JP4883532B2 - Gene amplification method using recombinant enzyme - Google Patents

Description

  The present invention relates to a gene recombination technique. More specifically, the present invention relates to a gene recombination method in a host cell using the recombination enzyme Cre and a mutant loxP sequence. If this invention is used, amplification of the target gene can be performed on the chromosome of an animal cell. The present invention is useful for mass production of recombinant proteins using animal cells or transgenic animals.

  When using genetically engineered animal cells to produce substances such as therapeutic drugs and other biopharmaceuticals, it is necessary to establish stable transformants by inserting the target gene into the genome chromosome of the cells. In general, in gene transfer into animal cells, the efficiency of integrating the transgene into the genome is low, except when a viral vector is used. By using a drug resistance gene or a nucleic acid biosynthetic enzyme gene as a selectable marker, the target gene is accidentally generated. Since the cells into which is incorporated are screened by survival in a selective medium by the action of the transgene, the site of introduction into the chromosome is also random. In genetically engineered animal cells for the purpose of substance production, gene amplification processing is performed in order to amplify the copy number of the target gene on the chromosome in order to further increase productivity (Non-patent Documents 1 and 2). This is because cells that have been amplified in the number of copies of the transgene as a result of increasing the concentration of the screening drug corresponding to the drug resistance gene or nucleic acid biosynthetic enzyme gene used as a selectable marker during the culture period. Is to be selected. This method is indispensable for the establishment of a highly productive cell line. However, in order to expect a phenomenon to occur at random, there is a problem that it lacks certainty and requires a long time for selection.

  On the other hand, development of a method for introducing a target gene into a specific position of a genomic chromosome is desired in various aspects such as gene therapy and transgenic animal production, as well as gene introduction at a cellular level (Non-patent Document 3). ). For these purposes, the introduction of a target gene by gene replacement by homologous recombination has been conventionally performed. This is because the gene sequence sandwiched between the chromosomal sites to be introduced on both sides of the target gene fragment is prepared and introduced into the cell, and the transgene is inserted into the target chromosomal site at a certain frequency by the action of the host cell's gene repair mechanism. This is a method using this (Non-Patent Document 4). Since this method also depends on a complicated mechanism on the cell side, it greatly depends on the cell to be introduced, and low integration efficiency is a problem.

In contrast to gene transfer by passive homologous recombination that depends on the gene repair mechanism of the host cell, a more aggressive sequence-specific gene transfer system using a sequence-specific recombinase (recombinase) Various studies have been made on chromosome engineering of animal cells (Non-Patent Documents 5 and 6). Representative examples of such recombinant enzymes include bacteriophage P1-derived Cre (non-patent document 7), yeast-derived Flp (non-patent document 8), and bacteriophage ΦC31-derived integrase (non-patent document 9). These recombinases recognize distinct sequence motifs (called loxP , FRT, and attB / attP , respectively) called recombination target sites and act on them to catalyze the efficient rearrangement of gene fragments Is.

Control of gene transfer by using the first generation recombinase was deletion of the transgene using Cre- loxP or flp- FRT system. Each of these recombinant enzymes can catalyze the incorporation reaction into the corresponding target site, but also catalyzes a deletion reaction which is a reverse reaction, and the reaction equilibrium is rather largely due to the deletion reaction. This method is still frequently used as a conditional knockout method.

The gene transfer control by the second generation recombinant enzyme is used as a gene cassette exchange method. In this method, by using two types of target sites that do not undergo recombination reaction with each other, a recombination replacement reaction is performed in a region sandwiched between these target sites. The ΦC31 integrase system can catalyze an irreversible substitution reaction as the original recombination system, but it can also be used with the development of several mutation target sites in the Cre- loxP and flp- FRT systems. (Non-patent Documents 10 to 14). In particular, and led to lox66 / lox71 (Non-Patent Document 15 to 17) in which a possible irreversible incorporation reaction, Cre-loxP in many mutations loxP is reported (Non-Patent Document 18).

Crouse GF, McEwan RN, Pearson ML., Expression and amplification of engineered mouse dihydrofolate reductase minigenes. Mol Cell Biol. 1983, 3 (2): 257-266. Powell JS, Berkner KL, Lebo RV, Adamson JW., Human erythropoietin gene: high level expression in stably transfected mammalian cells and chromosome localization.Proc Natl Acad Sci U S A. 1986, 83 (17): 6465-6469. Coates CJ, Kaminski JM, Summers JB, Segal DJ, Miller AD, Kolb AF., Site-directed genome modification: derivatives of DNA-modifying enzymes as targeting tools.Trends Biotechnol. 2005, 23 (8): 407-419. Glaser S, Anastassiadis K, Stewart AF., Current issues in mouse genome engineering. Nat Genet. 2005, 37 (11): 1187-1193. Kolb AF., Genome engineering using site-specific recombinases.Cloning Stem Cells. 2002, 4 (1): 65-80. Akopian A, Marshall Stark W., Site-specific DNA recombinases as instruments for genomic surgery. Adv Genet. 2005, 55: 1-23. Hoess RH, Ziese M, Sternberg N., P1 site-specific recombination: nucleotide sequence of the recombining sites.Proc Natl Acad Sci U S A. 1982, 79 (11): 3398-3402. Golic KG, Lindquist S., The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell. 1989, 59 (3): 499-509. Thorpe HM, Smith MC., In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvase / invertase family.Proc Natl Acad Sci U S A. 1998, 95 (10): 5505-5510. Hoess RH, Wierzbicki A, Abremski K., The role of the loxP spacer region in P1 site-specific recombination.Nucleic Acids Res. 1986, 14 (5): 2287-2300. Lee G, Saito I., Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination. Gene. 1998, 216 (1): 55-65. Langer SJ, Ghafoori AP, Byrd M, Leinwand L., A genetic screen identifies novel non-compatible loxP sites.Nucleic Acids Res. 2002, 30 (14): 3067-3077. Seibler J, Bode J., Double-reciprocal crossover mediated by FLP-recombinase: a concept and an assay.Biochemistry. 1997, 36 (7): 1740-1747. Schlake T, Bode J., Use of mutated FLP recognition target (FRT) sites for the exchange of expression cassettes at defined chromosomal loci. Biochemistry. 1994, 33 (43): 12746-12751. Albert H, Dale EC, Lee E, Ow DW., Site-specific integration of DNA into wild-type and mutant lox sites placed in the plant genome.Plant J. 1995, 7 (4): 649-659. Araki K, Araki M, Yamamura K., Targeted integration of DNA using mutant lox sites in embryonic stem cells.Nucleic Acids Res. 1997, 25 (4): 868-872. Araki K, Araki M, Yamamura K., Site-directed integration of the cre gene mediated by Cre recombinase using a combination of mutant lox sites.Nucleic Acids Res. 2002, 30 (19): e103. Missirlis PI, Smailus DE, Holt RA., A high-throughput screen identifying sequence and promiscuity characteristics of the loxP spacer region in Cre-mediated recombination.BMC Genomics. 2006, 7:73.

