CN111088272A - Double-promoter expression vector and construction method thereof - Google Patents
Double-promoter expression vector and construction method thereof Download PDFInfo
- Publication number
- CN111088272A CN111088272A CN202010005223.2A CN202010005223A CN111088272A CN 111088272 A CN111088272 A CN 111088272A CN 202010005223 A CN202010005223 A CN 202010005223A CN 111088272 A CN111088272 A CN 111088272A
- Authority
- CN
- China
- Prior art keywords
- sequence
- promoter
- vector
- expression vector
- binding site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The application belongs to the technical field of genetic engineering, and particularly relates to a dual-promoter expression vector capable of expressing target genes in prokaryotic and mammalian cells respectively and a construction method thereof. The vector takes a eukaryotic expression vector as a starting vector, and meanwhile, a genome comprises a prokaryotic promoter T7 sequence, a ribosome binding site and a T7 termination sequence. The double-promoter expression vector constructed by the application can simultaneously express the same target gene in prokaryotic and eukaryotic cells, can overcome the complex steps that the prior same target protein needs 2 sets of expression systems in mammals and prokaryotic cells, and also lays a certain technical foundation for the expression of related target genes in different expression systems.
Description
Technical Field
The application belongs to the technical field of genetic engineering, and particularly relates to a dual-promoter expression vector capable of expressing target genes in prokaryotic and mammalian cells respectively at the same time and a construction method and a patent application thereof.
Background
In the conventional application of the genetic engineering technology, the function of a target gene can be deeply analyzed and researched by recombining an artificially obtained exogenous target gene with a vector in vitro, then introducing the recombinant vector into a receptor cell and enabling the target gene to be normally replicated, transcribed and translated in the receptor cell. Based on this principle, genetic engineering techniques have been widely used in the field of medicine, such as recombinant protein drug production, gene therapy, and the like.
In the prior art, when recombinant protein drugs are produced by using genetic engineering, protein expression systems can be divided into two categories according to the genome difference of receptor cells: eukaryotic expression systems and prokaryotic expression systems, wherein eukaryotic expression systems such as mammalian cells, insect cells, yeast cells, and the like; prokaryotic expression systems such as E.coli and the like. Wherein, the mammalian and Escherichia coli expression systems are the most common and the most main expression systems in the preparation of the existing recombinant protein medicaments. Statistics show that more than 80% of the currently approved recombinant protein drugs are produced in these two expression systems.
In the prior art, mammalian cells used for the expression of recombinant proteins mainly comprise: chinese Hamster Ovary (CHO) cells, mouse myeloma cells Sp2/0 and NS0, Human Embryonic Kidney (HEK) cells 293, hamster kidney (BHK) -21, and the like. And the Escherichia coli in the prokaryotic expression system has the advantages of higher expression quantity, rapid propagation on a culture medium, low cost and the like compared with CHO cells due to clear genetic background, so that the protein expression system constructed by the Escherichia coli is the most common prokaryotic expression system.
Because the existing prokaryotic and eukaryotic expression systems have different elements required for efficient replication, selection, transcription and translation of target genes when expressing proteins, different recombinant expression vectors are usually selected or designed for expressing the same protein in the two systems. The process is complicated and costly due to the complicated operation steps.
Disclosure of Invention
The application aims to provide a double-promoter expression vector simultaneously containing a eukaryotic promoter CMV and a prokaryotic promoter T7, so that the same target gene can be expressed in eukaryotic cells or prokaryotic cells, and a certain technical basis is laid for related gene research or target protein preparation.
The technical solution adopted in the present application is detailed as follows.
