef, PH=5.6) rooting screening medium for culturing. 6. After the screened seedlings grow roots, opening the lid of tissue culture bottle. replacing with a sealing film, and cutting a number of cracks in the sealing film with a scalpel to train the seedlings. Two days later. using tweezers to gently remove the tissue culture seedlings, and rinsing their roots with clean water until the root culture medium is rinsed out, and then transplanting them in sterilized soil. 7. For the transplanted Nicotiana benthamiana. watering throughly. and placing them in a light culture at a constant temperature of 25°C, Covering them with a film for moisturizing in first three days. and culturing normally after three days.

(IV) Planting Nicotiana benthamiana (1) Seed disinfection and aseptic seeding Firstly, placing the seeds on a clean utensilto removeimpurities. and then transferring the sceds into an EP tube, washing the seeds once with sterile water. Secondly, further soaking them in 75% cthanol for 30-60 s. Subsequently. cleaning Nicotiana benthamiana seeds with 2% NaClO for 10 min. Finally further rinse with sterile water 3-5 times. Utilizing 1 mL aseptic pipette tip to inoculate the sterilized seed on MS medium. (2)Nicotiana benthamiana transplanting Firstly, prior to transplanting. sterilizing nutrient soil at 120°C for 30 min. and loading it into a the flower pot for planting Nicotiana benthamiana after the soil cooling. Using tweezers (lo transplant the vigorously growing Nicotiana benthamiana to the nutrient soil. with one plant per pot. Placing the transplanted Nicotiana benthamiana into a fight incubator. and cultivating at a constant temperature of 25°C.

2

BES 199 LU102487 The infection and screening process of Nicotiana benthamiana tobacco leaves are summarized in Fig 9. Conducting screening the infected leaves in the induced callus screening medium with hygromycin (Figure 9A) to obtain callus (Fig. 9B), moving the callus in the budding screened medium with hygromycin for screening to obtain buds (Fig.9C). cutting the buds off and putting the buds in rooting screening medium for continuing screening and culturing (Fig. 9D). The buds grew into shaped plants and gave birth to young roots (Fig.9E). indicating that the screening is completed. the seedlings can be trained and moved to the soil (Fig. 9F). (V} The identification of Nicotiana benthamiana tobacco The extraction of DNA After transplanting the positive Nicotiana benthamiana seedlings screened by hygromycin into nutrient soil to grow for two weeks. and cutting off tobacco leaves for DNA extraction.

Steps are as follows: 1. Placing 0.5 2 tobacco leaves in a mortar pre-cooled by liquid nitrogen. grinding them sufficiently and continuously adding hquid nitrogen. and quickly transferring them into a 2 mL EP tube. 2. Adding 700 ul.

CTAB extraction buffer (pre-heated in a water bath at 65°C) into EP tube. mixing them sufficiently and uniformly, and adding 20 pl.

B-mercaptoethanol. 3. Water bath at 65°C for 40 min. shaking uniformly gently every 20 min. 4. Alter cooling to room temperature. adding an equal volume of phenol: chloroform: isopentanol (1:1:1) solution, mixing uniformly and sufficiently, and putting the tube in an ice bath for 5 min, centrifuging at 12.000 rpm for 15 min. 3. Taking the supernatant out and repeating step 4. 6. Drawing the supernatant into a new EP tube. adding an equal volume of isopropanol to the EP tube. mixing uniformly. and placing it in a refrigerator at -20°C for standing 1h, and centrifuging at 12.000 rpm for 8 min. 7. Discarding the supernatant, and washing the precipitation 3 times with 70% anhydrous ethanol pre-cooled at 4°C. centrifuging at 12.000 rpm for 2 min. 8. After drying for a few minutes at room temperature, adding 50 pl. deionized water. centrifuging and store at -20°C for later use.