Until now, it has been known that an independent recombination reaction can be performed at a target site having a spacer mutation (for example, lox511 , lox2272 ) (Non-Patent Documents 10 to 12), and a target site having an arm mutation (for example, lox66 , lox71 ) (Non-Patent Documents 15 to 17), it is known that the irreversible insertion reaction is promoted by the generation of a mutation in both arms after the reaction. Use in combination has not been studied.

  On the other hand, if the target gene integrated on the chromosome can be amplified, it goes without saying that it is further useful in the production of recombinant proteins and the like. However, gene amplification technology utilizing the current drug resistance, that is, drug resistance together with the target gene. The method of selecting a recombinant in which gene amplification has occurred by introducing a gene into a chromosome and increasing the concentration of a drug in the environment requires a long time and a great amount of labor, and has a problem that it is inefficient. .

The present invention provides a system capable of repeatedly introducing a target gene into a chromosome using a recombination enzyme Cre and a mutant loxP sequence, in other words, capable of amplifying the target gene on the chromosome. To do. In the present invention, arm mutation and spacer mutation are used in combination.

The present invention specifically provides the following:
(1) Recombinant enzyme Cre;
A gene recombination method using a spacer region and a Cre target site comprising a left arm region and a right arm region respectively arranged on the left and right sides thereof:
(A) Target site 1 consisting of spacer region 1, one arm region with mutation, and the other arm region that is wild-type, which has been introduced into the host chromosome;
(B) an integration cassette comprising a target site 2 and a target site 3 linked to both sides of gene 1 and gene 1, respectively.
At this time, the target site 2 is from the spacer region 1 and one arm region on the opposite side of the target site 1 that is mutated and close to the gene 1 and the other arm region that is a wild type. And the target site 3 is a spacer region 2 that can function independently of the spacer region 1, and one arm region that is mutated and is on the same side as the target site 1 and close to the gene 1 And consisting of the other arm region that is wild type; and
(C) a replacement cassette comprising a target site 4 and a target site 5 respectively linked to both sides of gene 2 and gene 2,
At this time, the target site 4 is composed of the spacer region 2, one arm region on the side opposite to the target site 1 having mutation and close to the gene 2, and the other arm region that is a wild type. In this case, the target site 5 is the spacer region 3 (however, the spacer region 3 is the same as the spacer region 1 or can function independently of each of the spacer regions 1 and 2), and the mutation site. Preparing one arm region on the same side as the target site 1 and close to the gene 2 and the other arm region that is a wild type;
(1) reacting the target site 1 and the embedded cassette with Cre to obtain a reaction product; and
(2) A gene recombination method for carrying out two or more recombination on a chromosome, comprising a step of reacting the reaction product with a replacement cassette by Cre.

(2) Target site 1 consists of the nucleotide sequence of SEQ ID NO: 2;
Target site 2 consists of the nucleotide sequence of SEQ ID NO: 4;
The gene recombination method according to (1), wherein the target site 3 is composed of the nucleotide sequence of SEQ ID NO: 3; and the target site 4 is composed of the nucleotide sequence of SEQ ID NO: 5.

(3) In genetic recombination using the recombinant enzyme Cre,
A target site 1 consisting of a wild-type left arm region, a spacer region 1, and a mutant right arm region;
A target site 2 consisting of a mutant left arm region, a spacer region 1, and a wild type right arm region;
Target site 3 consisting of wild type left arm region, spacer region 2 that can function independently of spacer region 1, and mutant right arm region; and mutant left arm region, spacer region 2, and wild type right arm region Target site 4 consisting of
How to use in combination.

(4) Target site 1 consists of the nucleotide sequence of SEQ ID NO: 2;
Target site 2 consists of the nucleotide sequence of SEQ ID NO: 4;
The use method according to (3), wherein the target site 3 is composed of the nucleotide sequence of SEQ ID NO: 3; and the target site 4 is composed of the nucleotide sequence of SEQ ID NO: 5.

(5) A kit for performing two or more recombination using the recombination enzyme Cre including one or more selected from the following:
A target site 1 consisting of a wild-type left arm region, a spacer region 1, and a mutant right arm region;
A target site 2 consisting of a mutant left arm region, a spacer region 1, and a wild type right arm region;
Target site 3 consisting of wild type left arm region, spacer region 2 that can function independently of spacer region 1, and mutant right arm region; and mutant left arm region, spacer region 2, and wild type right arm region Target site 4 consisting of:

(6) Target site 1 consists of the nucleotide sequence of SEQ ID NO: 2;
Target site 2 consists of the nucleotide sequence of SEQ ID NO: 4;
The kit according to (5), wherein the target site 3 is composed of the nucleotide sequence of SEQ ID NO: 3; and the target site 4 is composed of the nucleotide sequence of SEQ ID NO: 5.

(7) One of the following Cre target sites:
A polynucleotide consisting of SEQ ID NO: 2;
A polynucleotide consisting of SEQ ID NO: 3;
A polynucleotide consisting of SEQ ID NO: 4; and a polynucleotide consisting of SEQ ID NO: 5.

(8) Use of a combination of an arm mutation at the Cre target site and two or more independently functioning spacer mutations to perform two or more gene recombination.
In the present invention, the recombination enzyme Cre and a target site recognizable by Cre are used. Cre is a protein with a molecular weight of 38 kDa and recognizes a 34 bp target site called loxP for recombination (Figure 1). The target site consists of two arm regions consisting of a 13 bp palindromic sequence (left arm region and right arm region) that function as a Cre monomer binding site and an 8 bp sequence sandwiched between them. It consists of a spacer region. In this specification, “target site” refers to something that can be recognized by Cre, except in special cases. The target site can be double stranded DNA.

In the present invention, a target site having a mutated left arm region and a target site having a mutated right arm region are also used in combination. If each mutation is only in one arm of the target site, Cre can cause an insertion reaction, but if the insertion reaction results in a site with mutations in both arms, the deletion reaction Anything that promotes an irreversible insertion reaction that does not occur. An example of the sequence of the left arm region with mutation is lox 66 (SEQ ID NO: 9), and an example of the sequence of the right arm region with mutation is lox 71 (SEQ ID NO: 12).

The following can also be used in the present invention as the left arm region with mutation or the right arm region with mutation:
(a) It consists of a nucleotide sequence in which one or several bases are substituted, deleted, inserted and / or added in the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 12, and consists of SEQ ID NO: 9 or 12 The same function as the arm region (i.e., if there is a mutation in only one arm of the target site, an insertion reaction with Cre can occur, but when the insertion reaction results in a site with a mutation in both arms, A polynucleotide having a function capable of promoting an irreversible insertion reaction in which no deletion reaction occurs;
(b) A polynucleotide comprising a nucleotide sequence having high identity with the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 12, and having the same function as the arm region consisting of SEQ ID NO: 9 or 12.
(c) Hybridizes under stringent conditions with a polynucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 12, and has the same function as the arm region comprising SEQ ID NO: 9 or 12 A polynucleotide having
In the present specification, the polynucleotide includes DNA and RNA, except for special cases, and includes single-stranded and double-stranded ones.

