Scenedesmus rich in oil and culture application thereof
Technical Field
The invention belongs to the fields of biotechnology and biological energy, and particularly relates to scenedesmus rich in oil and culture application thereof.
Background
As fossil energy is decreasing and the greenhouse effect is increasing due to the use of fossil energy, more and more researchers are focusing on the development and utilization of renewable energy. Biomass can be the most important renewable energy on earth, and comprises forestry biomass, crops, aquatic plants, agricultural wastes and the like. Among the many biomass energy sources, microalgae are important renewable resources. They have the characteristics of wide distribution, large biomass, high photosynthesis efficiency, strong environment adaptability, short growth period, high biomass yield and the like. The cells contain unique primary or secondary metabolites and are chemically complex. The solar energy conversion efficiency of the microalgae can reach 3.5 percent, the microalgae is a potential resource for producing medicines, fine chemicals and novel fuels, and fatty acid obtained from the microalgae can be converted into fatty acid methyl ester, namely biodiesel.
With the development of the world economy, the use and consumption of a large amount of fossil energy, resulting in the shortage of energy and the increasing deterioration of the environment, particularly CO2The greenhouse effect is more and more serious due to the sharp increase of the carbon dioxide, and besides, the industrial waste gas from the petroleum and chemical industry contains high-concentration CO2The concentration of acid gases such as SOx and NOx is high in addition to the gas (15 v% to 30 v%). Short growth period of microalgae, high photosynthetic efficiency, and CO2High fixing efficiency which is more than 10 times of that of terrestrial plants under certain conditions, and can reduce CO2The discharge and the culture cost are reduced; CO removal2Besides, some SOx, NOx and other components in the exhaust gas are purified along with the metabolism of the microalgae, so that the emission of harmful gases is effectively reduced. Therefore, biodiesel produced using microalgal oil as a feedstock is currently the most likely renewable energy source for fuels needed for world transportation.
At present, more researches are carried out on oil-producing microalgae such as chlorella and scenedesmus. CN20110144545.6 discloses a ScenedesmusScenedemus sp.) Algal strains ofThe growth can be carried out by using an artificial culture medium or properly treated wastewater, and is characterized in that the oil yield is higher than that of most of the existing algal strains, and the application field of the algal strains comprises CO2The fixation, the purification of waste water, and the production of grease, protein, pigment, starch, polysaccharide and nucleic acid. CN201110427579.6 discloses a Scenedesmus strain (Scenedesmus sp.Koch)Desmodesmus sp.) ENN2203A, the scenedesmus has the characteristics of high temperature resistance and easy collection, has strong environmental adaptability, is suitable for high-density culture, can be used for treating sewage containing nitrogen and phosphorus, can be used for reducing carbon dioxide emission, and can be used for producing biodiesel or used as aquatic product bait or animal feed and the like. However, in the course of culturing, the algal strain was cultured by introducing a mixed gas of carbon dioxide and air at a concentration of 1.5 to 2% into the culture medium until the 16 th day, and the final dry weight was 10.93 g/L. But in practical application, when CO is in the environment2When the volume fraction is more than 5v%, the growth of most microalgae is inhibited, and the carbon fixation efficiency is influenced. And when the introduced fossil fuel waste gas contains gases such as SOx, NOx and the like with high concentration, the growth of microalgae can be inhibited and the carbon fixation efficiency can be reduced.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides scenedesmus rich in grease and culture application thereof. The scenedesmus provided by the invention can tolerate high-concentration SO2Can use CO-containing2And SO2The flue gas is irradiated for autotrophic growth to obtain biomass, the carbon fixation efficiency is high, and the obtained biomass is rich in grease and can be used for producing biodiesel.
The invention relates to a Scenedesmus HY-D3 which is classified and named as Scenedesmus (Scenedesmus sp.) (Scenedesmus acutus) The strain has been preserved in China general microbiological culture Collection center (CGMCC) in 2018, 2 and 5 months, and the preservation number is CGMCC No. 15298.
The scenedesmus HY-D3 rich in oil provided by the invention is green in algae cells under a microscope, and is often gathered into groups, the groups are usually composed of 4-8 cells, and the cells of the groups are arranged in a straight line. The single cells are oblong, oval, smooth in cell wall, containing melanosomes, each cell containing a protein nucleus, and are about 3-6 μm long and about 2-3 μm wide. The upper and lower ends of the cells on both sides of the population have 1 long or straight or slightly curved spikes, and both ends of the cells in the middle and the side free parts of the cells on both sides have no spikes. 4 cells with a population width of 10-24 microns and a puncture length of 10-13 microns.