A double-promoter expression vector comprises a prokaryotic promoter T7 sequence, a ribosome binding site RBS and a T7 termination sequence in a genome; during specific construction, eukaryotic expression vectors such as pIRES-neo, pIRES-neo2, pIRES-neo3, pEGFP-C1, pcDNA1.1, pCHO1.0 and the like are used as starting vectors and are constructed by utilizing a gene engineering technology;
in the constructed double-promoter expression vector, a T7 promoter sequence is positioned at the downstream of a promoter (eukaryotic promoters such as SV40, CMV, EF1 α and CAG) of the eukaryotic expression vector, a ribosome binding site is positioned at the downstream of a T7 promoter sequence, and a T7 termination sequence is positioned at the downstream of a eukaryotic expression vector screening marker (such as Neomycin Phosphotransferase (NPT) resistance gene) of an initial vector;
when in specific construction, the vector is obtained by recombining a promoter T7 sequence, a Ribosome Binding Site (RBS) and a T7 termination sequence or a connecting sequence of a promoter T7 sequence and a Ribosome Binding Site (RBS) and a T7 termination sequence into a eukaryotic expression vector;
the promoter T7 has the sequence: TAATACGACTCACTATA the flow of the air in the air conditioner,
the RBS sequences are: GAAGGA;
the connection sequence of the promoter T7 sequence and a Ribosome Binding Site (RBS) is as follows:TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC；
the T7 termination sequence is (48 bp):
CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG。
taking pIRES-neo as a starting vector and EGFP gene or ASFVp54 gene as an example of a target gene, the construction method of the double-promoter expression vector comprises the following steps:
(1) designing primers aiming at target genes and carrying out PCR amplification
For EGFP gene, taking the EGFP gene sequence in pEGFP-C1 plasmid as an example of target gene, primers P1 and P2 can be designed during PCR amplification as follows:
P1：5′-CCGGAATTCATGGTGAGCAAGGGCGAGGAG-3′，
P2：5′-CTAGGATCCCTTGTACAGCTCGTCCATGCCGA-3′；
for the ASFVp54 gene, the sequence (576 bp) of the ASFVp54 gene is:
ATGGATTCTGAATTTTTTCAACCGGTTTATCCGCGGCATTATGGTGAGTGTTTGTCACCAGTCTCTACACCAAGCTTCTTCTCCACACATATGTATACTATTCTCATTGCTATCGTGGTCTTAGTCATTATTATCATCGTTCTAATTTATCTATTTTCTTCAAGAAAGAAAAAAGCTGCTGCCGCTATTGAAGAGGAAGATATACAGTTTATAAATCCTTATCAAGATCAGCAGTGGGTAGAGGTCACTCCACAACCAGGTACCTCTAAACCGGCTGGAGTGACTACAGCAAGTGTAGGCAAGCCAGTCACGGGCAGGCCGGCAACAAACAGACCAGTTACGGACAGGCTAGTCATGGTAACTGGCGGGCCAGCGGCCGCAAGTGCGGCCGCAAGTGCGGCTGCGAATGCGGCCACGAATACAGCTGCGAGTGCAGCCGCGAGTGCTCCTGCTCATCCGGCTGAGCCTTATACGACAGTCACTACTCAGAACACTGCTTCCCAAACAATGTCGGCTATTGAAAATCTACGGCAAAGAAGCACCTATACGCATAAAGACCT AGAAAACTCCTTGTAA
(2) construction of recombinant eukaryotic expression plasmid containing target gene
Digesting the starting plasmid pIRES-neo (for example, carrying out double digestion by using EcoRI and BamHI), and recovering linearized plasmid DNA (namely linearized pIRES-neo plasmid);
connecting the target gene sequence in the step (1) with linearized plasmid DNA by using T4 DNase, and transforming and screening to obtain a recombinant plasmid containing a target gene after recombination;
(3) preparation of promoter T7 sequence, Ribosome Binding Site (RBS) and T7 termination sequence
Artificially synthesizing or respectively obtaining a promoter T7 sequence, a Ribosome Binding Site (RBS) and a T7 termination sequence, or a connection sequence of a promoter T7 sequence and the Ribosome Binding Site (RBS) and a T7 termination sequence by adopting other biological techniques for later use;
the connection sequence of the promoter T7 sequence and the RBS is as follows:
TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC；
(among the sequences, sequences 1 to 17 bit, i.e., "TAATACGACTCACTATA", are T7 promoter, and sequences 74 to 80 bit, i.e., "GAAGGA" part is RBS sequence)
The T7 termination sequence is (48 bp):
CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG；
(4) connecting, transforming and screening to obtain double expression vector
Recombining the promoter T7 sequence, Ribosome Binding Site (RBS) and T7 termination sequence in the step (3) into the recombinant plasmid containing the target gene in the step (II), screening and verifying to ensure that the recombination construction is correct, namely the double-promoter expression plasmid capable of expressing the target gene in a prokaryotic or eukaryotic mammalian expression system.
When cells are transfected with the dual promoter expression plasmid: when eukaryotic mammalian cells are transfected, for example, specifically: CHO, HEK293, BHK, SP2/O, NS0 and other cell lines; for example, Escherichia coli BL21 cell line is specifically used for the transformation of prokaryotic cells.
The double-promoter expression vector constructed by the application, wherein the T7 promoter for prokaryotic expression is derived from T7 bacteriophage, is a strong promoter commonly used in an escherichia coli expression system, can specifically react with T7 RNA polymerase, and has very active transcription after being recognized. Based on this, the inventor fuses the expression vector with a eukaryotic expression promoter, thereby constructing and obtaining a double-promoter expression vector which can simultaneously express the same target gene in prokaryotic and eukaryotic cells, thereby overcoming the complex steps that the prior conventional same target protein needs 2 sets of expression systems in mammals and prokaryotic cells, and simultaneously laying a certain technical foundation for the expression of other target genes in different expression systems.
Drawings
FIG. 1 is a schematic diagram of the structure of a PIRES-neo vector;
FIG. 2 is a schematic diagram of the structure of pIRES-EGFP vector;
FIG. 3 is a schematic diagram of the structure of pIRES-CMV/T7-EGFP vector;
FIG. 4 shows the fluorescence of EGFP expressed in CHO cells (left panel) and prokaryotic E.coli BL21 (right panel);
FIG. 5 shows flow cytometry detection of EGFP expression levels in CHO cells;
FIG. 6 shows the expression level of EGFP in E.coli BL21 cells detected by Western blot;
FIG. 7 shows the results of Westernblot detection of the expression of the target protein p54 in CHO cells (left panel) and prokaryotic E.coli BL21 (right panel).