  In addition, in this specification, the number of nucleotides to be substituted when referred to as “a nucleotide sequence in which one or more bases are substituted, deleted, inserted, and / or added” refers to the number of nucleotides that comprise the base sequence. Although it does not specifically limit as long as it has a desired function, 1-9 pieces or about 1-4 pieces may be sufficient. Means for preparing a polynucleotide comprising such a nucleotide sequence are well known to those skilled in the art.

  Further, in the present specification, regarding nucleotide sequences, high identity means 50% or more, preferably 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more. Refers to sex. Search / analysis regarding the identity of polynucleotide sequences can be carried out by algorithms or programs well known to those skilled in the art (for example, BLASTN, BLASTP, BLASTX, ClustalW). Those skilled in the art can appropriately set parameters when using a program, and the default parameters of each program may be used. Specific techniques for these analysis methods are also well known to those skilled in the art.

  In addition, the term “stringent conditions” in the present specification refers to the conditions of 6M urea, 0.4% SDS, 0.5 × SSC or a hybridization condition equivalent thereto unless otherwise specified, and if necessary, In the present invention, conditions with higher stringency, for example, 6M urea, 0.4% SDS, 0.1 × SSC or equivalent hybridization conditions may be applied. Under each condition, the temperature can be about 40 ° C. or higher, and if higher stringency conditions are required, for example, about 50 ° C. or about 65 ° C. may be used.

In the present invention, a wild-type left arm region and a wild-type right arm region are also used. Examples of sequences constituting these are SEQ ID NOs: 8 and 13, respectively.
The following are also included in the category of “wild type” in the present specification and can be used in the present invention:
(d) consisting of a nucleotide sequence in which one or several bases are substituted, deleted, inserted and / or added in the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 13, and consisting of SEQ ID NO: 8 or 13 A polynucleotide having the same function as an arm region (ie, a function capable of causing an insertion reaction by Cre but also promoting a deletion reaction which is a reverse reaction);
(e) a polynucleotide comprising a nucleotide sequence having a high identity with the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 13, and having the same function as an arm region consisting of SEQ ID NO: 8 or 13.
(f) The same function as the arm region consisting of SEQ ID NO: 8 or 13 and hybridizing under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 13. A polynucleotide having:
In the present invention, a plurality of spacer regions that can function independently are used in combination. The spacer region can be used in combination of not only two types but also more (for example, three or four types). Examples of spacer region sequences are SEQ ID NOs: 10 and 11.

The following can also be used in the present invention as spacer regions:
(g) consisting of a nucleotide sequence in which one or several bases are substituted, deleted, inserted and / or added in the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11, and consisting of SEQ ID NO: 10 or 11 A polynucleotide having the same function as the spacer region (ie, capable of causing an insertion reaction by Cre and functioning independently of the other spacer regions);
(h) a polynucleotide comprising a nucleotide sequence having high identity to the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11, and having the same function as the spacer region comprising SEQ ID NO: 10 or 11.
(i) The same function as the spacer region consisting of SEQ ID NO: 10 or 11 and hybridizing with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11 under stringent conditions A polynucleotide having:
In this specification, when “(each) can function independently” with respect to the spacer region, the target sites should not recombine with each other when used in the target site, except in special cases. Say.

  An example of the target site 1 includes a wild type left arm region, a spacer region 1, and a mutant type right arm region. In such a case, the target site 2 may be composed of a mutated left arm region, a spacer region 1, and a wild type right arm region; the target site 3 is defined as a wild type left arm region and a spacer region 1. The target region 4 may consist of a spacer region 2 that can function independently, and a mutated right arm region; and the target site 4 may consist of a mutated left arm region, a spacer region 2, and a wild type right arm region. do it. When the target site 5 is used, it may be composed of a wild type left arm region, a spacer region 3, and a mutant type right arm region.

  More specifically, the target site 1 can be composed of the nucleotide sequence of SEQ ID NO: 2; the target site 2 can be composed of the nucleotide sequence of SEQ ID NO: 4; target site As the target site 4, one consisting of the nucleotide sequence of SEQ ID NO: 3 can be used. As the target site 4, one consisting of the nucleotide sequence of SEQ ID NO: 5 can be used.

The following can also be used in the present invention as target sites:
(j) consisting of a nucleotide sequence in which one or several bases are substituted, deleted, inserted, and / or added in any one of the nucleotide sequences of SEQ ID NOs: 2 to 5; A polynucleotide having the same function as any one of the target sites;
(k) a polynucleotide comprising the nucleotide sequence having high identity with any one nucleotide sequence of SEQ ID NOs: 2 to 5 and having the same function as the target site consisting of any one of SEQ ID NOs: 2 to 5 .
(l) It hybridizes under stringent conditions with a polynucleotide comprising a nucleotide sequence complementary to any one nucleotide sequence of SEQ ID NOs: 2 to 5, and consists of any one of SEQ ID NOs: 2 to 5 A polynucleotide having the same function as the target site;
In the target site 1, contrary to the above example, when the mutant type left arm region and the wild type right arm region are used, the target site 2 includes the wild type left arm region, the spacer region 1, and the mutant type right arm region. Target site 3 may consist of a mutant left arm region, a spacer region 2 that can function independently of spacer region 1, and a wild type right arm region; and target The site 4 may be composed of a wild type left arm region, a spacer region 2, and a mutant right arm region. When the target site 5 is used, it may be composed of a mutated left arm region, a spacer region 3, and a wild type right arm region.

  In the present invention, a built-in cassette and a replacement cassette are used in combination. Each cassette can be in the form of a plasmid (circular DNA). In each cassette, the target site is linked to both sides of the target gene (gene to be incorporated into the chromosome), but the target site can function and the target gene can be expressed in the host. Done to be. Each cassette may further include a sequence such that unnecessary regions are deleted after the Cre reaction. For example, the integration cassette can include a target site consisting of a wild-type left and right arm region and a predetermined spacer region further downstream of the target site linked downstream of the target gene. The integration cassette is used not only for gene integration, but also for gene integration and deletion (replacement) or replacement, and the replacement cassette can be replaced or replaced. In addition to being used for purposes, it may also be used for integration.

  The target gene of each cassette may be the same or different. Examples of target genes include useful proteins used as pharmaceuticals, such as antibodies, erythropoietin, tissue plasminogen activator, tumor necrosis factor, urokinase, interferon, interleukin, hepatitis B vaccine, and colony stimulating factor.

  Each cassette may also contain a gene that confers resistance to other genes, for example, a drug such as chloramphenicol, tetracycline, or ampicillin, in addition to the target gene.