PCR amplification detection: taking the DNA extracted in previous steps as a

36-5199 LU102487 template to conduct amplification to ZmACY-/ gene. The Real Time PCR reaction system is: adding 12.5 pl. TBGreenPremixExTagll; 0.5 pl. qRT-ZMACY-1-F; 0.5 ul, qRf-ZmACY-1-R. 2.0 pl. cDNA after reverse transcription; adding RNase free water to reach 25 pl. The Real Time PCR reaction steps are: pre-denaturating at 94 °C for 5 min: denaturating at 94 °C for 30 s: anncaling at 55-60 °C for 30 s: clongating at 72 °C for 30 s: cycling 40 times.

Real-time fluorescent quantitative PCR: taking wild-type Nicotiana benthamiana as a control. using TBGreenPremixExTagll (11iRNaseHPlus) kit (TaKaRa company) to conduct fluorescent quantitative PCR to detect the expression condition of ZmACY-1 in Nicotiana benthamiana. The experiment takes the endogenous gene NbEFTa ol Nicotiana benthamiana as an internal reference gene (taking NbEFla-F and Nbl71a-R shown in table 1 as primers). to determine the relative expression level of ZmACY-1 at the transcriptional level (taking qRF- ZMmACY-1-F and qRT-ZmACY-1-R as primers). The reaction system of real-time fluorescent quantitative PCR is the same as above.

Extracting the screened seeding leaf DNA screened by hygromycin and obtained. and conducting the molecular detection to Vo positive transformed strains. The result is shown in Fig. 10A. À total of six strains of Ty generation ZmACY-1 positive scedings are obtained, all of which are successfully transformed positive seedlings. Three transgenic ZmACY-1 strans are selected and named as OE1, OF3 and OFS as the subsequent experiment materials. The leaf RNA of T3 generation transgenic ZmACY-1 purification seedling and wild-type Nicotiana benthamiana are extracied for real-time fluorescent quantificationto detect the relative expression level of ZmACY-1 in each strain. The method is the same as above. and the result is shown in Fig.10.As can be known, ZmACY-1 is almost not expressed in wild-type Nicotiana benthamiana, but 1s highly expressed in OEIL OF3 and OLS strains. which indicates that the altered phenotypes (character) in OEl. OFE3 and OFS strains. compared to the wild-type Nicotiana benthamiana. are directly or indircetly caused by the ZmrACY-1 gene.

26

BL-5199 LU102487 (VI) The identification of transgenic ZmACY-1 tobacco phenotype

1. Determination and comparison of the germination rate of transgenic ZmACY-] tobacco seeds and wild-type tobacco seeds In ultra clean worktable. aseptically sowing the seeds of transgenic strains QF 1. OE3, OES, and wild-type tobacco in a culture dish containing MS medium with one hundred seeds on each plate. The germination rates (see Fig. 11 A for statistical data) arc conducted with determination and comparison from the third day. In order to compare the growth between transgenic strains and wild-type strains (see Fig.11- B-D). the seeds of cach strain are aseptically sown on the same plate and 25 seeds are sown for cach strain. As can be known. ZmACY-1 gene can enhance the germination rate of tobacco seeds. and promote the growth of tobacco.

2. The identification of the phenotype of transgenic ZmACY-1 tobacco plant and wild-type tobacco plant After culturing the T; generation transgenic strains OE1, OE3. OFS. and wild-type tobacco seedlings in MS medium for 15 days. transplanting them into soil. 15 days later. measuring the plant height (sce Fig.12C for the result). the leal area (see Fig.12B for the result). the stem diameter (see Fig. 12D for the result). the root length (sce Fig. 12F for the result). the number of leaves (see Fig. 12A for the result), the root area (sec Fig.12G for the result). the fresh weight of overground portion (see Fig.12E for the result). and the fresh weight of underground portion (see Fig. 1211 for the result) of onc-month-old tobacco plant.

3. Extracting the Ical RNAs of the same portion of transgenic strains OE]. OF3. OES and wild-type Nicotiana benthamiana and conducting real-time fluorescent quantitative PCR. The PCR method is the same as that in Section (5) of Example

5. adopting NbEXPAT-F. NbEXPAI-R shown in table 1 as primers to conduct amplification to the NBEXPAT gene. and adopting Nbl:IN2-F, NbEIN2-R shown in table I as primers to conduct amplification to the NBEIN2 gene. Measuring the

BL-3199 LU102487 relative expression level of the two genes NBEXPAI (GenBank number is NM 001325646.1), NBEIN2 (GenBank number is XM_016579720.1). The results are shown in Fig.13.