Detailed Description
The present application is further illustrated by the following examples. Before describing the specific embodiments, a brief description will be given of some experimental background cases in the following embodiments.
Biological material:
pIRES-neo vector, pEGFP-C1 plasmid, purchased from Clontech, USA;
the related primer sequence, gene sequence synthesis and sequencing are all provided by general biological gene (Anhui) Inc.;
experimental reagent:
seamless cloning kit, product of Novoprotein technologies ltd.
Example 1
In this example, the EGFP gene is taken as the target gene, and pIRES-neo is taken as the starting vector, and the construction process of the dual expression vector pIRES-CMV/T7-EGFP is described as follows.
Firstly, aiming at a target gene EGFP, designing a primer and carrying out PCR amplification
The EGFP (enhanced green fluorescent protein) gene (GenBank: U55763.1, 613-1329 th base) sequence in the pEGFP-C1 plasmid is taken as a target gene, and primers P1 and P2 are designed as follows:
p1: 5'-CCGGAATTCATGGTGAGCAAGGGCGAGGAG-3', (5 ' GAATTC partial sequence is introduced Eco RI enzyme cutting site)
P2: 5'-CTAGGATCCCTTGTACAGCTCGTCCATGCCGA-3', respectively; (5' -end GGATCC partial sequence is introduced BamHI enzyme cutting site)
PCR amplification is carried out by taking pEGFP-C1 plasmid as a template (the size of an amplification product is 717 bp), and after electrophoretic detection, the EGFP sequence is obtained by recovering the PCR amplification product.
During PCR amplification, a 25. mu.L amplification system was designed as follows:
10×PCR buffer ，2.5μL；
primers P1, P2, 1.0. mu.L (10. mu. mol/L) each;
dNTP，2.0μL（25μmol/L）；
pEGFP-C1 plasmid template, 1.0. mu.L (100 ng/. mu.L);
taq enzyme, 0.5. mu.L (5U/. mu.L);
ddH2O，17μL；
the PCR amplification procedure was: 95 deg.C for 3 min; 94 deg.C, 40s, 58 deg.C, 30s, 72 deg.C, 40s, 4 cycles per annealing temperature, finally 55 deg.C, 30 cycles, 72 deg.C, 3 min.
(II) constructing recombinant eukaryotic expression plasmid containing EGFP
And (2) carrying out double enzyme digestion on the PCR amplification product (namely the target gene EGFP sequence obtained by amplification) and the starting plasmid pIRES-neo in the step (1) by utilizing EcoRI and BamHI enzymes respectively, carrying out electrophoretic detection, and recovering the EGFP sequence subjected to enzyme digestion and linearized plasmid DNA (namely the linearized pIRES-neo plasmid).
In the enzyme digestion process, a 20-mu-L enzyme digestion system is designed as follows:
10×M buffer ，2μL；
EcoRI, BamHI enzymes, 0.5. mu.L each (10U/. mu.L);
PCR amplification products (i.e., EGFP sequences) or linearized plasmid DNA, 1.18. mu.L (0.85. mu.g/. mu.L for PCR amplification products) or 1.23. mu.L (0.81. mu.g/. mu.L for linearized plasmid DNA);
adding double distilled water to 20 mu L;
after mixing well, the mixture was digested at 37 ℃ (6 h for PCR amplification product; 3h for linearized plasmid DNA).
The recovered EGFP sequence and linearized plasmid DNA were ligated using T4 dnase.
For ligation, a 20 μ L ligation system was designed as follows:
2×Quick Ligation Buffer，10μL；
pIRES-neo linear plasmid DNA, 200 ng;
87.2ng of EGFP sequence fragment after enzyme digestion;
t4 ligase, 1. mu.L (350U/. mu.L);
adding double distilled water to 20 mu L;
ligation was carried out overnight at 16 ℃.
The ligation product was added to a competent bacterial suspension of e.coli JM109 for transformation. After completion of transformation, 100. mu.L of the transformant was inoculated on an LB solid plate containing ampicillin, and cultured overnight at 37 ℃ for selection. And finally, after carrying out subculture by picking positive single colony shake bacteria, extracting bacterial plasmids for enzyme digestion verification and sequencing verification, and naming the correctly constructed recombinant plasmid as pIRES-EGFP (FIG. 1 is a structural schematic diagram of a pIRES-neo vector, FIG. 2 is a structural schematic diagram of the pIRES-EGFP vector, and it can be seen that a CMV promoter is arranged in the pIRES-neo vector, and a downstream multiple cloning site of the CMV promoter is inserted into an EGFP sequence in the recombinant vector).