  When carrying out the genetic recombination method of the present invention on a chromosome, a predetermined target site is previously incorporated into the host chromosome. The integration of the target site into this host chromosome can be carried out by those skilled in the art using a known technique. Can be used as appropriate. For example, when using CHO cells, a suitable gene transfer reagent is used to transfect a plasmid containing the target site and drug resistance gene, and a cell line that has undergone recombination on the chromosome using drug resistance is selected. If necessary, genomic DNA can be extracted from the cell line and the presence of the target site can be confirmed by PCR. For more detailed conditions, the examples in this specification can be referred to.

  In carrying out the gene recombination method of the present invention, the recombination enzyme Cre is used. Cre may be expressed in a host animal cell, or the Cre protein itself may be introduced into the cell. In order to express Cre in a host animal cell, the Cre gene inserted into an expression vector that can function in the host cell may be supplied to the host cell together with the integration cassette or the replacement cassette.

  According to the gene recombination method of the present invention, gene recombination or inheritance on the chromosome of animal cells can be suitably performed. The host animal cell may be a cultured cell or an individual animal. The method of the present invention can be used not only on chromosomes but also for gene manipulation on plasmids.

The principle of the method of the present invention will be described with reference to an example of gene amplification on a chromosome in the case of carrying out using two types of independently functionable spacer regions (FIG. 2A). A target site (referred to as loxS1-R ) having an arm mutation is introduced into the cell genome in advance. A target site ( loxS1-L ) having a spacer 1 with a target gene (gene 1) sandwiched between a plasmid (circular DNA) and an arm mutation on the opposite side (and target gene side), and spacer 2 Prepared by placing a target site ( loxS2-R ) with an arm mutation on the same side (and target gene side) as loxS1-R (plasmid 1), and loxS1-R integrated into the previous cell genome When they are reacted with Cre, those with spacer 1 react with each other and an insertion reaction on the genome occurs. In the reaction product, at one target site having spacer 1, both arm mutations are generated ( loxS1-X ), so that the deletion reaction does not occur and the insertion state is stabilized (another generated spacer 1). Target sites with no arm mutation; loxS1 ). Next, a target site ( loxS2-L ) that has a target gene (gene 2) on a plasmid (circular DNA), has a spacer 2, and has an arm mutation on the opposite side of loxS2-R (and the target gene side) ) And loxS1-R (arm mutation is on the target gene side) prepared (plasmid 2) and reacted with Cre, this time, those with spacer 2 react with each other on the genome As the insertion reaction occurs, the loxS1-R of plasmid 2 and the loxS1 generated in the previous reaction on the genome undergo a deletion reaction, resulting in a replacement reaction between the regions sandwiched at the target site. At the target site having spacer 2, both arm mutations are generated ( loxS2-X ), so that the deletion reaction does not occur and the insertion state is stabilized. By two integration reactions with these two types of plasmids, two types of target genes can be inserted, leaving only reactive loxS1-R . Since the remaining loxS1-R is the same as that introduced into the cell first, a series of reactions can be repeated, and the target gene can be inserted for each reaction.

  The case where the method of the present invention is carried out using three types of spacer regions that can function independently is shown in FIGS. 2B and 2C.

In order to prove the effectiveness of this system, we attempted gene amplification on a plasmid by Cre reaction in vitro using a plasmid and gene amplification on a chromosome using cells into which loxS1-R had been introduced in advance. It was.

  The mutant loxP sequences used in this experiment are summarized in Table 1.

LoxP1 , loxP2 , loxP3 , and loxP4 correspond to loxS1-R , loxS2-R , loxS1-L , and loxS2-L in FIG. 2A, respectively. FIG. 3 shows a system for confirming the progress of the reaction. Here, a green fluorescent protein (GFP) gene was used as the target gene 1 in FIG. 2, and a red fluorescent protein (DeRed) gene was used as the target gene 2. In order to confirm the integration reaction by the expression of the target gene, a promoter that works in animal cells (CMV promoter) was placed immediately upstream of the target site in the plasmid to be integrated (acceptor plasmid; here, P1). By introducing the GFP gene and DsRed gene into the plasmid (donor plasmid; here P2 or P3) that donates the gene at the same time as the IRES sequence at the determined target site, Cre is dependent on the target site. Only when the integration reaction occurs, the target protein is translated and produced from the transcription product generated by placing the target gene downstream of the promoter. Confirmation of the progress of the reaction was carried out by carrying out an integration / replacement reaction using purified Cre protein in a test tube, and then amplifying specific gene products from the resulting plasmid by PCR using specific primers. The gene was analyzed by gene sequence analysis after transduction into E. coli and mass production. In addition, the progress of the reaction was evaluated by expression of the target protein in animal cells using the Cre expression vector, and genomic DNA was extracted and PCR was performed.

[1. Preparation of experimental materials]
1.1. Preparation of pCEP4 / NCre (Figure 4)
A Cre recombinase gene having a nuclear translocation signal sequence derived from SV40 was prepared using pxCANCre (Riken, Tsukuba) as a template and primers 5'-ATCG GCTAGC AGCGGCCCTCCAAAAAAG-3 '(SEQ ID NO: 14) and 5-ATCC AAGCTT GTTAATGGCTAATCGCCATCTTCC-3' (sequence Number: 15) (underlined parts are restriction enzymes Nhe I and Hin dIII) amplified by PCR (DNA polymerase; KOD-plus-, Toyobo, Osaka, 94 ° C, 15 seconds, 60 ° C, 30 seconds, 68 ° C) , 70 seconds: 30 cycles). This restriction DNA fragment enzymes Nhe I and pET28a that had been digested with Hin dIII (Takara, Otsu) linked to (DNA Ligation Kit, Takara), was prepared pET28a / NCRE.

The introduced DNA sequence was confirmed by gene sequence analysis. The Cre gene fragment derived from pET28a / NCre digested with restriction enzymes Xba I and Xho I was ligated to pCEP4 (Invitrogen, Carlsbad, CA, USA) digested with restriction enzymes Nhe I and Xho I to prepare pCEP4 / NCre.

1.2. pcDNA4 / loxP1 (P1) production (Figure 5)
Two chemically synthesized single-stranded polynucleotides 5'- GGCCGC ATAACTTCGTATAGTATAGTATATACGAACGGTA T- 3 '(SEQ ID NO: 16) and 5'- CTAGA TACCGTTCGTATATACTATACTATACGAAGTTAT GC- 3' (SEQ ID NO: 17) corresponding to the mutant loxP sequence ( loxP1 ) (Underlined parts are restriction enzymes Not I and Xba I) After heat treatment at 70 ° C. for 2 minutes, annealing was performed by returning to room temperature. PBluescript KS (-) (Toyobo) and pcDNA4 / TO / myc-His A (Invitrogen) digested with restriction enzymes Not I and Xba I were prepared to prepare pBlue / loxP1 and pcDNA4 / loxP1 (P1), respectively.