NBEXPA! belongs to the expansin protein family. which plays an extremely important role in promoting leaf growth. NhE/N2 1s an essential positive regulator in the ethylene signaling pathway. As can be seen from Fig. 13, the expression levels of NBEXPAI, NBEIN2 in transgenic Nicotiana benthamiana is dramatically higher than those of wild type. It indicates that the overexpression of ZmACY-1 gene in Nicotiana benthamiana can cause the acceleration of plant growth speed by positively regulating the expression of plant growth-related genes NBEXPA1 and NBEIN2. As can be scen. ZmACY-1 not only responses to the regulation of phytohormone, thereby promoting the growth and development process of plant. but also plays an important role in the aspect of enhancing the biomass and yield of plant. 5, Picking the fully developed pods of middle portion of tobacco in mature period and conducting weighing and measuring fruit length and fruit width (sce Fig. 14 for the results). As shown in Fig. 11. Fig.12 and Fig.14. the overexpression of ZmACY-1 in Nicotiana benthamiana tobacco dramatically promotes the growth and development of the plant. The germination rate. the plant height, the root length. the stem diameter, the leaf area (the fifth functional leaf). the root areca. the fresh weight of overground portion. the fresh weight of underground portion, pods (mature plant) of transgenic plants are all dramatically larger than those of wild-tvpe plants. ZmACY-1 can promote the growth of Nicotiana benthamiana tobacco. (VID The study on the response of transgenic ZmACY-1 tobacco lo salt stress and PLG stress Effects of salt stress and PEG stress on physiology and biochemistry of the transgenic ZmAC}-/ Nicotiana benthamiana I. Trrigating one-month-old Nicotiana benthamiana seedlings with 350 mmol L 28

BL-5199 LU102487 NaCl to conduct salt stress, and treating with 20% PEG6000 aqueous solution to conduct PEG stress.

Response of transgenic Znr4ACY-7 Nicotiana benthamiana to salt stress The result of conducting 350 mmol/L.

NaCl solution treatment to one-month-old Nicotiana benthamiana of T; generation indicates that. after treating for 10 davs. both wild-type and transgenic ZmACY-1 strains turn chlorosis and yellowing gradually. wherein the condition of the chlorosis and yellowing of the transgenic ZmACY-1 Nicotiana benthamiana is more obvious, dramatically higher than that of wild type (Fig. 135A). In addition. watering with clear water is used as a control to measure the fresh weight of overground portion (Fig. 158) and chlorophyll content (Fig.15C) of Nicotiana benthamiana tobacco of each strain after 10 days of salt stress treatment.

The result shows that, both the fresh weight of overground portion and chlorophyll content of transgenic strain after 10 days of clean water irrigation are higher than those of wild type apparently. but after 10 days of salt stress. both the fresh weight of overground portion and chlorophyll content of each strain decrease. and the fresh weight of overground portion and chlorophyll content of transgenic strain are dramatically lower than those of the wild type.

This indicates that the overexpression of ZMACY-1 in Nicotiana benthamiana weakens the salt tolerance of plants.

Response of transgenic ZmACY-/ Nicotiana benthamiana to drought stress.

In the present research. the one-month-old Nicotiana benthamiana of T3 generation is subjected to drought treatment. and water irrigation is used as a control.

The result shows that. after 7 days of drought treatment, compared with wild-type Nicotiana benthamiana tobacco. the wilting degree of the transgenic strains are more serious. and after two days of rehydration(rewatering). the recovery degree of wild-type Nicotiana benthamiana tobacco 1s significantly higher than that of the ZmAC}-/ transgenic strains (Fig.16A). Morcover. the present research further determines the fresh weight of overground portions of Nicotiana benthamiana tobacco of cach strain under untreated and drought-treated conditions.