(III) preparation of promoter T7 sequence, Ribosome Binding Site (RBS) and T7 terminator sequence
Artificially synthesizing a connecting sequence of a promoter T7 sequence and a Ribosome Binding Site (RBS) and a T7 termination sequence for later use;
the connection sequence of the promoter T7 sequence and the RBS is (87 bp):
TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC；
the T7 termination sequence is (48 bp):
CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG。
(IV) constructing to obtain a double expression vector
Recombining the T7+ RBS sequence and the T7 terminator sequence in the step (three) into the pIRES-EGFP in the step (two) by using a seamless cloning kit; and transforming the constructed recombinant vector into E.coli JM109 competent bacteria, screening, extracting plasmids, performing double enzyme digestion (SmaI/PacI) verification and sequencing verification, and renaming the correctly constructed plasmid to be pIRES-CMV/T7-EGFP, namely the recombinant plasmid containing the double promoters (the structural schematic diagram of the recombinant plasmid is shown in figure 3, and can be seen that a T7 promoter and a ribosome binding site are inserted at the downstream of the CMV promoter, and a T7 termination sequence is inserted at the downstream of neo).
Example 2
In order to determine the expression condition of the EGFP gene of interest in eukaryotic cells or prokaryotic cells, the recombinant plasmid pIRES-CMV/T7-EGFP expression vector pIRES-CMV/T7-EGFP constructed in example 1 is further transfected into CHO-S cells and transformed into Escherichia coli BL21 respectively, and the specific experimental process is briefly described as follows.
Expression vector transfection CHO cell expression system
CHO-S cells were cultured in DMEM-F12 medium containing 10% fetal bovine serum and 1% cyan/streptomycin by volume under the following conditions: 37 ℃ and 5% CO2Culturing in incubator, digesting with 0.25% pancreatin when cell adherent growth density reaches 90%, collecting cells at 2 × 105The cells are inoculated in a 24-well plate, and when the cell density reaches (about 24 h) 60% -70%, Lipo2000 (Lipofectamine 2000) is used as a transfection reagent for transfection.
During transfection, pIRES-EGFP vector (constructed in step (II) of example 1) was used as a control group.
The specific transfection procedure was:
standing 2 μ L lipofectamine 2000+50 μ L serum-free DMEM-F12 medium in incubator at 37 deg.C for 5 min; simultaneously, mixing 50 mu L of serum-free DMEM-F12 culture medium and 1 mu g of expression vector pIRES-CMV/T7-EGFP uniformly, and standing for 20min at room temperature;
simultaneously, after washing the 24-well culture plate with PBS for three times, 500. mu.L of serum-free DMEM-F12 cell culture medium was added to the cells;
then, the mixed solution of the liposome after standing and pIRES-CMV/T7-EGFP plasmid DNA is dripped into the hole drop by drop, and the culture plate is shaken gently as soon as possible to mix the mixture evenly;
then, the mixture is placed in 5% CO2The cells are cultured in the cell culture box at 37 ℃ for 6h, then serum-free DMEM-F12 culture medium is replaced by DMEM-F12 complete culture medium, and the cells are cultured in the cell culture box continuously.
After the cells are transfected for 48 hours, the transfection efficiency and the EGFP expression condition are observed under a fluorescence microscope, and the result shows that the double-promoter vector is expressed in a large amount in CHO cells (the left picture in FIG. 4), and the transfection efficiency is not obviously different from that of the pIRES-EGFP vector, and the result shows that the transfection efficiency and the transient expression of the target protein in a eukaryotic expression system are not influenced by a prokaryotic promoter.
And then trypsinizing and collecting cells, transferring the cells into a cell culture bottle for continuous culture, after the cells grow into the bottle, trypsinizing and collecting the cells, and analyzing the EGFP expression quantity by a flow cytometer. The Mean Fluorescence Intensity (MFI) was obtained from the fluorescence intensity of each cell captured by it, and the results of the detection are shown in FIG. 5. Analysis can see that: the average fluorescence intensity of the expression of the double-promoter vector in CHO cells is 1.33 multiplied by 104And pIRES-EGFP vector is 1.48X 104And the expression quantity of the two genes has no obvious difference, which indicates that the expression of the target protein in a eukaryotic expression system is not influenced by a prokaryotic promoter.
(II) expression vector transformation Escherichia coli expression system
Mu.g of pIRES-CMV/T7-EGFP recombinant plasmid constructed in example 1 was transformed into 50. mu.L of E.coli BL21 competent bacteria, followed by addition of 500. mu.L of LB medium, shake-cultivation at 37 ℃ for 1 hour, followed by plating on LB solid medium containing ampicillin, and overnight cultivation in an incubator at 37 ℃.
And (3) selecting positive monoclonal, adding the positive monoclonal into an LB culture medium, activating the positive monoclonal overnight by a shaking table at 37 ℃, adding 60 mu L of bacterial liquid into 6mL of LB liquid culture medium, continuously culturing by the shaking table at 37 ℃, continuously detecting OD value during the culture, adding IPTG (final concentration of 1 mmol/L) when OD is 0.6-0.8, continuously culturing for 6h, and collecting the bacterial liquid. In the transformation process, pIRES-EGFP expression vectors are synchronously arranged as a reference.