1.3. Preparation of pBlue / loxP2-IRES-EGFP-loxP3 (P2) (Figure 6)
Two chemically synthesized single-stranded polynucleotides 5'- GGCCGC ATAACTTCGTATAGGCTATAGTATACGAACGGTA T- 3 '(SEQ ID NO: 18) and 5'- CTAGA TACCGTTCGTATACTATAGCCTATACGAAGTTAT GC- 3' (SEQ ID NO: 19) corresponding to the mutant loxP sequence ( loxP2 ) (Underlined parts are restriction enzymes Not I and Xba I) After heat treatment at 70 ° C. for 2 minutes, annealing was performed by returning to room temperature. Then, it was ligated to pBluescript KS (−) digested with restriction enzymes Not I and Xba I to prepare pBlue / loxP2.

Two chemically synthesized single-stranded polynucleotides 5′- AGCTT TACCGTTCGTATAGTATAGTATATACGAAGTTAT C- 3 ′ (SEQ ID NO: 20) and 5′- TCGAG ATAACTTCGTATATACTATACTATACGAACGGTA A 3 ′ (SEQ ID NO: 21) corresponding to the mutant loxP sequence ( loxP3 ), the (the underlined restriction enzymes Hin dIII and Xho I), 70 ° C., after heat treatment for 2 minutes, and annealed by returning to room temperature. Restriction enzymes Hin dIII and Xho I digested was pBluescript KS (-) connected to, to prepare a pBlue / loxP3.

After digesting pMSCV / ΔAWGA-IRES-EGFP with the restriction enzyme Cla I, the restriction enzyme fragment was blunted (DNA blunting kit, Takara). Then the IRES-EGFP gene fragment obtained by digestion with Bam HI, ligated into pBlue / loxP3 digested with restriction enzymes Bam HI and Eco RV, was prepared pBlue / IRES-EGFP-loxP3. The restriction enzymes Bam HI and Xho I digested with IRES-EGFPloxP3 gene fragment from pBlue / IRES-EGFPloxP3 was was ligated into pBlue / loxP2 digested with restriction enzymes Bam HI and Xho I, pBlue / loxP2-IRES -EGFP -loxP3 (P2) was created.

1.4. Preparation of pBlue / loxP1-IRES-DsRed-loxP4 (P3) (Figure 7)
Two chemically synthesized single-stranded polynucleotides 5'- AGCTT TACCGTTCGTATAGGCTATAGTATACGAAGTTAT C- 3 '(SEQ ID NO: 22) and 5'- TCGAG ATAACTTCGTATACTATAGCCTATACGAACGGTA A- 3' (SEQ ID NO: 23) corresponding to the mutant loxP sequence ( loxP4 ) the (the underlined restriction enzymes Hin dIII and Xho I), 70 ° C., after heat treatment for 2 minutes, and annealed by returning to room temperature. Restriction enzymes Hin dIII and Xho I digested was pBluescript KS (-) connected to, to prepare a pBlue / loxP4.

IRES-DsRed gene fragment from pIRES2-DsRed Express (Clontech, Palo Alto, CA, USA) digested with restriction enzymes Bam HI and Dra I was ligated to pBlue / loxP4 digested with restriction enzymes Bam HI and Eco RV, pBlue / IRES-DsRed-loxP4 was prepared. The restriction enzymes Bam HI and Xho I digested with IRES-DsRed-loxP4 gene fragment from pBlue / IRES-DsRed-loxP4 was was ligated into pBlue / loxP1 digested with restriction enzymes Bam HI and Xho I, pBlue / loxP1-IRES -DsRed-loxP4 (P3) was produced.

1.5. Preparation of pBlue / loxP2-IRES-EGFP-loxP3-loxP5 (P2 ') (Figure 8)
Two chemically synthesized single-stranded polynucleotides 5'- TCGAG ATAACTTCGTATAGGCTATAGTATACGAAGTTAT GGTAC- 3 '(SEQ ID NO: 24) and 5'- C ATAACTTCGTATACTATAGCCTATACGAAGTTAT C- 3' (SEQ ID NO: 25) corresponding to the mutant loxP sequence ( loxP5 ) (Underlined portions are restriction enzymes Xho I and Kpn I) were annealed in the same manner as described above. This gene fragment and the IRES-EGFPloxP3 gene fragment derived from pBlue / IRES-EGFP-loxP3 digested with restriction enzymes Bam HI and Xho I were ligated to pBlue / loxP2 digested with restriction enzymes Bam HI and Kpn I, and pBlue / loxP2 -IRES-EGFP-loxP3-loxP5 (P2 ') was prepared.

1.6. Construction of pBlue / loxP2-IRES-EGFP-loxP3-Cm-loxP5 (P2'Cm) (Figure 8)
A chloramphenicol resistance gene expression unit was prepared using primers 5'-CCG CTCGAG CCGAAAAGTGCCACCTG-3 '(SEQ ID NO: 26) and 5'-CCG CTCGAG GGCGTTTAAGGGCACC-3 using 705-Cre (Gene Bridges, Dresden, Germany) as a template. '(SEQ ID NO: 27) (underlined is the restriction enzyme Xho I) (DNA polymerase; KOD-plus-, 94 ° C, 15 seconds, 51 ° C, 30 seconds, 68 ° C, 60 seconds) 30 cycles). This DNA fragment was ligated to pBlue / loxP2-IRES-EGFP-loxP3-loxP5 (P2 ') digested with restriction enzyme Xho I to produce pBlue / loxP2-IRES-EGFP-loxP3-Cm-loxP5 (P2'Cm) did.

1.7. Preparation of pBlue / loxP1-Kan-loxP4 (P3Kan) (Figure 9)
A kanamycin resistance gene expression unit was prepared using pMW219 (Nippon Gene, Toyama) as a template and primers 5'-CCC AAGCTT AGAACGCTCATGTTTGACAG-3 '(SEQ ID NO: 28) and 5'-CG GGATCC GTTCGGTGTAGGTCGTTCG-3' (SEQ ID NO: 29). (underlined restriction enzymes Hin dIII and Bam HI) were amplified by PCR using the (DNA polymerase; KOD-plus-, 94 ℃, 15 seconds, 52.5 ° C., 30 sec, 68 ° C., 60 seconds: 30 cycles). This DNA fragment was ligated to the P3 digested with restriction enzymes Hin dIII and Bam HI, to produce a pBlue / loxP1-Kan-loxP4 ( P3Kan).

1.8. Preparation of pBlue / loxP1-Neo-IRES-DsRed-loxP4 (P3Neo) (Figure 9)
Neomycin resistance gene, primers 5'-CG GGATCC ATGATTGAACAAGATGGATTGC-3 '(SEQ ID NO: 30) and 5'-CG GGATCC TCAGAAGAACTCGTCAAGAAGG-3' (SEQ ID NO: 31) (underlined part is limited) using pIRES2-DsRed-Express as a template Amplified by PCR using the enzyme Bam HI) (DNA polymerase; KOD-plus-, 94 ° C., 15 seconds, 54 ° C., 30 seconds, 68 ° C., 60 seconds: 30 cycles). This DNA fragment was digested with restriction enzymes Bam HI pBlue / loxP1-IRES- DsRed-loxP4 linked to (P3), to prepare a pBlue / loxP1-Neo-IRES- DsRed-loxP4 (P3 Neo).