The result shows that. 29

BL-5199 LU102487 drought stress significantly causes the decreases of the fresh weights of overground portions of both the wild-type and transgenic strains, and under the untreated condition, the fresh weight of overground portion of transgenic strains is significantly higher than that of the wild type.However, under the drought stress treatment. the fresh weight of overground portion of transgenic strains is lower than that of wild tvpe (Fig.16B). The above results indicate that, different from the performance in Escherichia coli BI.21, the overexpression of ZmAC}-1 in Nicotiana benthamiana tobacco weakens the drought resistance capability of the plants. (1) Determination of malondialdehyde (MDA) content Cutting 0.2 g Nicotiana benthamiana leaves. adding 3 ml. of 3% trichloroacetic acid (TCA). grindinginto a slurry. and centrifuging at 5.000 rmp for 10 min.

Taking the supernatant into a test tube. adding an equal volume of 0.5% thiobarbituric acid (TBA). and putting the test tube in a boiling water bath alter mixing uniformly.

After 30 min. taking it out to cool and then determining its absorbance at 450 nm. 532 nm and 600 nm”, MDA content (nmol/1.)=6.45 <*(As3>-Ac00)-0.56<A4s0 The results are shown in Fig.17D.

As can be seen. the peroxidase activitv of transgenic ZmACY-/ Nicotiana benthamiana is stronger than that of wild-type Nicotiana benthamiana after salt stress and drought stress. (2) Determination of relative electric conductivity Cutting about 0.2 g Nicotiana benthamiana leaves. transfer them into a test tube, adding 20 mL deionized water to the test tube until the leaves are immersed. and let standing for 4 h at room temperature.

Alter shaking © uniformly and sufficiently. the conductivity of the leaves is measured with a conductometer as Ry.

After boiling in a boiling water bath tor 25 min and cooling. shaking uniformly. and further determining the electric conductivity Ro.

Relative conductivity 7Rı/Rox 100% The results are shown in Fig.17F.

As can be seen, the relative conductivity of Sa

31.-5199 LU102487 transgenic ZmACY-1 Nicotiana benthamiana is higher than that of wild-type Nicotiana benthamiana after salt stress and drought stress. (3) Determination of protective enzyme activity Extraction of crude enzyme solution: cutting 0.2 g Nicotiana benthamiana leaves and putting them into a mortar, adding 2 mL of 0.1 mol/l. pre-cooled Tris-HCL buffer.

After grinding. drawing them into a 2 mi, centrifuge tube, and then using 1 ml. buffer to rinse the left substances in mortar. and drawing them into the centrifuge tube.

Centrifuging at 8.000 rpm at 4°C for 30 min. taking the supernatant, ie... the crude enzyme solution. and subpackaging and storing it in a refrigerator at -20°C. ‘LJ Determination of superoxide dismutase (SOD) activity The SOD activity 1s determined by the Nitrogen Blue Tetrazolium (NBT) method. using a microplate reader to determine the absorbance value of the processed crude enzyme solution sample at the wavelength of 560 nm”. SOD activity (U/mg protein)=(Au-A)<V1x(0.5A0< W=V1); in which Ag: the absorbance value of control tube at 560 nm: A: the absorbance value of sample tube at 560 nm: Vy: the total volume of enzyme extraction solution (mL): Vi: the volume of enzyme solution added during measurement (mL): W: the fresh weight of sample (g). The results are shown in Fig. 20B.

As can be scen. the peroxidase activity of transgenic ZmACY-1 Nicotiana benthamiana is stronger than that of wildtype Nicotiana benthamiana after salt stress and drought stress. (2) Determination of Peroxidase (POD) activity The POD activity is determined by the guaiacol color-developing method. using a microplate reader to determine the absorbance value of the crude enzyme solution sample at 470nm once every other min (5 times). Taking a change of 0.01 per minute as one unit of enzyme activity 1. POD activity "10° ~AAL70C Ve ti AAgo: the change of absorbance value within the reaction time (D: C: the concentration of enzyme solution protein (pg/ul.): Ve: 31

BL-3199 LU102487 the volume of enzyme solution taken at the time of determination (mL): t: reaction time (min). The results are shown in Fig.17A. As can be seen. the peroxidase activity of transgenic ZmACY-1 Nicotiana benthamiana is stronger than that of wild-type Nicotiana benthamiana after salt stress and drought stress. 3) Determination of catalase (CAT) activity The guaiacol color-developing method is adopted for determination. using a spectrophotometer lo determine the absorbance value of the crude enzyme solution sample at 470nm once every other min (3 times). Taking a change of 0.01 per minute as one unit of enzyme activity.