Measuring the OD value of the collected 1mL of bacterial liquid by using an ultraviolet spectrophotometer, centrifuging at 12000rpm for 5min, discarding the supernatant, and adding PBS (phosphate buffer solution) to resuspend the bacterial liquid according to the OD value. Finally, the EGFP expression was observed in a six-well plate under an inverted fluorescence microscope. As shown in FIG. 4 (right panel), it can be seen that the dual promoter vector has a large amount of expression of the target protein in the prokaryotic expression system. This result indicates that the recombinant plasmid can normally promote the expression of the target gene in a prokaryotic system.
Referring to the previous operation or the prior art, after 1mL of the bacterial solution is centrifuged and resuspended in PBS, the bacteria are ultrasonically disrupted, centrifuged again at 12000rpm for 5min, the supernatant is collected, and the precipitate is resuspended in an equal amount of PBS. Protein loading buffer was added to each sample and the samples were boiled at 100 ℃ for 10min for Western blot analysis, and the results are shown in FIG. 6. It can be seen that the double-promoter vector can express a large amount of target proteins in a prokaryotic expression system, while the control vector (i.e., the vector without the T7 promoter) cannot detect the expression of the target proteins, i.e., the single eukaryotic promoter cannot promote the expression of the target proteins in the prokaryotic expression system.
Example 3
On the basis of example 2, to further examine whether the dual-promoter vector constructed in the present application is suitable for expression of other target proteins, the inventors further constructed a recombinant dual-promoter vector pIRES-CMV/T7-p54 with ASFVp54 as a target protein, and performed translational expression by using a eukaryotic expression system and a prokaryotic expression system, respectively, which is briefly described below.
The gene sequence (576 bp) corresponding to the target protein ASFVp54 is as follows:
ATGGATTCTGAATTTTTTCAACCGGTTTATCCGCGGCATTATGGTGAGTGTTTGTCACCAGTCTCTACACCAAGCTTCTTCTCCACACATATGTATACTATTCTCATTGCTATCGTGGTCTTAGTCATTATTATCATCGTTCTAATTTATCTATTTTCTTCAAGAAAGAAAAAAGCTGCTGCCGCTATTGAAGAGGAAGATATACAGTTTATAAATCCTTATCAAGATCAGCAGTGGGTAGAGGTCACTCCACAACCAGGTACCTCTAAACCGGCTGGAGTGACTACAGCAAGTGTAGGCAAGCCAGTCACGGGCAGGCCGGCAACAAACAGACCAGTTACGGACAGGCTAGTCATGGTAACTGGCGGGCCAGCGGCCGCAAGTGCGGCCGCAAGTGCGGCTGCGAATGCGGCCACGAATACAGCTGCGAGTGCAGCCGCGAGTGCTCCTGCTCATCCGGCTGAGCCTTATACGACAGTCACTACTCAGAACACTGCTTCCCAAACAATGTCGGCTATTGAAAATCTACGGCAAAGAAGCACCTATACGCATAAAGACCT AGAAAACTCCTTGTAA
by referring to the operation and the prior art, an artificially synthesized ASFV p54 gene sequence is substituted for an EGFP sequence in a pIRES-CMV/T7-EGFP vector by using a seamless cloning kit to construct a recombinant vector, E.coli JM109 competent bacteria are further transformed, and after screening, extracting a plasmid and carrying out sequencing verification, the correctly constructed plasmid is renamed to pIRES-CMV/T7-p 54.
Further, the pIRES-CMV/T7-p54 plasmid is expressed and verified in a prokaryotic expression system and a eukaryotic expression system respectively, and the specific process is briefly described as follows.
(1) Expression in CHO cells
CHO-S cells were cultured in DMEM-F12 medium containing 10% fetal bovine serum and 1% cyan/streptomycin by volume under the following conditions: 37 ℃ and 5% CO2Culturing in an incubator. 3 x 10 in 6-hole plate6Cells were seeded at a cell count per well and transfected with Lipo2000 as transfection reagent 24 hours later when the cells reached approximately 70-80% confluence.
After cell transfection for 48 hours, washing with PBS, digesting with pancreatin, collecting cells, adding 2-3 ml of serum-free culture medium, and performing suspension culture at 120 rpm; transferring the cells into a 125mL suspension culture flask after culturing for 3 days, wherein the initial cell amount is 5-6 multiplied by 106Adding 30ml of serum-free medium into the culture medium per ml, and performing suspension culture at 120rpm for 5 days;
after the culture is finished, collecting cells, and adding a cell lysate to lyse the cells;
after mixing 80. mu.L of lysate with 20. mu.L of protein loading buffer, the mixture was boiled at 100 ℃ for 10min, and expression of ASFV p54 was detected by Western Blot, the experimental results are shown in FIG. 7 (right panel). As can be seen, the target protein ASFV p54 is successfully expressed in the CHO expression system by the double-promoter vector pIRES-CMV/T7-p 54.