1.9. Production of pcDNA4 / loxP6-loxP2 (mP12) (Figure 10)
Two chemically synthesized single-stranded polynucleotides 5'- AGCTT ATAACTTCGTATAGTATAGTATATACGAAGTTAT CGAT- 3 '(SEQ ID NO: 32) and 5'- CG ATAACTTCGTATATACTATACTATACGAAGTTAT A- 3' (SEQ ID NO: 33) corresponding to the mutant loxP sequence ( loxP6 ) the (the underlined restriction enzymes Hin dIII and Pvu I), 70 ° C., after heat treatment for 2 minutes, and annealed by returning to room temperature. Ligated into pcDNA4 was digested LoxP2 fragment from pBlue / loxP2 digested with this LoxP6 fragment with restriction enzymes Pvu I and Eco RI restriction enzymes Hin dIII and Eco RI (Invitrogen), producing a pcDNA4 / loxP6-loxP2 (mP12) did.

2. Experimental results 2.1. Gene amplification on plasmid (in vitro reaction)
(1) Generation of P12 by reaction of P1 and P2 or P2 '
It was confirmed whether P12 was produced by reacting P1 and P2. The reaction was carried out with 100 ng P1, 100 ng P2, 10 ng Cre recombinase (Clontech) in a total volume of 15 μl in 1 μg / ml BSA (Clontech) and Cre reaction buffer (Clontech) at 30 ° C. I went for 16 hours.

  Using 5 μl of the reaction solution as a template, primers 5′-AACGAGAAGCGCGATCAC-3 ′ (SEQ ID NO: 34) and 5′-ACAGTGGGAGTGGCACCTT-3 ′ (SEQ ID NO: 35) (P2 and P2′Cm), 5′-GCTCGTTTAGTGAACCGTCAG-3 PCR reaction was performed using '(SEQ ID NO: 36) and 5'-CAACAGACCTTGCATTCCTT-3' (SEQ ID NO: 37) (P2'Cm) (DNA polymerase; G-Taq, Hokkaido system science, 95 ° C, 20 Seconds, 60 ° C, 40 seconds, 72 ° C, 30 seconds: 25 cycles).

As can be seen from the electrophoresis result on the lower left side of FIG. 11, the expected gene fragment of 326 bp was amplified only when Cre was added. Moreover, the plasmid DNA obtained from the reaction was transformed into E. coli DH5α strain, and after culturing for 1 hour, it was applied to an LB agar medium containing antibiotics to form transformant colonies. This transformant clone was grown in an antibiotic-containing LB liquid medium, and after plasmid collection, plasmid extraction was performed to obtain a plasmid after a recombination reaction with Cre. The plasmid was analyzed by digesting cleavage patterns by restriction enzymes Pvu II and Hin dIII, were consistent with the P12 purposes. Furthermore, the loxP sequence on this plasmid was exactly the same as that of the expected P12 (FIG. 12).

  The same thing was done using P2'Cm, which has a chloramphenicol resistance gene, and P2 'designed so that regions unnecessary for donor plasmid integration can be deleted after Cre reaction. It can be confirmed that the integration reaction predicted in the assay has occurred (FIG. 13), and the plasmid obtained by transformation into E. coli has the same restriction enzyme cleavage pattern and target site as the target production plasmid P12'Cm. The expected reaction product could be obtained.

(2) Generation of P123 by the reaction of P1 + P2 + P3
After reacting P1 and P2, it was confirmed that the production of P123 was observed by continuing the reaction of P3. The reaction was carried out at 30 ° C. for 16 hours in a total volume of 15 μl in 100 ng P1, 100 ng P2, 10 ng Cre recombinase, 1 μg / ml BSA and Cre reaction buffer. Subsequently, 100 ng of P3 was digested with restriction enzymes Not I and Xho I, and a DNA fragment (loxP1-IRES-DsRed-loxP4) and 10 ng of Cre recombinase were added, followed by 30 ° C. for 16 hours.

PCR reaction was performed using 2 μl of the reaction solution as a template and primers 5′-GCTCGTTTAGTGAACCGTCAG-3 ′ (SEQ ID NO: 36) and 5′-CAACAGACCTTGCATTCCTT-3 ′ (SEQ ID NO: 37) (DNA polymerase; G-Taq 95 ° C, 20 seconds, 60 ° C, 40 seconds, 72 ° C, 30 seconds: 25 cycles). As can be seen from the electrophoresis result on the lower left side of FIG. 15, the expected gene fragment of 870 bp was amplified only when Cre was added. Furthermore, when the amplified gene fragment by PCR was digested with restriction enzyme Not I and the cleavage pattern was analyzed by electrophoresis (lower right side of FIG. 15), it was divided into the expected size of 693 bp and 177 bp. , P123 formation reaction was confirmed.

  Similarly, when the plasmids P12'Cm and P3Kan obtained in FIG. 14 were reacted with Cre, it was confirmed that the integration reaction predicted in the PCR assay was occurring, and further obtained by transformation into E. coli. The plasmid had the same restriction enzyme cleavage pattern as the target production plasmid P123Kan and the sequence of the target site (FIG. 16), and the expected reaction product could be obtained.

(3) Confirmation of the first stage reaction in the second cycle by the reaction of mP12 + P3 + P2
After reacting mP12 and P3 having the same target site as P12, P2 was subsequently reacted to confirm whether the target site generated in the first cycle could be used in the second cycle. The reaction was performed by digesting 100 ng mP12, 100 ng P3 with restriction enzymes Not I and Xho I (loxP1-IRES-DsRed-loxP4), 10 ng Cre recombinase, 1 μg / ml BSA The total volume was 15 μl in Cre reaction buffer, and the reaction was performed at 30 ° C. for 16 hours. Subsequently, 150 ng of P2 and 10 ng of Cre recombinase were added, followed by 30 ° C. for 16 hours. PCR reaction was performed using 2 μl of the reaction solution as a template and primers 5′-AACGAGAAGCGCGATCAC-3 ′ (SEQ ID NO: 34) and 5′-CACCTTGAAGCGCATGAAC-3 ′ (SEQ ID NO: 38) (DNA polymerase; G- Taq, 95 ℃, 20 seconds, 60 ℃, 40 seconds, 72 ℃, 30 seconds: 25 cycles). As can be seen from the electrophoresis result on the left side of the lower part of FIG. 17, the expected gene fragment of 792 bp was amplified only when Cre was added. Furthermore, when the amplified gene fragment by PCR was digested with the restriction enzyme Bam HI and the cleavage pattern was analyzed by electrophoresis (lower right side of FIG. 17), it was divided into the expected size of 641 bp and 151 bp. It was confirmed that the second cycle reaction occurred.