The Scenedesmus HY-D3 rich in oil provided by the invention can tolerate CO2Has a concentration of 40v%, and is tolerant to SO2The concentration of (A) can reach 400 x 10-6(v/v),SO2The removal rate of the catalyst reaches more than 50 percent.
The 18S rDNA gene sequencing analysis result of the oil-rich scenedesmus HY-D3 provided by the invention is shown in a sequence table. According to the sequence alignment, the Scenedesmus HY-D3 of the invention has a difference with the published 18S rDNA data of Scenedesmus strains.
The culture method of the Scenedesmus HY-D3 rich in oil comprises culturing in a photobioreactor with fresh water culture medium such as BG11, SE, etc. under the conditions of illumination intensity of 1500-2And (3) culturing the gas with the content of 5-40 v% until the stationary phase is finished, and harvesting the microalgae cells. Through detection, the dry weight of the algae cells reaches more than 8g/L, and the total lipid content of the cells accounts for more than 40 percent of the dry weight of the cells.
The scenedesmus HY-D3 of the invention is used for fixing CO2The use of (1). The strain can tolerate CO up to 40v%2Higher concentration of CO2The efficiency is fixed.
The scenedesmus HY-D3 is applied to production of microalgae grease. Under the appropriate growth conditions, the total lipid content of the cells of the scenedesmus strain can account for more than 40% of the dry weight of the cells, and the production of biodiesel can be carried out.
The scenedesmus HY-D3 is used for purifying substances containing CO2And SO2In exhaust gases or flue gases. The strain can utilize the strain containing CO2And SO2The waste gas or the smoke is subjected to illumination autotrophic growth to obtain biomass rich in grease, and CO in the waste gas or the smoke2Not more than 40% by volume of SO2The content is not more than 400 × 10-6(v/v). Specifically, fresh water culture medium such as BG11, SE, etc. is used for culture, and CO is introduced from the bottom of the reactor2And SO2The illumination intensity of the culture is 1500-.
The scenedesmus HY-D3 can also tolerate low temperature, can normally grow at the temperature as low as 10-15 ℃, and keeps higher biomass yield.
Compared with the prior art, the invention can bring the following beneficial effects:
(1) the scenedesmus HY-D3 bred by the method can tolerate high-concentration SO2Can utilize CO in the exhaust gas2Autotrophic growth and CO fixation2The problem of greenhouse effect brought by the current industrial society is solved; at the same time can resist SO in the waste gas2Avoiding the high concentration of SO when the microalgae grows by utilizing the waste gas2Inhibiting photosynthesis of microalgae and maintaining normal growth of microalgae.
(2) The strain can be used for fixing CO in flue gas2Meanwhile, part of SO in the flue gas can be utilized2The sulfur is converted into biomacromolecules of algae cells through a sulfur metabolism way, and the smoke can be purified.
(3) The algal strain has the advantages of high growth rate, short growth cycle (no more than 10 days), high total lipid content in algal cells, suitability for producing biodiesel and capability of solving the problem of lipid source in biodiesel production.
Biological material preservation instructions
Scenedesmus (A) and (B) provided by the inventionScenedesmus acutus) HY-D3, deposited in China general microbiological culture Collection center; address: the institute of microbiology, national academy of sciences No. 3, Xilu No.1, Beijing, Chaoyang, Beijing; the preservation number is: CGMCC number 15298; the preservation date is as follows: year 2018, month 2 and day 5.
Detailed Description
The present invention will be described in further detail by way of examples. In the present invention, v% is a volume fraction.
Example 1 isolation and acclimatization screening of Scenedesmus HY-D3
(1) Obtaining starting algae strains: taking 150mL of water sample from Channa argus lake in 2013 and 10 months, filtering the water sample with gauze to remove large impuritiesAnd inoculating 50mL of the filtered water sample into 200mL of BG11 culture medium for enrichment culture, wherein the illumination intensity of the culture is 5000Lux, the temperature is 25 ℃, the illumination period is 24 hours, the light-dark time ratio is 14:10, and the culture medium is green after about half a month of culture. Diluting the water sample of enrichment culture to 10-5And coating the mixture on a BG11 solid plate under aseptic conditions for culture, wherein the illumination intensity of the culture is 5000Lux, the temperature is 25 ℃, green single algae colonies appear on the plate after about 10 days of culture, selecting the single algae colonies to culture on a shake flask, the culture temperature is 25 ℃, the illumination intensity is 5000Lux, after 10 days of culture, observing and determining whether the single algae colonies are pure algae strains by a microscope, and repeating the steps until the pure culture algae strains are determined. The pure algae strain is numbered HY-3 after repeated culture.
(2)CO2The domestication culture: inoculating the pure algae cultured in the shake flask in the step (1) into a microalgae aeration culture device for acclimatization culture, wherein the illumination intensity is 5000Lux, the temperature is 25 ℃, and CO in the introduced gas2The content of (A) was gradually increased from 5v% to 40v%, each time increased by 5v%, and the culture was terminated after 10 days, and the acclimation culture was repeated 3 times.
(3) And (3) culturing the algae liquid domesticated and cultured in the step (2) in a plate streaking mode to obtain pure algae seeds, wherein the culturing step is the same as the step (1).
(4)SO2The domestication culture: introducing CO into the algae liquid in the logarithmic growth phase of the algae strains in the step (3)220v% of mixed gas, culturing at 25 deg.C and illumination of 5000Lux, and injecting SO into the mixed gas2Gas SO of algae species2The tolerance of the culture medium is cultured, and SO in the mixed gas is generated in the culture process2In an amount of from 50X 10-6(v/v) is increased to 400 x 10 step by step-6(v/v), increase by 100X 10/day during the cultivation-6(v/v), after 10 days of culture, repeated acclimation and culture were carried out 3 times to harvest SO-tolerance2The algal solution.
(5) And (3) obtaining pure algae colonies by adopting a plate streaking mode for the algae liquid obtained by domestication in the step (4), wherein the culture step is the same as the step (1), and after the culture is finished, selecting larger algae colonies for shake flask culture to obtain a target algae strain named HY-D3.
Example 2 identification of algal strains
Extracting DNA of obtained HY-D3 algal cells by CTAB method, cloning 18S rDNA gene, and sequencing 3 positive clones by Shanghai Biochemical company. The sequencing analysis result of the 18S rDNA gene is shown in a sequence table. The 18S rDNA sequence is logged into a Genbank database for Blast comparison, and the result is displayed and compared withScenedesmus acutusHas the greatest similarity, the BLASTn value is 2614, the Max index value is 99 percent, and HY-D3 can be determined as scenedesmus (Scenedesmus obliquus) (AScenedesmus acutus)。
Example 3 application of Scenedesmus HY-D3
Inoculating HY-D3 algae solution in logarithmic growth phase into BG11 culture medium (formula of BG11 shown in tables 1 and 2), culturing in photobioreactor, and inoculating OD of the culture solution690Is 0.2. Introducing CO from the bottom of the reactor2Flue gas with a content of 30v%, wherein SO2The content is 400 multiplied by 10-6(v/v). In the culture process, the illumination intensity is 5000Lux, the culture temperature is 28 ℃, the pH value is controlled between 7 and 9, the illumination period is 24 hours, the light-dark time ratio is 14:10, and the culture is in a stable period for 7 days. After the culture is finished, centrifuging and collecting algae liquid, carrying out vacuum freeze drying at the temperature of-60 ℃ to constant weight, measuring the dry weight of algae powder, and calculating the biomass yield; and adopting n-hexane: the total lipid content was determined by ethyl acetate method. Through detection, the biomass yield of the HY-D3 algal strain is 8.1237g/L, and the total lipid content of the cells accounts for 41.56% of the dry weight of the cells.
TABLE 1 BG11 culture Medium
Table 2 composition of a5+ Co solution in table 1
Example 4 comparison of growth effects of HY-D3 and HY-3
Inoculating HY-D3 and HY-3 algae solution in logarithmic growth phase into BG11 culture mediumCulturing in a photobioreactor, adjusting the density to OD after inoculation690Is 0.2. According to the test requirements, the CO with different contents is prepared2And SO2Mixed gas is introduced from the bottom of the reactor. In the culture process, the illumination intensity is 5000Lux, the culture temperature is 28 ℃, the pH value is controlled between 7 and 9, the illumination period is 24 hours, the light-dark time ratio is 14:10, the culture time is 10 days, the algae cells are collected after the culture is finished, the dry weight of the cells is measured, and the results are shown in Table 3. As can be seen from the results, the domesticated and screened HY-D3 was CO-resistant as compared with the original algal strain HY-D32And SO2Has better tolerance, good biomass stability and SO resistance2Also has higher removal rate.
TABLE 3 different CO2And SO2Comparison of Effect of contents
Examples 5 HY-D3 and HY-3 Low temperature resistance
Inoculating HY-D3 and HY-3 algae solution in logarithmic growth phase into BG11 culture medium, culturing in photobioreactor, and culturing to OD690Is 0.2. Introducing CO from the bottom of the reactor2Flue gas with a content of 10v%, wherein SO2Content of 200X 10-6(v/v). In the culture process, the illumination intensity is 8000Lux, the pH value is controlled to be 7-8, the illumination period is 24h, the light-dark time ratio is 14:10, and the culture time is 7 days. After the completion of the culture, algal cells were collected and the dry weight of the cells was measured, and the results are shown in Table 4.
TABLE 4 comparison of HY-D3 and HY-3 culture results
As can be seen from Table 4, HY-D3 screened by the present invention has better resistance to low temperature than the original algal strain HY-3.
Sequence listing
<110> China petrochemical Co., Ltd
Dalian petrochemical research institute of China petrochemical company Limited
<120> Scenedesmus rich in oil and culture application thereof
<130> New patent application
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1418
<212>DNA
<213>Scenedesmus acutus
<400>1
gtagtcatat gcttgtctca aagattaagc catgcatgtc taagtataaa ctgcttatac 60
tgtgaaactg cgaatggctc attaaatcag ttatagttta tttggtggtaccttactact 120
cggataaccg tagtaattct agagctaata cgtgcgtaaa tcccgacttc tggaagggac 180
gtatatatta gataaaaggc cgaccgagct ttgctcgacc cgcggtgaat catgatatct 240
tcacgaagcg catggccttg tgccggcgct gttccattca aatttctgcc ctatcaactt 300
tcgatggtag gatagaggcc taccatggtg gtaacgggtg acggaggatt agggttcgat 360
tccggagagg gagcctgaga aacggctacc acatccaagg aaggcagcag gcgcgcaaat 420
tacccaatcc tgatacgggg aggtagtgac aataaataac aataccgggc attttatgtc 480
tggtaattgg aatgagtaca atctaaatcc cttaacgagg atccattgga gggcaagtct 540
ggtgccagca gccgcggtaa ttccagctcc aatagcgtat atttaagttg ttgcagttaa 600
aaagctcata gttggatttc gggtgggttc tagcggtccg cctatggtga gtactgctat 660
ggccttcctt tctgtcgggg acgggcttct gggcttcact gtccgggact cggagtcgac 720
gtggttactt tgagtaaatt agagtgttca aagcaggctt acgccagaat actttagcat 780
ggaataacac gataggactc tggcctatct tgttggtctg taggaccgga gtaatgatta 840
agagggacag tcgggggcat tcgtatttca ttgtcagagg tgaaattctt ggatttatga 900
aagacgaact actgcgaaag catttgccaa ggatgttttc attaatcaag aacgaaagtt 960
gggggctcga agacgattag ataccgtcgt agtctcaacc ataaacgatg ccgactaggg 1020
attggcgaat gtttttttaa tgacttcgcc agcaccttat gagaaatcaa agtttttggg 1080
ttccgggggg agtatggtcg caaggctgaa acttaaagga attgacggaa gggcaccacc 1140
aggcgtggag cctgcggctt aatttgactc aacacgggaa aacttaccag gtccagacat 1200
agtgaggatt gacagattga gagctctttc ttgattctat gggtggtggt gcatggccgt 1260
tcttagttgg tgggttgcct tgtcaggttg attccggtaa cgaacgagac ctcagcctgc 1320
taaatagtct cagttgcttt ttgcagctgg ctgacttctt agagggacta ttggcgttta 1380
gtcaatggaa gtatgaggca ataacaggtc tgtgatgc 1418