(2) Expression in E.coli
Transforming pIRES-CMV/T7-p54 recombinant plasmid 1 mu g into 50 mu L escherichia coli BL21 competent bacteria, after transformation, selecting positive monoclonal and adding the positive monoclonal into an LB culture medium, after overnight activation by shaking at 37 ℃, taking 50 mu L of bacterial liquid to perform amplification culture in 5mL of LB liquid culture medium, performing shaking culture at 200rpm/min and 37 ℃, after 4h of culture, adding IPTG when OD is measured to be 0.6-0.8, leading the final concentration of the IPTG to be 1mmol/L, and continuing to culture for 6h to induce protein expression.
After the culture is finished, collecting bacterial liquid and carrying out Western Blot detection. The results of the experiment are shown in FIG. 7. It can be seen that the target protein is successfully expressed in the Escherichia coli expression system by the double-promoter vector pIRES-CMV/T7-p 54.
The results show that the double-promoter vector constructed by the application can effectively express target protein in a eukaryotic expression system and can also effectively express target protein in a prokaryotic system, and based on the expression, a good technical basis can be laid for the preparation of related proteins.
Sequence listing
<110> New countryside medical college
<120> double-promoter expression vector and construction method thereof
<130>none
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>87
<212>DNA
<213>bacteriophage
<400>1
taatacgact cactataggg gaattgtgag cggataacaa ttcccctcta gaaataattt 60
tgtttaactt taagaaggag atatacc 87
<210>2
<211>48
<212>DNA
<213>bacteriophage
<400>2
ctagcataac cccttggggc ctctaaacgg gtcttgaggg gttttttg 48
<210>3
<211>576
<212>DNA
<213>African Swine fever virus
<400>3
atggattctg aattttttca accggtttat ccgcggcatt atggtgagtg tttgtcacca 60
gtctctacac caagcttctt ctccacacat atgtatacta ttctcattgc tatcgtggtc 120
ttagtcatta ttatcatcgt tctaatttat ctattttctt caagaaagaa aaaagctgct 180
gccgctattg aagaggaaga tatacagttt ataaatcctt atcaagatca gcagtgggta 240
gaggtcactc cacaaccagg tacctctaaa ccggctggag tgactacagc aagtgtaggc 300
aagccagtca cgggcaggcc ggcaacaaac agaccagtta cggacaggct agtcatggta 360
actggcgggc cagcggccgc aagtgcggcc gcaagtgcgg ctgcgaatgc ggccacgaat 420
acagctgcga gtgcagccgc gagtgctcct gctcatccgg ctgagcctta tacgacagtc 480
actactcaga acactgcttc ccaaacaatg tcggctattg aaaatctacg gcaaagaagc 540
acctatacgc ataaagacct agaaaactcc ttgtaa 576
Claims (7)
1. A double-promoter expression vector is characterized in that the genome of the vector contains a prokaryotic promoter T7 sequence, a ribosome binding site and a T7 termination sequence;
the eukaryotic expression vector is used as a starting vector and is constructed by utilizing a genetic engineering technology;
in the constructed double-promoter expression vector, a T7 promoter sequence is positioned at the downstream of a promoter of a eukaryotic expression vector of a starting vector, a ribosome binding site is positioned at the downstream of a T7 promoter sequence, and a T7 termination sequence is positioned at the downstream of a eukaryotic expression vector screening marker of the starting vector;
specifically, the vector is constructed by recombining a prokaryotic promoter T7 sequence, a ribosome binding site RBS and a T7 termination sequence or recombining a promoter T7 sequence, a connecting sequence of the ribosome binding site RBS and a T7 termination sequence into a eukaryotic expression vector;
the promoter T7 has the sequence: TAATACGACTCACTATA the flow of the air in the air conditioner,
the RBS sequences are: GAAGGA;
the connecting sequence of the promoter T7 sequence and the ribosome binding site RBS is shown as SEQ ID NO.1, and specifically comprises the following steps:TA ATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGG AGATATACC；
the T7 termination sequence is shown as SEQ ID NO.2, and specifically comprises:
CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG。
2. the method for constructing the dual promoter expression vector of claim 1, comprising the steps of:
(1) obtaining a promoter T7 sequence, a ribosome binding site RBS and a T7 termination sequence, or a connecting sequence of a promoter T7 sequence and the ribosome binding site RBS and a T7 termination sequence for later use;
(2) the eukaryotic expression vector is used as a starting vector, and a promoter T7 sequence, a ribosome binding site RBS and a T7 termination sequence or a connecting sequence of a promoter T7 sequence and the ribosome binding site RBS and a T7 termination sequence are recombined to the eukaryotic expression vector by utilizing a genetic engineering technology to construct the eukaryotic expression vector.
3. The dual-promoter expression vector of claim 1, wherein the eukaryotic expression vector is specifically constructed by using pIRES-neo, pIRES-neo2, pIRES-neo3, pEGFP-C1, pcDNA1.1 or pCHO1.0 as starting vectors.