3. Catalasc (CAT) Drawing 22.5 pl enzyme extraction solution. adding 1.5 ml. of 100 mM PBS and

3.75 uL of 30% 11:0. and mixing them uniformly to remove air bubbles. The absorbance values are recorded at 240 nm once each every 10 sec, and finally the change values of absorbance values are used to indicate the size of enzyme activity. The results are shown in Fig.17C.As can be seen, the catalase activity of transgenic ZmACY-1 Nicotiana benthamiana is stronger than that of wild-type Nicotiana benthamiana after salt stress and drought stress. In summary. under the adversity condition of salt stress and drought stress. superoxide dismutase (SOD) can transform the intracellular harmful substances into H:0>and O2. and CAT and POD will eliminate these products, therefore. under the synergistic effect. these three kinds of antioxidases relieve the damage of adversity stress 10 plants. MDA is the final decomposition product of lipid peroxidation. and the level of MDA reflects the degree of plant damage. In order to further verify that the overexpression of ZmACY-! in Nicotiana benthamiana tobacco weakens the drought resistance and salt tolerance capability of plants. the present research determines the contents of protective enzymes POD. SOD. CAT and the content of MDA and relative conductivity in the leaves of cach strain after two days of treatments with clean water (CK). 20% PEG600 and 350 mmol 1. NaCl.

31-5199 LU102487 The result shows that both drought stress and salt stress increase the activities of protective enzymes POD. SOD. CAT. and the MDA content and the relative conductivity of the transgenic strains and wild-type Nicotiana benthamiana tobacco (Figs.17A-k). Wherein. under salt stress and drought stress, the activities of protective enzymes POD. SOD and CAT of transgenic strains are lower than those of wild type. however the MDA content and relative conductivity of transgenic strains arc higher than those of wild type.

The data is calculated adopting 242%" relative quantitative analysis method!” Microsoft Excel 2007 is adopted to treat the data. and plot to analyze.

As can be scen. the transgenic ZmAC}-7 Nicotiana benthamiana suffers more severe damage after salt stress and drought stress.

As can be known from the technical knowledge, the present invention can be implemented by other embodiments without detaching the spirit essence or essential features. Thus. the above-disclosed embodiments disclosed above are only illustrative in all aspects. and not the only ones. All alterations within the scope of the present invention or the scope equals to the present invention arc included in the present invention.

SEQUENCE LISTINGS LU102487 <118> Qingdao Agricultural University <120> Use of Aminoacylase-1 <130> C1CNLU281544 <168> 14 <178> SIPOSequenceListing 1.0 <218> 1 <211> 439 <212> PRT <213> Zea mays <4pe> 1 Met Pro Pro Pro Leu Arg Cys Leu Leu Leu Ala Phe Val Val Val Leu 1 5 18 15 Ser Gly Phe Pro Arg Leu Ala His Pro Phe Thr Ala Leu Glu Ser Asp 38 Gln Ile Ala Arg Phe Gln Glu Tyr Leu Arg Ile Arg Thr Ala His Pro 40 45 Ser Pro Asp Tyr Ala Gly Ala Ser Ala Phe Leu Leu His Tyr Ala Ala 50 55 60 Ser Leu Gly Leu His Thr Thr Thr Leu His Phe Thr Pro Cys Lys Thr 65 78 75 80 Lys Pro Leu Leu Leu Leu Thr Trp Arg Gly Ser Asp Pro Ser Leu Pro 85 se 95 Ser Val Leu Leu Asn Ser His Met Asp Ser Val Pro Ala Glu Pro Glu 188 185 118 His Trp Ala His Pro Pro Phe Ala Ala His Arg Asp Pro Thr Thr Gly 115 128 125 Arg Ile Tyr Ala Arg Gly Ala Gln Asp Asp Lys Cys Leu Pro Val Gln 130 135 148 Tyr Leu Glu Ala Ile Arg Gly Leu Gln Ala Ala Gly Phe Ala Pro Ala 145 150 155 168 Arg Thr Ile His Ile Ser Leu Val Pro Asp Glu Glu Ile Gly Gly Ala 165 170 175 Asp Gly Phe Asp Lys Phe Ala Arg Ser Glu Glu Phe Arg Ala Leu Asn 180 185 190 Ile Gly Phe Met Leu Asp Glu Gly Gln Ala Ser Pro Thr Asp Val Phe 195 200 205 Arg Val Phe Tyr Ala Asp Arg Leu Val Trp Arg Leu Val Val Lys Ala 218 215 220 Ala Gly Ala Pro Gly His Gly Ser Arg Met Leu Asp Gly Ala Ala Val 225 230 235 240 Asp Asn Leu Met Asp Cys Val Glu Thr Ile Ala Ala Phe Arg Asp Ala 245 258 255 Gln Phe Arg Met Val Lys Ser Gly Glu Lys Gly Pro Gly Glu Val Val 260 265 270 Ser Val Asn Pro Val Tyr Met Lys Ala Gly Ile Pro Ser Pro Thr Gly

Phe Val Met Asn Met Gln Pro Ser Glu Ala Glu Val Gly Phe Asp Leu 298 295 300 Arg Leu Pro Pro Thr Glu Asp Ile Glu Gln Ile Lys Arg Arg Val Glu 385 318 315 328 Glu Glu Trp Ala Pro Ser His Lys Asn Leu Thr Tyr Glu Leu Val Gln 325 330 335 Lys Gly Pro Ala Thr Asp Val Ser Gly Arg Pro Val Ser Thr Ala Thr 340 345 350

Asn Ala Ser Asn Pro Trp Trp Leu Thr Phe Glu Arg Ala Ile Ala Ser

355 360 365 Ala Gly Gly Glu Leu Ser Lys Pro Glu Ile Leu Ser Ser Thr Thr Asp

378 375 380 Ser Arg Phe Ala Arg Gln Leu Gly Ile Pro Ala Leu Gly Phe Ser Pro 385 390 395 400 Met Thr Arg Thr Pro Ile Leu Leu His Asp His Asn Glu Phe Leu Glu 405 410 415 Asp Arg Val Phe Leu Arg Gly Ile Gln Val Tyr Glu His Val Ile Arg 420 425 430

Ala Leu Ser Ser Phe Gln Gly

435 <210> 2 <211> 1320 <212> DNA <213> Zea mays <400> 2 atgeccgecege etetecgetg teteettete geettegteg tegteectete ceeettecce 60 cgtctegece acccecttecac ggetetecgag tetgaccaga tegecegett ccaggaatac 128 ctcecgecatcc gaactgcgca cccatcccce gactacgceg gegccagege cttectecta 180 cactacgceg cttegetegg tetecacacc accacgetec acttcacecc gtgcaagacc 240 aagcccetec tectectcac ctggegagge tecgateect cecteecete cgtgetectc 300 aactcccaca tggactccgt ccccgecggag cccgagecact gggcgcacee tccattegec 368 gcgcaccgcg acccgaccac gggccgcatc tacgcgcgcg gcgcacagga cgacaagtge 420 ctceccgtec agtacctega ggegatecgg ggectgeageg cegeggeggtt cgetecegec 488 cgcaccatee acateteget tgtccccgac gaggagatcg gcegcecgga tgggttcgac 540 aagttcgecc gatcggagga gttecgceec ctcaacatcg ggtttatgct cgacgaggeg 698 Caggcetcec cgacggacgt gttcagagtc ttttacgcgg acaggctget gtggaggetce 660 gtcgtgaagg cggeggggee gccagggcat gggtcgagga tgttggacgg cgccgecgtt 720 gacaatttga tggattgcgt ggagaccatc getgegtteca gggatgegea gttcaggatg 780 gtgaagtccg gggagaaggeg tcctgegegag gtggtctcag tcaaccctgt gtacatgaag 840 Eccggcatac caagecccac ggegtttegtg atgaacatge aaccttcaga agcggaggtc 906 gectttgacc tecgcettec tccaaccgaa gacatcgage agatcaageg gagggtcgaa 960 gaggaatggg caccatctca caadaacctg acctacgage tggtgcagaa aggtccggeg 1028 acggatgtgt ccggacgtce cgtatccaca gegacgaacg cgtegaacce gtggtgectg 1980 acgttcgaga gggccatcgc ecteegegggt ggggagctet ctaagectga gatectetet 1148 tcgaccacgg actcacectt tgegeggeag ctgggcatee ctgeccteogg gttttetceceg 1200 atgaccagga cececatact gctacatgac cataacgagt ttctggaaga cagagtgttc 1260 ctgaggegca tccaagtgta cgaacatgtc atcagagcac taagctecett ccaaggetga 1320 <218> 3 <211> 24

<212> DNA <213> Artificial Sequence <400> 3 atgccgecge cecetetecg ctgt 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <406> 4 tcagcctteg aacgagctta gtgc 24 <218> 5 <211> 21 <212> DNA <213> Artificial Sequence <400> 5 aagacatcga gcagatcaag € 21 <218> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 tcgctgtgga tacgggac 18 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <480> 7 gctctagaat gecgeegecg cetetecect gt 32 <218> 8 <211> 32 <212> DNA <213> Artificial Sequence <400> 8 cggegatcctc agccttggaa cgagettagt ge 32 <216> 9 <211> 22 <212> DNA <213> Artificial Sequence <400> 9 ccteaagaag gttggataca ac 22

<210> 18 <211> 22 <212> DNA <213> Artificial Sequence <400> 10 tecttegecte attaatctgg tc 22 <218> 11 <211> 22 <212> DNA <213> Artificial Sequence <486> 11 ttgtttctect gcttctggat gg 22 <218> 12 <211> 24 <212> DNA <213> Artificial Sequence <488> 12 cttaatgcag cagtgtttgt acca 24 <218> 13 <211> 24 <212> DNA <213> Artificial Sequence <460> 13 ggcataatag atctggeatt ttec 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <480> 14 tatctaagag catcggtgca gttg 24

Claims (10)

BL-5199 LU102487 CLAIMS:

1. Use of Aminoacylase-1 in improving plant characters. improving plant characters is selected from any one of the group consisting of: increasing a germination rate of plant seeds: increasing plant height increasing leaf arca: increasing stem diameter: increasing root length: increasing a number of leaves: increasing root area: increasing pod weight: and increasing plant fresh weight.

2. The use of claim 1. characterized in that the Aminoacylase-1 is a plant-derived Aminoacviase-1. preferably. the Aminoacvlase-1 is maize Aminoacviase-1; preferably. a protein of the Aminoacviase-1 is selected from a protein indicated as SEQ ID NO.1. or a protein having more than 90% sequence homology with the protein indicated as SEQ ID NO.1 and having enzymatic activity of Aminoacvlase- 1: preferably, encoding a nucleotide sequence of the Aminouevlase-! indicated as SEQ ID NO.2: preferably. improving plant characters is improvement of tobacco characters: preferably. improving plant characters is improvement of characters by increasing expression quantities of NBEXPAI gene and/or NBEIN2 gene.

3. À method for improving plant characters. the method is to transfer expressible 31

BL-S199 LU102487 Aminoacvlase-1 genes into plants, improving plant characters is selected from any one of the group consisting of: increasing a germination rate of plant seeds: increasing plant height: increasing leaf area: increasing stem diameter: increasing root length: increasing a number of leaves: Increasing root area; increasing pod weight: and increasing plant fresh weight,

4. The method of claim 3. characterized in that the Aminoacviase-1 is a plant- derived Aminoacylase-1: preferably. the Aminoacylase-1 1s maize Aminoacylase-I; preferably. a protein of Aminoacylase-1 is selected from a protein indicated as SEQ 1D NO.1, or a protein having more than 90% sequence homology with the protein indicated as SEQ ID NO.1 and having enzymatic activity of Aminoacvlase-1; preferably. a nucleotide sequence encoding the Aminoacylase-1 is indicated as SEQ ID NO.2: preferably. improving plant characters is improvement of tobacco characters: preferably. improving plant characters ts improvement of characters by increasing expression quantities of NBEXPAT gene and ‘or NBEIN2 gene.

5. Use of Aminoacylase-1 in enhancine polyethylene glycol-resistance for bacterium.

6. The use of claim 5. characterized in that the polvethvlene glvcol-resistance for

BI.-5199 LU102487 bacterium means that the bacterium grows in a liquid medium containing 1 wt%4-20 wie. preferably 5 wt%-15 wi% polyethylene glycol: preferably. the Aminoacylase-1 1s a plant-derived Aminoacylase-1, preferably, the Aminoacylase-1 1s maize Aminoacvlase-1, preferably, a protein of the Aminoacylase-1 1s selected from a protein indicated as SEQ ID NO.1. or a protein having more than 90% sequence homology with the protein indicated as SEQ ID NO.1 and having a enzymatic activity of Aminoacy lase-1: preferably. a nucleotide sequence encoding the Aminoacylase-1 is indicated as SEQ HD NO.2: preferably. the bacterium is Escherichia coli, more preferably, the bacterium is Escherichia coli BL2}.

7. A method for enhancing a capability of potvethvlene glvcol-resistance for bacterium. the method is Lo transgene expressible Amrinoacvlase-1 genes into the bacterium. 8, The use of claim 7. characterized in that the polyethylene glycol-resistance for bacterium means that the bacterium grows in a liquid medium containing 1 w1%- wt%. preferably 5 wit%-15 wi% polyethylene glycol: preferably. the Aminoacyluse-1 is a plant-derived Aminoacylase-1; preferably. the Aminoacylase-] is maize Aminoacviase-1: preferably, a protein of the Aminoacylase-1 is selected from a protein indicated as SEQ ID NO.1. or a protein having more than 90% sequence homology with the protein indicated as SEQ ID NO.1 and having enzymatic activity of Aminoacylase- 1: preferably. a nucleotide sequence encoding the 4minoacvlase-1 is indicated as SEQ [D NO.2: 36

BL-5199 LU102487 preferably, the bacterium is Escherichia coli. more preferably, the bacterium is Escherichia coli BL21.

9. Arccombinant genetic engineering vector, containing expressible Aminoacylase- I genes: preferably. the Aminoacylase-1 1s a plant-derived Aminoacylase-1: preferably. the Aminoacylase-1 is maize Aminoacylase-1; preferably, a protein of the Aminoacylase-1 is selected from a protein indicated as SEQ ID NO.1. or a protein having more than 90% sequence homology with the protein indicated as SEQ ID NO.! and having a cnzymatic activity of Aminoacylase-1: prefcrablv. a nucleotide sequence encoding the Aminoacyiase-1 1s indicated as SEQ 1D NO.2: preferably, the recombinant genetic engineering vector is a recombinant prokaryotic gene expression vector. preferably, a vector of the recombinant prokaryotic gene expression vector is pET2Ba: preferably. the recombinant genetic engineering vector is a recombinant cukarvotic genc expression vector. preferably. a vector of the recombinant cukaryotic gene expression vector 1s PCAMBIA 1300: preferably. the recombinant genetic engineering vector is a recombinant gene expression shuttle vector.

10. A host containing the recombinant genetic engineering vector of claim 9: preferably. the host is a bacterium or a plant; preferably. the bacterium is Escherichia coli, more preferably. the bacterium is Escherichia coli BL.2 1: preferably. the plant is tobacco.