2.2. Gene amplification on cell chromosomes (reaction in animal cells)
(1) Recombination reaction by P1 and P2 transfection (insertion reaction)
As animal cells, Chinese hamster ovary cells (CHO-K1 cells) were used. CHO cells were seeded in 24-well plates at 1.2 × 10 ⁵ cells / well. The next day, using a gene transfer reagent (Lipofectamine 2000; Invitrogene), 400 ng P1, 400 ng P2, and Cre animal cell expression vector pCEP4 / NCre was transferred to 0, 5, 10, 15, 25, The cells were co-transfected with 35 and 50 ng. 48 hours later, when the cells expressing green fluorescent protein (GFP), which is the target gene, were counted (FIG. 18: left), almost no GFP-expressing cells were seen when the Cre expression vector was not added. The addition of GFP-expressing cells dramatically increased. When pCEP4 / NCre was fixed at 35 ng and P1 and P2 in a total amount of 800 ng were co-transfected at a ratio of 1: 4, 1: 2, 1: 1, 2: 1, 4: 1 The number of GFP-expressing cells was the highest at 1: 1 (FIG. 18: right).

(2) Recombination reaction (replacement reaction) by transfection of P12 or mP12 and P3
It was confirmed whether the second-stage reaction in the first cycle occurred in animal cells. CHO cells were seeded in 24-well plates at 1.2 × 10 ⁵ cells / well. The next day, cells were cotransfected with 400 ng P12 or mP12, 400 ng P3 and 35 ng pCEP4 / NCre using LF2000. After 48 hours, when the cells expressing the target gene red fluorescent protein (DsRed) were observed, it was confirmed that DsRed expressing cells appeared in a Cre-dependent manner when either P12 or mP12 was used (FIG. 19). .

(3) Integration reaction in a CHO cell line incorporating P1 From the above results, it was found that a series of integration reactions occur in animal cells. Therefore, in order to confirm the amplification reaction on the chromosome, P1 was A stable cell line incorporated into it was established. As a method, CHO cells were seeded in a 24-well plate at 1.2 × 10 ⁵ cells / well, and the next day, the cells were transfected with 800 ng of P1 using a gene transfer reagent. After 48 hours, cells were seeded in a 60 mm culture dish and cultured in a medium containing 250 μg / ml zeocin (Invitrogen). Thereafter, a stable cell line in which P1 was integrated into the chromosome was established by limiting dilution (CHO / P1). The cell line containing loxP1 was identified by extracting genomic DNA from the cell line and performing PCR to obtain six clones that seem to have incorporated P1 into the genome. Therefore, this CHO / P1 cell was used to confirm the recombination reaction on the chromosome by P2 or P2 ′ transfection.

Two cell lines (F11 and H6) were selected from the established CHO / P1 cell lines, and the cells were seeded in a 24-well plate at 1.2 x 10 ⁵ cells / well, and the next day, 800 ng using a gene transfer reagent. The cells were transfected with P2 and pCEP4 / NCre of 0, 0.5, 1.0, 2.5, 5.0, 10, 15 ng. After 48 hours, GFP-expressing cells were counted, and GFP-expressing cells appeared depending on the addition of the Cre expression vector (FIGS. 20 and 21). Similarly, GFP-expressing cells were obtained when co-transfected with 800 ng of P2 ′ and 10 ng of pCEP4 / NCre. Thereafter, a cell line (CHO / P12 or CHO / P12 ′) that had undergone the integration reaction on the chromosome was established by the limiting dilution method using green fluorescence as an index.

(4) Confirmation of integration reaction on the chromosome by transfection of P2 and P3 in CHO / P1 cells In order to confirm the integration reaction on the chromosome, specific amplification of the gene integrated by PCR was attempted. . CHO / P1 cells were seeded in a 24-well plate at 1.2 × 10 ⁵ cells / well, and the following day, cells were transfected with 800 ng P2 and 5 ng pCEP4 / NCre using a gene transfer reagent. 24-72 hours later, cells were transfected with 800 ng P3 and 5 ng pCEP4 / NCre. Cells were collected 96 hours after the first transfection, and genomic DNA was extracted (Mag Extractor-Genome-, Toyobo). Primers 5′-TACACCATCGTGGAGCAGTA-3 ′ (SEQ ID NO: 39), 5′-ACCACCCGGTGAACAG-3 ′ (SEQ ID NO: 40), and 5′-AACGAGAAGCGCGATCAC-3 ′ (SEQ ID NO: 34) using the extracted genomic DNA as a template And 5′-CACCTTGAAGCGCATGAAC-3 ′ (SEQ ID NO: 38) (DNA polymerase; G-Taq, 95 ° C., 20 seconds, 57 ° C., 40 seconds, 72 ° C., 30 seconds: 35 cycles) ). As can be seen from the electrophoresis results in FIG. 22, amplification of specific gene fragments could be confirmed by the primer set (primer2 / 3) for confirming the progress of the first-stage integration reaction (FIG. 22: left). In addition, when P3 was added, amplification of specific gene fragments could be confirmed by PCR using a primer set (primer6 / 7) that was amplified when the second-stage substitution reaction proceeded (Fig. 22: Right).

(5) Recombination reaction on chromosome by transfection of P3 or P3Neo in CHO / P12 'cells
By cloning P2'-incorporated P2 'cells and expressing GFP (CHO / P12' cells) into P1-incorporated CHO cells (CHO / P1 cells), and reacting P3 with these cells It was confirmed whether the second-stage substitution reaction occurred on the chromosome. Therefore, CHO / P12 'cells were seeded in 24-well plates at 1.2 x 10 ⁵ cells / well, and the next day, 800 ng P3 or P3Neo and 5 ng pCEP4 / NCre were copied into the cells using a gene transfer reagent. Transfected. When 48 hours later, DsRed expressing cells were counted, DsRed expressing cells appeared depending on the addition of the Cre expression vector (FIG. 23).

FIG. 1 is a diagram showing a Cre- loxP gene recombination system. FIG. 2A is a diagram showing the principle of gene amplification using a recombinant enzyme. FIG. 2B is a diagram showing an example of gene amplification when there are three types of independently functioning spacers (integrated type). FIG. 2C is a diagram showing an example of gene amplification when there are three types of spacers that function independently (replacement type). FIG. 3 is a diagram showing a system for confirming the progress of the reaction. FIG. 4 shows the production of pCEP4 / NCre. FIG. 5 shows the production of P1. FIG. 6 is a diagram showing the production of P2. FIG. 7 is a diagram showing the production of P3. FIG. 8 shows the production of P2 ′ and P2′Cm. FIG. 9 shows the production of P3Kan and P3Neo. FIG. 10 shows the production of mP12. FIG. 11 is a diagram showing confirmation of the gene insertion reaction by PCR (P1 + P2 reaction). FIG. 12 is a diagram showing confirmation by restriction enzyme cleavage of plasmid P12 obtained by transducing the product after P1 + P2 reaction into E. coli and sequence analysis of mutant loxP. FIG. 13 shows the confirmation of gene insertion reaction by PCR (P1 + P2′Cm). FIG. 14 is a diagram showing confirmation by restriction enzyme cleavage of plasmid P12′Cm obtained by transducing the product after the P1 + P2′Cm reaction into E. coli and sequence analysis of mutant loxP. FIG. 15 is a view showing confirmation of a gene insertion / replacement reaction by PCR (P1 + P2 + P3 reaction). FIG. 16 is a diagram showing confirmation by restriction enzyme cleavage of plasmid P123Kan obtained by transducing the product after the P12′Cm + P3Kan reaction into Escherichia coli and sequence analysis of the mutant loxP. FIG. 17 is a diagram showing a continuous gene insertion / substitution reaction (mP12 + P3 + P2) by a recombinant enzyme. FIG. 18 is a graph showing the results of gene insertion reaction (on a plasmid) in CHO cells. FIG. 19 is a photograph of CHO cells after the gene recombination replacement reaction (on the plasmid). A) P12 + P3, B) mP12 + 3 FIG. 20 is a graph showing gene insertion reaction efficiency (change in the amount of Cre expression vector) in the CHO / P1 cell line. FIG. 21 is a photograph of CHO / P1 (F11) cells after P2 insertion reaction on the chromosome. FIG. 22 is a head showing confirmation of insertion / replacement reaction in CHO / P1 (F11) cells by PCR. FIG. 23 is a photograph of CHO / P12 ′ cells after P3 recombination reaction on the chromosome.

Claims (7)

Recombinant enzyme Cre,
A gene recombination method using a spacer region and a Cre target site comprising a left arm region and a right arm region respectively arranged on the left and right sides thereof:
(A) Target site 1 consisting of spacer region 1, one arm region with mutation, and the other arm region that is wild-type, which has been introduced into the host chromosome;
(B) an integration cassette comprising a target site 2 and a target site 3 linked to both sides of gene 1 and gene 1, respectively.
At this time, the target site 2 is from the spacer region 1 and one arm region on the opposite side of the target site 1 that is mutated and close to the gene 1 and the other arm region that is a wild type. And the target site 3 is a spacer region 2 that can function independently of the spacer region 1, and one arm region that is mutated and is on the same side as the target site 1 and close to the gene 1 And consisting of the other arm region that is wild type; and
(C) a replacement cassette comprising a target site 4 and a target site 5 respectively linked to both sides of gene 2 and gene 2,
At this time, the target site 4 is composed of the spacer region 2, one arm region on the side opposite to the target site 1 having mutation and close to the gene 2, and the other arm region that is a wild type. In this case, the target site 5 is the spacer region 3 (however, the spacer region 3 is the same as the spacer region 1 or can function independently of each of the spacer regions 1 and 2), and the mutation site. Preparing one arm region on the same side as the target site 1 and close to the gene 2 and the other arm region that is a wild type;
(1) reacting the target site 1 and the embedded cassette with Cre to obtain a reaction product; and
(2) A gene recombination method for carrying out two or more recombination on a chromosome, comprising a step of reacting the reaction product with a replacement cassette by Cre,
One of the spacer regions 1 and 2 is
SEQ ID NO: consists of 10 of the nucleotide sequence,
The other of the spacer regions 1 and 2 is
SEQ ID NO: consists of 11 of the nucleotide sequence;
Left arm area of the mutation,
SEQ ID NO: 9 or is in Ranaru thing;
The right arm region with the mutation
SEQ ID NO: are those 1 2 or Ranaru;
The method wherein the wild type left arm region consists of the nucleotide sequence of SEQ ID NO: 8; and the wild type right arm region consists of the nucleotide sequence of SEQ ID NO: 13. Target site 1 consists of the nucleotide sequence of SEQ ID NO: 2;
Target site 2 consists of the nucleotide sequence of SEQ ID NO: 4;
The gene recombination method according to claim 1, wherein the target site 3 is composed of the nucleotide sequence of SEQ ID NO: 3; and the target site 4 is composed of the nucleotide sequence of SEQ ID NO: 5. In genetic recombination using the recombinase Cre,
A target site 1 consisting of a wild-type left arm region, a spacer region 1, and a mutant right arm region;
A target site 2 consisting of a mutant left arm region, a spacer region 1, and a wild type right arm region;
Target site 3 consisting of wild type left arm region, spacer region 2 that can function independently of spacer region 1, and mutant right arm region; and mutant left arm region, spacer region 2, and wild type right arm region Target site 4 consisting of
Are used in combination,
One of the spacer regions 1 and 2 is
SEQ ID NO: consists of 10 of the nucleotide sequence,
The other of the spacer regions 1 and 2 is
SEQ ID NO: consists of 11 of the nucleotide sequence;
Left arm area of the mutation,
Consists of 9;: SEQ ID NO
Right arm area of the mutation is,
SEQ ID NO: consists of 12;
The method wherein the wild type left arm region consists of the nucleotide sequence of SEQ ID NO: 8; and the wild type right arm region consists of the nucleotide sequence of SEQ ID NO: 13. Target site 1 consists of the nucleotide sequence of SEQ ID NO: 2;
Target site 2 consists of the nucleotide sequence of SEQ ID NO: 4;
The method of use according to claim 3, wherein the target site 3 is composed of the nucleotide sequence of SEQ ID NO: 3; and the target site 4 is composed of the nucleotide sequence of SEQ ID NO: 5. A kit for carrying out two or more recombination using a recombination enzyme Cre including one or more selected from the following:
A polynucleotide comprising the target site 1 consisting of a wild-type left arm region, a spacer region 1, and a mutant right arm region;
A polynucleotide comprising a target site 2 consisting of a mutant left arm region, a spacer region 1, and a wild type right arm region;
A polynucleotide comprising a wild-type left arm region, a spacer region 2 capable of functioning independently of the spacer region 1, and a target site 3 comprising a mutated right arm region; and a mutated left arm region, a spacer region 2 and wild A polynucleotide comprising a target site 4 comprising a type right arm region,
One of the spacer regions 1 and 2 is
SEQ ID NO: consists of 10 of the nucleotide sequence,
The other of the spacer regions 1 and 2 is
SEQ ID NO: consists of 11 of the nucleotide sequence;
Left arm area of the mutation,
Consists of 9;: SEQ ID NO
The right arm region with the mutation
SEQ ID NO: consists of 12;
The kit, wherein the wild type left arm region consists of the nucleotide sequence of SEQ ID NO: 8; and the wild type right arm region consists of the nucleotide sequence of SEQ ID NO: 13. Target site 1 consists of the nucleotide sequence of SEQ ID NO: 2;
Target site 2 consists of the nucleotide sequence of SEQ ID NO: 4;
The kit according to claim 5, wherein the target site 3 consists of the nucleotide sequence of SEQ ID NO: 3; and the target site 4 consists of the nucleotide sequence of SEQ ID NO: 5. A polynucleotide consisting of a Cre target site that is either:
A polynucleotide consisting of SEQ ID NO: 2;
A polynucleotide consisting of SEQ ID NO: 3;
A polynucleotide consisting of SEQ ID NO: 4; and a polynucleotide consisting of SEQ ID NO: 5.