4. The recombinant vector constructed by the dual-promoter expression vector of claim 3, wherein the recombinant vector is constructed by taking pIRES-neo as a starting vector and an EGFP gene or ASFVp54 gene as a target gene through the following steps:
(1) designing primers aiming at target genes and carrying out PCR amplification
Aiming at the EGFP gene, the EGFP gene sequence in the pEGFP-C1 plasmid is taken as a target gene, and primers P1 and P2 are designed during PCR amplification as follows:
P1：5′-CCGGAATTCATGGTGAGCAAGGGCGAGGAG-3′，
P2：5′-CTAGGATCCCTTGTACAGCTCGTCCATGCCGA-3′；
aiming at the ASFVp54 gene, the sequence of the ASFVp54 gene is shown in SEQ ID NO.3, and specifically comprises the following steps:
ATGGATTCTGAATTTTTTCAACCGGTTTATCCGCGGCATTATGGTGAGTGTTTGTCACCAGTCTCTACACCAAGCTTCTTCTCCACACATATGTATACTATTCTCATTGCTATCGTGGTCTTAGTCATTATTATCATCGTTCTAATTTATCTATTTTCTTCAAGAAAGAAAAAAGCTGCTGCCGCTATTGAAGAGGAAGATATACAGTTTATAAATCCTTATCAAGATCAGCAGTGGGTAGAGGTCACTCCACAACCAGGTACCTCTAAACCGGCTGGAGTGACTACAGCAAGTGTAGGCAAGCCAGTCACGGGCAGGCCGGCAACAAACAGACCAGTTACGGACAGGCTAGTCATGGTAACTGGCGGGCCAGCGGCCGCAAGTGCGGCCGCAAGTGCGGCTGCGAATGCGGCCACGAATACAGCTGCGAGTGCAGCCGCGAGTGCTCCTGCTCATCCGGCTGAGCCTTATACGACAGTCACTACTCAGAACACTGCTTCCCAAACAATGTCGGCTATTGAAAATCTACGGCAAAGAAGCACCTATACGCATAAAGACCT AGAAAACTCCTTGTAA
(2) construction of recombinant eukaryotic expression plasmid containing target gene
Carrying out enzyme digestion on the starting plasmid pIRES-neo, and recovering the linear plasmid DNA;
connecting the target gene sequence in the step (1) with linearized plasmid DNA by using T4 DNase, and transforming and screening to obtain a recombinant plasmid containing a target gene after recombination;
(3) preparation of promoter T7 sequence, ribosome binding site RBS and T7 termination sequence
Obtaining a promoter T7 sequence, a ribosome binding site RBS and a T7 termination sequence, or a connecting sequence of a promoter T7 sequence and the ribosome binding site RBS and a T7 termination sequence for later use;
(4) connecting, transforming and screening to obtain double expression vector
Recombining the promoter T7 sequence, the ribosome binding site RBS and the T7 termination sequence in the step (3) into the recombinant plasmid containing the target gene in the step (2), screening and verifying to ensure that the recombination construction is correct, namely the dual-promoter expression plasmid capable of expressing the target gene in a prokaryotic or eukaryotic expression system.
5. The expression system constructed by using the dual promoter expression vector of claim 1, wherein when the dual promoter expression vector is used for transfecting cells, the following are specifically used for transfecting eukaryotic mammalian cells: CHO, HEK293, BHK, SP2/O, or NS0 cell lines; for the transformation of prokaryotic cells, E.coli BL21 cell line was used.
6. The method for preparing EGFP using the recombinant vector of claim 4, wherein the recombinant vector is transfected into CHO cells or transformed into E.coli BL21 cells.
7. The method for preparing ASFVp54 by using the recombinant vector as claimed in claim 4, characterized in that the recombinant vector is transfected into CHO cells or transformed into Escherichia coli BL21 cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010005223.2A CN111088272A (en) | 2020-01-03 | 2020-01-03 | Double-promoter expression vector and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010005223.2A CN111088272A (en) | 2020-01-03 | 2020-01-03 | Double-promoter expression vector and construction method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111088272A true CN111088272A (en) | 2020-05-01 |
Family
ID=70399531
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010005223.2A Pending CN111088272A (en) | 2020-01-03 | 2020-01-03 | Double-promoter expression vector and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111088272A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807145A (en) * | 2022-06-02 | 2022-07-29 | 新乡医学院 | Leader sequence for improving non-cap-dependent translation efficiency and application thereof |
| CN115141846A (en) * | 2022-06-02 | 2022-10-04 | 武汉滨会生物科技股份有限公司 | Double-promoter plasmid and construction method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1544624A (en) * | 2003-11-14 | 2004-11-10 | 山东大学 | Double promoter DNA vaccine expression vector pCMVnir and preparation method thereof |
| CN101397571A (en) * | 2008-11-03 | 2009-04-01 | 济南登益得科贸有限公司 | Preparation of double promoter DNA anti-caries vaccine pCN-SSIE |
| KR20090055869A (en) * | 2007-11-29 | 2009-06-03 | 고려대학교 산학협력단 | Development of dual promoter-driven reporter systems and their application in simultaneous tracing of mesenchymal stem cells differentiating into the cardiomyogenic or the endothelial cell lineage |
| CN108330140A (en) * | 2017-01-19 | 2018-07-27 | 西南大学 | A kind of sieving-free original/eukaryotic co-expression carrier and its structure and application |
-
2020
- 2020-01-03 CN CN202010005223.2A patent/CN111088272A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1544624A (en) * | 2003-11-14 | 2004-11-10 | 山东大学 | Double promoter DNA vaccine expression vector pCMVnir and preparation method thereof |
| KR20090055869A (en) * | 2007-11-29 | 2009-06-03 | 고려대학교 산학협력단 | Development of dual promoter-driven reporter systems and their application in simultaneous tracing of mesenchymal stem cells differentiating into the cardiomyogenic or the endothelial cell lineage |
| CN101397571A (en) * | 2008-11-03 | 2009-04-01 | 济南登益得科贸有限公司 | Preparation of double promoter DNA anti-caries vaccine pCN-SSIE |
| CN108330140A (en) * | 2017-01-19 | 2018-07-27 | 西南大学 | A kind of sieving-free original/eukaryotic co-expression carrier and its structure and application |
Non-Patent Citations (4)
| Title |
|---|
| DAN-DAN YI ET AL.: ""Construction of an expression vector mediated by the dual promoter for prokaryotic and mammalian cell expression system"", 《MOLECULAR BIOLOGY REPORTS》 * |
| MANABU MURAKAMI ET AL.: ""A simple and dual expre ssion plasmid system in prokaryotic (E. coli) and mammalian cells"", 《PLOS ONE》 * |
| 朱明慧: ""原核和真核双表达载体的构建及功能分析"", 《中国细胞生物学学报》 * |
| 郑海学等: ""T7RNA聚合酶表达系统的真核化及其偶联表达系统的建立"", 《生物工程学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807145A (en) * | 2022-06-02 | 2022-07-29 | 新乡医学院 | Leader sequence for improving non-cap-dependent translation efficiency and application thereof |
| CN115141846A (en) * | 2022-06-02 | 2022-10-04 | 武汉滨会生物科技股份有限公司 | Double-promoter plasmid and construction method and application thereof |
| CN115141846B (en) * | 2022-06-02 | 2023-03-10 | 武汉滨会生物科技股份有限公司 | Double-promoter plasmid and construction method and application thereof |
| CN114807145B (en) * | 2022-06-02 | 2024-02-20 | 新乡医学院 | Leader sequence for improving cap-independent translation efficiency and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107828738A (en) | A kind of dnmt rna deficiency Chinese hamster ovary celI system and preparation method and application | |
| CN107502608A (en) | Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes | |
| WO2019086007A1 (en) | Sgrna for targeting and guiding cas9 protein to efficiently cleave tcr and b2m gene loci | |
| CN111088272A (en) | Double-promoter expression vector and construction method thereof | |
| CN113278635B (en) | Sequence combination for promoting cyclic RNA (ribonucleic acid) to form ring and application thereof | |
| CN114164231B (en) | Method for gene editing of target site in cell | |
| CN105802997B (en) | Expression vector of human and mammal cell attachment, construction method and application | |
| CN105695494B (en) | Three-cistron expression vector, preparation method and application | |
| CN110964744A (en) | Human osteosarcoma U-2OS tool cell line capable of stably expressing Cas9 protein and preparation method and application thereof | |
| JP3844656B2 (en) | Methods for transformation of animal cells | |
| WO2019129175A1 (en) | Chimeric promoter with high transcriptional activity in t-cells | |
| CN112592388A (en) | 2A peptide, bicistronic mRNA expression vector, recombinant protein expression system and application | |
| CN112899238A (en) | Based on RNA-m6A modification level compound screening cell model and construction and application thereof | |
| JP4883532B2 (en) | Gene amplification method using recombinant enzyme | |
| JP6469371B2 (en) | A method for expressing a plurality of foreign genes in an embryoid body composed of induced pluripotent stem cells (iPS cells) | |
| CN115976107A (en) | Recombinant baculovirus vector and construction method and application thereof | |
| JP5246904B2 (en) | Vector for introducing foreign gene and method for producing vector into which foreign gene has been introduced | |
| CN109706122A (en) | It constructs FSCN1 gene and stablizes knockout cell system, method and plasmid or plasmid combinations and application | |
| JPWO2004070030A1 (en) | High expression vector for animal cells | |
| CN109402096B (en) | AID enzyme mutant and application thereof | |
| CN110484563B (en) | Mammal cell combined expression vector, expression system, preparation method and application | |
| CN113584085B (en) | Lentiviral vector for suspension cells and application thereof | |
| CN113637675B (en) | Production method, nucleotide sequence, expression vector and expression system of human serum albumin | |
| TW200401030A (en) | Internal ribosome entry site of the labial gene for protein expression | |
| CN111228292B (en) | Application of human TPT1/TCTP gene in preparation of antitumor drugs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |