CN110982838B - Method for changing rape seed fatty acid composition by using gene editing technology and application thereof - Google Patents

Abstract

S1, designing and screening target sequences of five base sites according to nucleotide sequences of brassica napus BnaSAD.C4, BnaSAD.A5, BnaSAD.A3 and BnaSAD.C3 genes, and designing primers aiming at the target sequences; s2, constructing a five-target gene editing vector pBnaSAD2 vector; s3, the pBnaSAD2 carrier is genetically transformed by the hypocotyl of the cabbage type rape as a receptor material to obtain a mutant with changed rape seed fatty acid composition, and the seed fatty acid composition of the mutant plant is obviously changed. The method provided by the invention can change the fatty acid composition of the rape seeds to different degrees, provides a new way for changing the fatty acid composition of the cabbage type rape seeds, provides a new germplasm resource, and has good application prospect.

Description

Method for changing rape seed fatty acid composition by using gene editing technology and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a method for changing the fatty acid composition of rape seeds by using a gene editing technology and application thereof.

Background

The rape is an important oil crop and edible plant oil source in China, the improvement of fatty acid of the rape is mainly developed from different purposes, the most concerned is to improve the oleic acid content of the rape and improve the quality of the rape, but few reports are made on the genetic improvement research on the fatty acid composition in the rape seeds, and the report on the mutation change of the fatty acid composition (C18: 0) of the rape seeds and the application of the fatty acid composition of the rape seeds by using a CRISPR/Cas 9-mediated gene editing technology to perform mutation on a cabbage type rape stearoyl desaturase (S-ACP-D) gene has not been made so far.

Disclosure of Invention

The invention provides a method for changing the fatty acid composition of rape seeds by using a gene editing technology and application thereof, aiming at the technical problems in the prior art. The method comprises the steps of firstly analyzing a brassica napus stearoyl desaturase (S-ACP-D) gene family according to an arabidopsis fab2 gene to obtain four copies of the gene in the brassica napus, and finally obtaining a mutant with changed seed fatty acid composition by carrying out precise site-specific mutagenesis on the four copies of BnaSAD by utilizing a CRISPR/Cas9 gene editing technology.

The technical scheme for solving the technical problems is as follows:

the invention provides a method for changing the fatty acid composition of rape seeds by using a gene editing technology, which comprises the following steps:

s1, designing and screening target sequences of five base sites according to the nucleotide sequences of the brassica napus BnaSAD.C4, BnaSAD.A5, BnaSAD.A3 and BnaSAD.C3 genes, and designing primers aiming at the target sequences;

s2, constructing a five-target gene editing vector pBnaSAD2 vector;

s3, pBnaSAD2 carrier is genetically transformed with hypocotyl of cabbage type rape as acceptor material to obtain rape seed with altered fatty acid composition.

Wherein the target sequences (5 '-3') of the five base sites are respectively shown in SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: 9. SEQ ID NO: 10.

wherein, the primer sequences of the target sequences are respectively shown in SEQ ID NO: 11. SEQ ID NO: 12. SEQ ID NO: 13. SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 16. SEQ ID NO: 17. SEQ ID NO: 18. SEQ ID NO: 19. SEQ ID NO: 20.

wherein the base sequence of BnaSAD.C4 copy is shown in SEQ ID NO:2 is shown in the specification; the base sequence of BnaSAD.A5 copy is shown as SEQ ID NO:3 is shown in the specification; the base sequence of BnaSAD.A3 copy is shown as SEQ ID NO: 4 is shown in the specification; the base sequence of BnaSAD.C3 copy is shown in SEQ ID NO: 5, respectively.

The step of constructing the five-target gene editing vector pBnaSAD2 in the step S3 of the invention comprises the following steps:

a. preparing a target spot joint;

b. connecting and amplifying a target joint primer and an sgRNA expression cassette;

c. connecting a target sgRNA expression cassette with a pYLCRISPR/Cas9 vector;

d. transforming escherichia coli, selecting positive clones, and performing sequencing verification to obtain a final vector;

e. the successfully ligated vector was transferred into competent Agrobacterium GV3101 cells to obtain the pBnaSAD2 vector Agrobacterium strain.

Wherein, the BnaSAD.C4, BnaSAD.A5, BnaSAD.A3 and BnaSAD.C3 genes are obtained by performing gene family analysis according to arabidopsis fab2 genes.

The invention also provides the application of the method for changing the fatty acid composition of the rape seeds by using the gene editing technology in rape breeding.

The invention has the following beneficial technical effects:

the invention obtains four copies of BnaSAD2 gene in cabbage type rape through gene family analysis; provides target sequences T1, T2, T3, T4 and T5 of a CRISPR/Cas9 system capable of changing the fatty acid composition of rape seeds, the five targets can accurately edit four copies of a BnaSAD2 gene at fixed points, and the fatty acid composition of the rape seeds can be changed by a CRISPR/Cas9 mediated gene editing technology. The invention provides a new way for changing the fatty acid composition of the brassica napus seeds, provides new germplasm resources and has good application prospect.

Drawings

FIG. 1 is a diagram showing the result of PCR positive detection and identification of mutant plants;

FIG. 2 is a diagram showing the result of PCR editing of a positive individual.

FIG. 3 is a schematic diagram of the pBnaSAD2 vector.

Detailed Description

The present invention is described below with reference to specific embodiments, which are provided for illustration only and are not intended to limit the scope of the present invention.

The reagents used in the present invention are commercially available, and the vectors and plasmids used are known and used in the art.

The media involved in the following examples are as follows:

LB medium (1L): 10g of peptone, 5g of yeast extract, 10g of sodium chloride, 15g/L of agar in a solid culture medium, autoclaving at 121 ℃ for 20min, and storing in a refrigerator at 4 ℃ for later use.

DM (100 ml): MS 0.44g, sucrose 3g, constant volume, adjusting pH to 5.84-5.88, sterilizing, and adding 100 μ l antibiotic AS (100 μm) when cooling rapidly.

M0(100 ml): 1/2MS 0.22g, sucrose 3g, constant volume, adjusting pH to 5.84-5.88, adding Agar 0.7g, and sterilizing.

M1(500 ml): MS 2.2g, sucrose 15g, Mannitol 9g, 2,4-D (1mg/L)0.5ml, KT (0.3mg/L)0.5ml, constant volume, pH 5.84-5.88, Agar 3.5g, sterilizing, and adding antibiotic AS (100 μm)500 μ L when used in quick cooling.

M2(500 ml): MS 2.2g, sucrose 15g, Mannitol 9g, 2,4-D (1mg/L)0.5ml, KT (0.3mg/L)0.5ml, constant volume, pH 5.84-5.88, Agar 3.5g, sterilization, STS 75 μ L in quick cooling, TMT (300mg/ml)0.5ml, and hygromycin B (25mg/ml)250 ul.

M3(500 ml): MS 2.2g, glucose 5g, xylose 0.125g, MES 0.3g, constant volume, pH 5.84-5.88, Agar 3.5g, sterilizing, adding trans-Zeatin (2.0mg/L)0.5ml, IAA (0.1mg/L)0.5ml, TMT (300mg/L)0.5ml, AgNO 375. mu.l, and hygromycin B (25mg/ml) 250. mu.l when used in quick cooling.

M4(500 ml): MS 4.4g, sucrose 5g, constant volume, pH 5.84-5.88, Agar 3.5g, sterilizing, and adding TMT (300mg/L)0.5ml when cooling.

STS:[Ag(SO₃)₂]3-mix immediately before use, precipitate after too long.

Mother liquor:

sodium thiosulfate, 0.1M (1.58g in 100ml ddH)₂O)；AgNO₃0.1M (1.7g in 100ml ddH)₂O)

V_Na2SO3:V_AgNO3AgNO3 was dissolved in sodium thiosulfate 4: 1.

2, 4-D1 mg/mL mother liquor, 0.25g 2,4-D a little 95% alcohol and 1M NaOH solution were added to make a volume of 250 mL.

KT:0.03gKT was dissolved in 1MHCL and water was added to make a volume of 100 mL.

100mmol/L of mother liquor of AS, 0.392g of AS is firstly dissolved in a small amount of methanol, and then dimethyl sulfoxide is added to the solution to obtain a constant volume of 20 mL.

TZ, trans-Zeatin (Zeatin), 2mg/mL mother liquor, namely 0.04gTZ, is dissolved in a small amount of 75% alcohol, and water is added to the solution to reach a constant volume of 20 mL.

IAA 0.1mg/mL, 100mg IAA dissolved in a small amount of 95% ethanol, and ddH₂And (4) metering the volume of O to 100mL, performing suction filtration, subpackaging and storing at-20 ℃.

Example 1 Brassica napus.DELTA.9 Stearoyl ACP Dehydrogenase (SAD) Gene homology Gene analysis

The fab2 gene coding sequence was obtained from the Arabidopsis TAIR database (https:// www.arabidopsis.org /); blast alignment of the coding sequence of the fab2 gene with the reference genome Darmor-bzh: (http:// www.genoscope.cns.fr/brassicanapus/Chalhoub et al 2014), selecting an alignment result with the similarity of more than 90% and the expectation value of 0 as a candidate gene for further research, and finally obtaining four copies of BnaSAD.C4, BnaSAD.A5, BnaSAD.A3 and BnaSAD.C 3. The base sequence of the arabidopsis fab2 gene is shown as SEQ ID NO: 1 is shown in the specification; the base sequence of BnaSAD.C4 copy is shown in SEQ ID NO:2 is shown in the specification; the base sequence of BnaSAD.A5 copy is shown in SEQ ID NO:3 is shown in the specification; the base sequence of BnaSAD.A3 copy is shown in SEQ ID NO: 4 is shown in the specification; the base sequence of BnaSAD.C3 copy is shown in SEQ ID NO: 5, respectively.

Example 2 obtaining of mutant Material

First, screening target point sequence and designing primer

Four copies of nucleotide sequences of BnaSAD genes BnaSAD.C4, BnaSAD.A5, BnaSAD.A3 and BnaSAD.C3 of the brassica napus are obtained from a reference genome Darmor-bzh, targets are designed by using online software CRISPR-P (http:// cbi.hzau.edu.cn/cgi-bin/CRISPR2/CRISPR), four targets in total, namely T1, T2, T3, T4 and T5, are screened (table 1), and primers are designed according to the target sequences (table 2).

TABLE 1 target sequences

TABLE 2 target primer sequences

Second, construct five target gene editing vector pBnaSAD2 vector

The preparation of the five-target gene editing vector pBnaSAD2 comprises the following steps:

(1) preparing a target joint: the target primer sequences (adapter primers) of Table 2 were substituted with ddH₂Dissolving O into 10. mu.M mother solution, adding 1. mu.l of each of the left and right primers to 8. mu.l of ddH₂Diluting to 1 μ M, mixing with vortex, shaking, adding into water bath at 90 deg.C, processing at 30 ″, and naturally cooling to room temperature.

(2) sgRNA expression cassette ligation reaction

1. The five plasmids of Lacz-AtU3d, AtU3d, AtU3b, AtU6-1 and AtU6-29 are subjected to enzyme digestion, the enzyme digestion system is shown in Table 3, and the enzyme digestion is carried out at room temperature for 15-20 min.

TABLE 3 plasmid digestion System

2. The five digested Lacz-AtU3d, AtU3d, AtU3b, AtU6-1 and AtU6-29 plasmids and each corresponding linker are subjected to ligation reaction, the ligation reaction is carried out for about 10-15min at room temperature (20-28 ℃), the plasmids and each corresponding linker are shown in Table 4, and the ligation reaction system is shown in Table 5.

TABLE 4 plasmids and respective linkers

Joint	Bas1 enzyme cutting plasmid
		T1	Lacz-AtU3d
T2	AtU3d
		T3	AtU3b
T4	AtU6-1
		T5	AtU6-29

TABLE 5 expression cassette ligation reaction System

Composition (I)	Amount of addition	Final concentration (amount)
			10×T4 DNA ligase Buffer	1μl		1×
pYLsgRNA-U # plasmid (Bas1)	0.5μl	10～20ng
			Target point joint	0.5μl	0.05μM
T4DNA ligase(NEB)(400U/ul)	0.1μl	～40U
			ddH2O	7.9μl
total	10μl

3. Amplifying the sgRNA expression cassette fragment: 2 nested PCR rounds are carried out, 2 reactions are carried out in the first round of PCR, and U-F/joint reverse primers and joint forward primers/gR-R are respectively used; the second round was overlappingPCR, and the expression cassette products were amplified using site-specific primers, the sequences of the primers used are shown in Table 6, the reaction system of the first round is shown in Table 7, and the reaction procedure is shown in Table 8. After the first round of reaction, 1. mu.l of each of the products of reaction 1 and reaction 2 was diluted by adding 8. mu.l of ddH2O, and vortexed and shaken to mix. Second round PCR, method of use of sgRNA expression cassette specific position primer pairs: Pps-GGL/Pgs-GG2(PT1), Pps-GG2/Pgs-GG3(PT2), Pps-GG3/Pgs-GG4(PT3), Pps-GG4/Pgs-GG5(PT4), Pps-GG5/Pgs-GGR (PT5R), and amplifying corresponding U # -T1-gRNA, U # -T2-gRNA, U # -T3-gRNA, U # -T4-gRNA and U # -T5-gRNA. Each primer was first dissolved in ddH2O to 10. mu.M stock solution. 1.5. mu.l of each of the primers Pps-GGL and Pgs-GG2 was added to 7. mu.l of ddH2O, diluted to 1.5. mu.M, and vortexed and shaken to mix them, and the mixture was named PT 1. PT2, PT3, PT4 and PT5R are sequentially configured; the reaction system is shown in Table 9, and the procedure is shown in Table 10.

TABLE 6 nested PCR primer sequences

TABLE 7 first round PCR reaction System

Composition (I)	Amount of addition
		sgRNA ligation products	0.5μl
10UM U-F/gR-R	0.3μl
		10UM T-R/T-F	0.3μl
2mM dNTP	1.5μl
		25mM MgSO4	0.6μl
10*Buffer	1.5μl
		KOD plus	0.3μl
ddH2O	10μl
		total	15μl

TABLE 8 first round PCR reaction procedure

TABLE 9 second round reaction System

TABLE 10 second round reaction procedure

4. And (5) purifying the nested PCR product. Mixing the five products of the second reaction, and purifying the PCR product by using EasyPure Quick Gel Extraction Kit of Beijing all-terrain gold biotechnologies; the concentration was measured spectrophotometrically and was 25 ng/. mu.l, and 75ng, corresponding to 3. mu.l, was required for the test.

5. And carrying out enzyme digestion and connection reaction on the binary vector and the sgRNA expression cassette. The reaction system is shown in Table 11, and the reaction procedure is shown in Table 12.

TABLE 11 restriction enzyme ligation reaction System of binary vector and sgRNA expression cassette

Composition (I)	Volume of	Final concentration (amount)
			10×T4 DNA ligase Buffer	1.5μl	1×
PYLCRISPR/CAS9 35S-H	4ul	80ng
			Nested PCR products	3ul	75ng
Bas1	1μl	10U
			T4 DNA ligase(NEB)(400U/ul)	0.1μl	35U
ddH2O	Make up to 15. mu.l
			Total	15μl

Table 12 restriction ligation procedure for binary vectors and sgRNA expression cassettes

6. And E.coli sequencing to determine the ligation product. The operation steps are as follows:

a. mu.l of Trans1-T1 Phage resist chemical composition Cell Competent cells thawed on ice bath were taken, 10. mu.l of the ligation product was added, gently mixed and placed in ice bath for 30 minutes.

b.42 ℃ Water bath Heat shock for 30 seconds, then quickly transfer the tube into an ice bath for 2 minutes without shaking the centrifuge tube.

c. Mu.l of sterile liquid LB medium (containing no antibiotics) was added to each tube, mixed well and then placed on a shaker at 37 ℃ for 1 hour at 200rpm to resuscitate the bacteria.

d. 50. mu.l of the transformed competent cells were pipetted onto an agar medium containing LB (25g/L) and the cells were spread out uniformly. The plate was placed at 37 ℃ until the liquid was absorbed, inverted and incubated overnight at 37 ℃.

e. Selecting a single clone, carrying out PCR positive identification, and carrying out the following system, program and primer:

PB-L: GCGCGCgGTctcGCTCGACTAGTATGG (see SEQ ID NO: 33)

PB-R: GCGCGCggtctcTACCGACGCGTATCC (see SEQ ID NO: 34)

TABLE 13 PCR Positive identification System and program

f. And selecting positive clones for sequencing, and determining that the pBnaSAD2 plasmid has no mutation and can be used for subsequent experiments.

7. The constructed vector is transferred into agrobacterium GV3101 electroconceptive cell. The method comprises the following specific steps: a tube of 50 mul GV3101 electroconceptive cells is placed on ice, after melting, 0.1 mug of constructed vector plasmid is added, and the mixture is gently sucked and beaten by a pipettor and evenly mixed; the competence containing the vector plasmid was pipetted into an ice-precooled electroporation cuvette and electrically shocked at 1800V for 6ms using a Gene pulser electroporation apparatus (available from Bio-Rad, Inc.); adding 500 mul of liquid LB into an electric rotating cup, uniformly mixing, transferring the bacterial liquid into a 2mL centrifuge tube, and culturing for 2hrs in a shaking table at 28 ℃ and at 150 rpm; spreading 100 μ l of the bacterial liquid on a solid LB plate (containing gentamicin 25 μ g/ml and kanamycin 50 μ g/ml), drying, and culturing in an incubator at 28 ℃ for 2-3 days; selecting bacterial plaque to carry out PCR detection, carrying out shake culture and split charging on positive clones at-80 ℃ for storage or directly using the positive clones for plant transformation, and obtaining the pBnaSAD2 vector agrobacterium strain.

Genetic transformation of hypocotyl of pBnaSAD2 vector

(1) Sterilization

a. Soaking mature seeds of A9707 in 75% alcohol for 1 min;

b. transferring the washed seeds into a sterile container (culture box), pouring alcohol into a waste liquid tank, adding an appropriate amount of disinfectant (84 disinfectant concentration sterile water: 84 liquid: 1), and sterilizing for 10-15 min;

c. after disinfection, the disinfectant is poured into a waste liquid tank, and the seeds are washed for 4-5 times by sterile water (about 50 ml).

(2) Seeding

a. Sowing the sterilized seeds on an M0 culture medium by using sterile forceps, wherein each dish contains 10-12 seeds;

b. the petri dish was placed in a sterile culture box and incubated in dark at 24 ℃ for 6 days.

(3) Shake the fungus

4-5 days after sowing, the pBnaSAD2 vector Agrobacterium strain was cultured in LB liquid medium (Kanamycin 50mg/L + Gentamicin 25 mg/L). The culture was carried out at 28 ℃ and 180 ℃ for about 15 hours on a shaker at 220 rpm. The OD value of the cultured broth is preferably about 0.4 (using a sterile flask or a centrifuge tube, 10/15. mu.l of the broth with two concentrations and 4ml of LB are prepared).

(4) Preparation and dip dyeing of explants

a. Preparing bacterial liquid, namely sucking 2ml of cultured strains into a sterile 2ml centrifuge tube, centrifuging the strain in a centrifuge at 6000rpm for 3min, and pouring off the supernatant; resuspending once with DM (plus AS) of the same volume AS the bacterial solution, centrifuging under the same conditions, discarding the supernatant, suspending with DM (plus AS) of the same volume, and diluting the suspended bacterial solution with 18ml DM (in a sterilized petri dish);

b. cutting the explant, and cutting hypocotyls of the seedling 6 days after sowing with sterile forceps and dissecting knives, each length of 0.8-1.0 cm. The cutting effect in the M1 liquid culture medium is better, and the explant is cut vertically as soon as possible when cut;

c. placing the cut explant into a culture dish with prepared bacterial liquid with concentration, dip-dyeing for 15min (the time cannot be overlong, the explant is prevented from being seriously dead due to water loss or the agrobacterium can not be inhibited in the later period), shaking once at intervals, and sucking the bacterial liquid when the difference is 3 min. During the impregnation, 150-200 explants per dish (20ml of bacterial solution) are suitable;

(5) the infected explants are blotted dry with sterilized filter paper, transferred to M1 culture medium by tweezers, and transferred to M2 after 50-60 explants per dish are cultured in the dark at 24 ℃ for 2 days, and cultured in the white light at 24 ℃ for 16 h/8 h in the dark.

(6) After 20 days, the cells were transferred to M3 and subcultured every 20 days until green shoots appeared.

Transferred into M4 to take root, the rooting time is 2-4 weeks. Transplanting the seedlings into a greenhouse plug tray after the roots grow, covering a plastic film to prevent excessive water loss in the early stage, and uncovering the film after one week. And finally, moving to a field for growing according to the climate.

Fourthly, obtaining mutant plants

(1) Extracting plant leaf DNA by a CTAB method, amplifying by using a specific sequence primer on a carrier for positive detection, and detecting a product by using 1% agarose gel electrophoresis. The reaction system is carried out on a PCR amplification instrument, and the PCR amplification reaction system comprises the following steps:

TABLE 14 mutant plant PCR positive identification system and program

The primer sequences were as follows (5 '-3'):

PB-L: GCGCGCgGTctcGCTCGACTAGTATGG (see SEQ ID NO: 33)

T1-R: AAACGATGGTACTGTGGTGGCGT (see SEQ ID NO: 12)

The detection results are shown in figure 1, wherein CK1 is a positive control, and CK2 is a negative control.

(2) And (5) editing and detecting. And editing and detecting the detected positive single plants by adopting 15% non-denaturing PAGE gel, and judging whether the editing occurs or not according to polymorphism. The reaction system is performed on a PCR amplification instrument, the PCR amplification reaction system and the primers are as follows, and partial results are shown in FIG. 2:

TABLE 15 Positive individuals PCR identification System and program

TABLE 16 PAGE detection of copy and target-corresponding primers

(3) Selecting single strain TA clone with polymorphism in PAGE result, sequencing and verifying, and the steps are as follows:

preparation of PCR products:

a. the following reaction systems were prepared in sterile PCR tubes for amplification, and the primer sequences are shown in Table 17:

TABLE 17 PCR reaction System

The program of the PCR reaction system is set to denature for 3min at 98 ℃; 15sec at 98 ℃, 15sec at 59 ℃, 30sec at 72 ℃, 34 cycles; 5min at 72 ℃; 10min at 25 ℃.

TABLE 18 amplification of 4 copies of primer sequences

b. Sucking 4ul of PCR product to detect the quality of the product by horizontal gel. If the amplification product has multiple bands, gel recovery of the target fragment is recommended.

c. Then, the target gene fragment is ligated into a PEASY-Blunt vector according to the PEASY-Blunt Simple Cloning kit instruction, and a sequencing intermediate vector is constructed and delivered to sequencing companies for sequencing.

Cloning reaction

1) Sequentially adding 1ul of PEASY-Blunt Simple cloning Vector into a micro-centrifuge tube, adding 4ul of PCR products (which can be properly increased and decreased according to the amount of the PCR products and does not exceed 4ul at most), gently mixing, reacting for 5 minutes at room temperature (27-37 ℃), and placing the centrifuge tube on ice after the reaction is finished.

2) The ligation product was added to 50ul Trans1-T1 competent cells (ligation product was added just after thawing the competent cells), mixed gently, ice-bathed for 20-30 min, heat-shocked in a water bath at 42 ℃ for 30sec, and immediately placed on ice for 2 min. Mu.l of LB medium equilibrated to room temperature was added, and the mixture was incubated at 37 ℃ for 1 hour at 200 rpm. 50 μ l of the aspirated and shaken bacterial solution (depending on the length of the connecting piece) was uniformly spread on an LB plate containing 50 μ g/mL Kan resistance, and cultured overnight in an incubator at 37 ℃ (for more clones, centrifugation was carried out at 4000rpm for 1min, a portion of the supernatant was discarded, 150 μ l of the supernatant was retained, the cells were suspended by flicking, and the whole bacterial solution was spread on a plate).

PCR identification of positive clones by bacterial liquid:

1) white single clones were picked into 10ul of sterile water and vortexed.

Taking 2ul of mixed solution to 20ul of PCR system, using M13F/M13R universal primer, setting PCR program as denaturation at 94 ℃ for 6 min; 30sec at 94 ℃, 1min at 59 ℃, 30sec at 72 ℃ and 35 cycles; 10min at 72 ℃; 10min at 25 ℃. Positive clones were identified by 1% agarose gel electrophoresis.

2) And (4) selecting positive clone bacteria liquid for sequencing. Sequencing was performed with the M13F/M13R universal primer. And after the sequencing is finished, comparing the sequencing result with the sequence analysis corresponding to the wild type by using the sequencher for analysis.

(4) Obtaining mutant plants

The BnaSAD2 gene is edited and detected in positive plants of the T0 generation strain to obtain mutant single plants.

Example 3 rape mutant plant seed fatty acid composition determination

The mutant plants obtained in example 2 were selfed and added to obtain homozygous mutant plants. The mutant seed fatty acid composition was determined as follows:

preparation of a sample:

1) each line was picked 3 individuals, each individual was randomly picked about 25 filled seeds, ground to powder in a 10mL test tube using a mortar, and wild type A9707 seeds were selected as above.

2) 1mL of anhydrous ether was added: petroleum ether (1:1) mixture and equal volume of potassium hydroxide-methanol solution (0.5mol/L) (500ml formaldehyde +11.2g potassium hydroxide) were allowed to stand at room temperature for 60 min.

3) Adding ultrapure water to constant volume of 10mL, standing for 10min, and adding 500-600 μ L into a sample bottle for determination.

4) The program was run directly on an autosampler gas chromatograph manufactured by agilent.

Setting parameters of a gas chromatograph: agilent HP7890A, wherein the detector is a hydrogen flame ionization detector, the sample injection is carried out automatically at 1 μ L, the split ratio is set to 1:45, the temperature of the detector is 250 ℃, the temperature of the sample injection chamber is 280 ℃, and the carrier gas is N₂Flow rate of 30mL/min, tail blowing of 40mL/min, H₂The speed is 30mL/min, the air flow rate is 300mL/min, the furnace temperature is set to be continuously increased, the temperature is kept at 180 ℃ for 2min, and then the temperature is increased to 220 ℃ at 10 ℃/min and kept for 7 min. The fatty acid component is gasified with each fatty acidThe later peak-off time is compared with the standard fatty acid peak-off time to determine, the fatty acid content is represented by the peak area percentage, and the detection results are shown in the following table:

TABLE 19 comparison of fatty acid content in mutant and wild-type material A9707

Fatty acids	First 9707	BnaSAD2-26	BnaSAD2-163	BnaSAD2-158	BnaSAD2-65
						16:0	4.08	5.6±0.1**	4.1±0.1*	4.8±0.0**	4.6±0.0
18:0	2.1±0.2	3.7±0.1**	12.0±0.2**	11.0±0.1**	10.5±0.1**
						18:1	67.6±1.3	64.5±0.4*	47.4±0.5**	49.9±0.0**	51.7±0.0**
18:2	17.26±1.09	18.81±0.3	24.6±0.4**	24.1±0.0**	20.5±0.0*
						18:3	7.4±0.6	5.8±0.1*	9.5±0.1**	8.1±0.3	10.7±0.3**
20:0	0.6±0.1	0.7±0.0*	2.1±0.1**	2.0±0.0**	1.5±0.1*

Note: represents significant differences between the two treatments, represents very significant differences between the two treatments

The results show that in the BnaSAD2 mutant (Table 19), the content of palmitic acid (C16: 0) in the seeds can reach up to 5.6% + -0.1%, and compared with the wild-type material A9707, the P value is 0.004401; the content of seed stearic acid (C18: 0) in the mutant reaches 12.0% + -0.2%, the content of wild type material A9707 stearic acid under the same condition is 2.1% + -0.2%, the extremely significant difference is reached, and the P value is 0.000850821; the oleic acid content of seeds (C18: 1) in the mutant is reduced to 47.4% + -0.5%, the oleic acid content of a wild type material A9707 under the same condition is 67.6% + -1.3%, a significant difference is achieved, and the P value is 0.00027645; the content of linoleic acid (C18: 2) in the mutant can reach 24.6% + -0.4%; the linolenic acid content of seeds (C18: 3) in the mutant reaches 10.7% + -0.3%, the linolenic acid content of a wild type material A9707 (C18: 3) under the same condition is 7.4% + -0.6%, the significant difference is achieved, and the P value is 0.022775026; seed C20 in the mutant: 0 content up to 2.1% + -0.1%, wild type material A9707C 20 under the same conditions: the 0 content is 0.6% + -0.1%, a significant difference is achieved, and the P value is 0.000067.

Test results prove that after the site-directed mutagenesis is carried out on the Brassica napus BnaSAD2 gene, the fatty acid composition of the Brassica napus seed can be obviously changed.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> university of agriculture in Huazhong

<120> a method for changing rape seed fatty acid composition by using gene editing technology and application thereof

<160> 58

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1206

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thalina)

<400> 1

atggctctaa agtttaaccc tttggtggca tctcagcctt acaaattccc ttcctcgact 60

cgtccgccaa ctccttcttt cagatctccc aagttcctct gcctcgcttc ttcttctccg 120

gctctcagct ccggccccaa gtcagttgag agtttgaaga aaccatttac gccacccagg 180

gaagtgcatg ttcaagtctt gcactccatg ccacctcaaa agatcgagat cttcaaatct 240

atggaaaact gggccgagga gaaccttctg attcacctca aggatgtgga gaagtcttgg 300

caaccccagg atttcttgcc tgaccctgca tcagatgggt ttgaagatca ggtaagagag 360

ttaagagaga gggctagaga gctccctgat gattactttg ttgttttggt gggggacatg 420

atcacagaag aagcacttcc gacctatcaa actatgttga acactttgga tggagttagg 480

gatgaaacag gtgctagtcc tacttcatgg gctatttgga ccagagcttg gactgcagaa 540

gaaaaccgac atggcgatct tctgaataaa tacctttact tgtctggtcg tgttgacatg 600

aggcagatcg aaaagaccat tcagtacttg attggatctg gaatggatcc gcggacagag 660

aataacccct accttggctt catctatacg tcattccaag aaagagcgac attcatctct 720

cacggaaaca cagcccgcca agccaaagag cacggggaca tcaaactagc ccaaatatgt 780

ggcacaatag ctgcagacga gaagcgtcat gaaacagcat acaccaagat agttgaaaag 840

ctctttgaga ttgatcctga tggtactgtc atggcttttg cagacatgat gagaaagaaa 900

atctcaatgc ctgctcactt gatgtatgat gggcgcaacg acaacctctt tgacaacttc 960

tcttccgtgg ctcagaggct cggtgtttac accgccaaag actatgcaga cattcttgag 1020

tttctggttg gtaggtggaa aatccaggac ttaaccgggc tttcaggtga aggaaacaaa 1080

gcacaagact atttatgcgg gttggctcca aggatcaaga gattggatga gagagctcaa 1140

gcaagagcca agaaaggacc caagattcct ttcagttgga tacacgacag agaagtgcag 1200

ctctaa 1206

<210> 2

<211> 2806

<212> DNA

<213> Brassica napus BnaSAD.C4(Brassica napus)

<400> 2

agactcttcc cttcacaccg ctgtttctca taaccatatt ctctttctgt ggacgaaact 60

caaccttaat aaaccagaga gaccgagaga tagcgagaga caagattagc ccagacagag 120

agctcttgtc tctgaaagaa cgtcaaacct tcaaaaaatg gcattgaagt ttaatccttt 180

ggtatctcgg ccatgcaaac tcgcttcctc ggctcgtccg ccagtctcta ctttcagatc 240

tcccaagttc ctctgcctcg cttcttcttc ttctcctgcc ctcagctcca agtatctctc 300

tctctctctc tctctccctc catcctcctg tttcatttct taataatata cttttaccga 360

ttgtccacaa gagatttggt cccttgctat cactttgttt ctgggtttag cttgtttgtt 420

cggttatcga tctatgttct gtcgacttta gctcaatgta ttgcttacct cacatttgct 480

taatgttatt atcaatggat gtgctttcaa tctggatggg accatcttct gttattctct 540

gtcttggccc cattgattca tcaattcaat gctctccttt cttaatctaa ttattctgag 600

atagattgct ccatggtgta tccgtttacc atcataatta tgagctttta gattgctttt 660

gagagacatg gaacaagtga cttcaacatg cttcttctta cactattcct gaattctctg 720

atatttcttc ttgttcaaaa aataaaaatt aaaaattcaa atcttttgat gtttattgta 780

taattctttc tttaatattt tgacgatgtc cacttgttgc tttactcatt tgatgagttt 840

tttttttgct gttgttgcat tgagagggag ggttcttgaa catatcagtt tatgttacgt 900

tggatgttat agagagaaga catgcatgcg tacttcgtgg cctcctctct aatagtttcc 960

gtccaaaact ttcactcttt cctcttgtaa tatgtgttca ctctcttttg aaaaaaaaaa 1020

aaacacattt ggcttttttt ttttatcttg tttctatctg attttgtctc tctagtacat 1080

tgaactgcaa cattgattcg tagattgtct agttgtttct cttcaatatg tggattaatc 1140

tattaagaga tgtagaacat gaatgcttat ccaaattcag tcaaaagtgt tcttgtttct 1200

tctgtctaca tcagaaacat taccttttca aacgctgatg ccaccttcct ttggtttgat 1260

gcagggaggt cgagagcttg aagaagccat tcaccccacc aagggaagtc caccttcaag 1320

tcctgcactc catgccaccc caaaagatcg aaatcttcaa atccatggaa gactgggccg 1380

agcacaacct cctacctcac ctcaaagacg tggagaagtc atggcagccc caggacttct 1440

tacccgaccc tgcttccgac gggttcgaag atcaggtaaa agagctaaga gaaagagcaa 1500

gagagctccc agatgattac ttcgttgtct tggttggaga catgatcaca gaagaagcgc 1560

ttcccaccta ccaaacaatg ttgaacactt tggatggagt aagggatgag actggcgcta 1620

gccccacttc atgggccgtt tggactagag cttggaccgc tgaagagaat cgccacggtg 1680

atcttctcaa taagtatctt tacttgtctg gtcgtgttga catgaggcag attgaaaaga 1740

ctattcagta cctgattggt tccggaatgg tgagagcata gtttcagaaa cattatcttt 1800

tgtttgactt tctaattcgc tttgttgact ttcacaggat ccacgcacag agaacaaccc 1860

ttaccttggc ttcatctaca cttcattcca agagagagcc accttcgtct ctcacggcaa 1920

cacagctcgc caagccaaag agcacggaga cctcaagcta gcgcaaatct gcggcacaat 1980

agctgcagac gagaagcgtc atgaaacagc ttacaccaag atagttgaga agcttctcga 2040

gattgatcct gacggcaccg tggtggcctt tgcggatatg atgaggaaga aaatctcgat 2100

gcctgctcac ttgatgtacg atgggcgtga tgataacctc tttgacaact tctcctcggt 2160

tgctcagagg cttggtgttt acactgctaa agactatgcg gacattcttg agtttttggt 2220

cgggaggtgg aagatagaga gcttgagtgg gctttcgggt gaaggaaaca aagcgcaaga 2280

gtatttgtgt gggttgactc cgagaatcag gaggttggat gagagagctc aagcaagagc 2340

caagaaagga cctaagattc cattcagctg gatacatgac agagaagtgc agctctgaac 2400

acaaaggaca aaagacataa taaaaccatt ttctctctct ctctctccgt tccttatttg 2460

atctgtctgc tcttgaagtt ggtgtagatt actatggttt cctgataatg ttcgttggtc 2520

tagttacaaa gttgagaagc agtgtcttag taactttgtg tctttctttc agtgacttat 2580

gttttgtctt ttagtaaact tctggtagtt aaaaacagtt gagcgttttg ggtctgtact 2640

cagttttcac tgtggagttt tgttttagtt gaagttagtt tttgtgtgtt ctctctgctt 2700

ttcctctgtt tctatatgaa tgatatacca atgtactcaa aagacagtgt gtgaatctgt 2760

ggaacagcaa tatatttgct gttttggcta ctagtgatgg tgttaa 2806

<210> 3

<211> 2965

<212> DNA

<213> Brassica napus BnaSAD.A5(Brassica napus)

<400> 3

cgagtgtaga ctcttccctc aaaccgctgt ttctcataac catattctct ttctgtggac 60

gaaactcaac cttaagagac cagagagagc attagcctag agagagctcg ctcgtgtctg 120

aaagaacatc aaacctcgta tcaaaaaaaa gaaaatggca ttgaagctta accctttggc 180

atctcagcct tacaaactcc atacctcggc tcgtccgcca atctctactt tcagatctcc 240

caagttcctc tgcctcgctt cctcttcttc ccctgctctc agctccagca ccaagtctgt 300

ctctttctct ctctctctat cctcttgttt catttgcaaa gtatctgctt ttaccgattg 360

tgtgttttgg gttttgcttg tttgttcggt tatggatcta tgttctgtca atgttagctc 420

aatcaaagga tttgcctttt aatctggggt ctagtgatta ctgatgaggc catcctctgt 480

tattctctgt ctcatgccat tgattttcat caatgctcct atcttgaatc tgattcgttt 540

attaatctac acgatccaga tgacaacatc gtaacattat agattcattc acgtttacag 600

tttctctgag attgattgct ccaatgtata taatcttttg cctttaggat cataactatt 660

ctgcatcata acactttcta ttatctttag tttgcttaat agacattgaa gaaagtgact 720

tcaaaatgct tcttagttaa aatccttata tcctctctta ttagtatatt acttcctctt 780

gcaaaaaaaa aaaaaaaaaa atcaatcttt tgatgtttat ttttatagtt ttttattgtt 840

tatataaaaa ttcaatcttt tgatgtttat tttctactag tttttttttt ttgtttgttt 900

atattttgac gatgaagtgc atgtccactt gttgcttact catgtgatga gttttttttg 960

tgcattgttc ttgagtttat gtttgtattc tttcttgaac gacattacgt tgaacgttat 1020

agagaagaca tgcatgcgta cttcgtggcc tctctctata gtttccgtcc aaaagtttca 1080

ctcttttctt ttaatatgtt cactctcttt tgaaaaaatg acatttggct ttttatcttg 1140

tctctatctg atttgtctct ctaccttgaa cattgaactg cgaaactgat tcataggtgc 1200

atgtataagg agttctagat gttcatcggt cactaattat cgaattgtgt ctctttaatg 1260

tgtggattaa tctgtttaga gatgtagaac atgaatgctt atccaaatgc aatcaaaagt 1320

gttcttgttt cttctgtgca catcagaaac attacctttt aaaatgctga tgataccttt 1380

ctttggtttg atgcagggag gtcgagagtc tgaagaagcc attcacccca ccaaaggaag 1440

tccacgttca agtcctgcac tccatgccac cccaaaagat cgaaatcttc aaatccatgg 1500

aagactgggc cgagcacaac ctcctacctc acctcaaaga cgtggagaag tcatggcagc 1560

cccaggactt cttaccggac cctgcttccg acgggttcga agaccaggta aaagagttaa 1620

gagaaagagc aagagagctc ccagatgatt acttcgttgt cttggtgggt gacatgatca 1680

cagaagaagc gcttcccacc tatcaaacaa tgctgaacac tttggatggt gtaagggatg 1740

agactggtgc tagccccact tcatgggccg tttggactag agcttggact gctgaagaga 1800

atcgccacgg tgatcttttg aataagtatc tttacttgtc tggtcgtgtt gacatgaggc 1860

agattgagaa gactattcag tacctgattg gttccggaat ggtgagagat tagtttcaga 1920

caattatctt tacttcatca gttactaatt cgctttgttg actttcacag gatccacgca 1980

cagagaacaa cccttacctt ggcttcatct acacctcatt ccaagaaaga gccaccttcg 2040

tctctcacgg caacacagct cgccaagcca aagagcacgg agacctcaag ctagcccaaa 2100

tctgcggcac aatagctgca gacgagaagc gtcacgagac agcttacacc aagatagttg 2160

agaagcttct tgagattgat cctgacggca ctgtggtggc ctttgcggat atgatgagga 2220

agaaaatctc gatgcctgct cacttgatgt acgatgggcg tgacgacaag ctctttgaca 2280

acttctcctc cgtggctcag aggcttggtg tctacactgc taaagattat gcggacattc 2340

ttgagttctt ggtcgggagg tggaagattg agagcttgag tgggctttcg ggtgaaggaa 2400

acaaagcgca ggagtatcta tgtgggttga ctccgaggat aaggaggttg gatgagagag 2460

ctcaggcaag agccaagaaa ggacctaaga ttcctttcag ctggatacat gacagagaag 2520

tgcagctctg aagaaaggac aaaagacata ataaaaccat tttctctctc tctctccgtt 2580

cgttatttga tatgtctgct cttgaagttg gtgtagatta ctatggtttc tgataatgtt 2640

cgttggtcta gttacaaagt tgagaagcag tgtcttagta actttgtttg tttcgttcag 2700

tgacttatgt ttggtctttt agtaaacttc tggtagttaa aaacagttga gcgttttgag 2760

tctgtactca gttttcactg tggagttttg ttctagttga agttagtttt tgtgtcttct 2820

ctctgctttt cctctgtttc tatatgaatc atataccaaa tgttctcaaa acgcagtgtg 2880

tgaatccgtg gaacaacaat atatttgctg tcttggcaat gtgtgatttt tagctactag 2940

tgattggtgt taacacagct atttc 2965

<210> 4

<211> 2750

<212> DNA

<213> Brassica napus BnaSAD.A3(Brassica napus)

<400> 4

ataaagctat tctctattct gtggacgaaa ctcaaccttt aaaaaggagt ccaaccagag 60

aacgagagcc agagatagtg tgagagcatt agccttacag agagagagag agagagagag 120

agcttgtctc tgaaagaatc cacaaatggc attgaagctt aaccctttgg catctcagcc 180

ttacaacttc ccttcctcgg ctcgtccgcc aatctctact ttcagatctc ccaagttcct 240

ctgcctcgct tcttcttctc ccgctctcag ctccaagtct ctctctctct tgtttcgttt 300

actaatataa gagatttggt tccttgtttc attatgtttc tgggttcttg cttgattgtc 360

gattatggat cttgatctta ttgattctag cgtagtcttg tttactcaca ttggcttttt 420

aatctatcaa atggatgtgc tttttttcaa tctgggaata gtgattaaag atggggccag 480

cctctgatat tctctgtttc tcaggccatt gattcattta atgctttcat tctcttatta 540

cacaatcatc atagcattct gagattgctc cattgtataa agtctttgcc tttaccatca 600

taatcattct gtttagatta acaacatttg ctaatgatct tttagattcc ttaagagtca 660

ttaaagaatg tgactttcaa ctagcttctt gactcaaatc ctgttcttcc ccgttgttca 720

aattttcaac tttttatgtt tttgtttata tttgattttg aaatgcatgt ccacttgttg 780

cttactcctt tgatggtttt ttttttttat ttctatgcat tgagaagaga ttcttgtaac 840

gtataacttt acgtcttatt ctttcttctt aagtgagaat acaacttgcg tctatgcatg 900

cgtacttcgt ggcctcctct ctctatagtt tacgtccaaa atgttctttg atttgtttac 960

tcttttttgc ctttttatct tgtctctatc tcatcttgtc tctctacctt tcacttcctc 1020

caagtttttt ttttttgctt cacattgcta agtgaatatt gaactgcaag attgattcat 1080

atattcatat atgtaacatc tatgtgacat gatgaatgtt tatccaaatg tgttcttgtc 1140

tcatctcact atatgctgat gatgatgcct ttcttttttt tattggtgca gggaggttga 1200

gagtttgaag aagccattca caccacctaa ggaagtgcac gttcaagtcc tgcattccat 1260

gccaccccag aagatcgaga tcttcaaatc catggaagac tgggccgagc agaaccttct 1320

aactcagctc aaagacgtgg agaagtcgtg gcagccccag gacttcttac ccgaccctgc 1380

atccgatggg tttgaagatc aggtaagaga gttaagagaa agagcaagag aactccctga 1440

tgattacttc gttgttctgg tgggagacat gatcacggaa gaagcgcttc cgacctatca 1500

aaccatgctg aacactttgg atggagtgag ggatgaaact ggcgctagcc ccacttcatg 1560

ggctatttgg acaagagctt ggactgcgga agagaaccga cacggtgatc ttctcaataa 1620

gtatctttac ttgtctggac gtgttgacat gaggcagatt gaaaagacca ttcagtactt 1680

gattggttct ggaatggtaa gagagactaa tcataatcta tttcttaaca tgacttccta 1740

atcagttcta acttctatgt cacaggatcc tagaacagag aacaatcctt acctcggctt 1800

cattctattt cttaacatga cttcctaatc agttctaact tctatgtcac aggatcctag 1860

aacagagaac aatccttacc tcggcttcat ctacacttca ttccaagaaa gagccacctt 1920

catctctcac ggaaacacag ctcgccaagc caaagagcac ggagacctca agctagccca 1980

aatctgcggc acaatagctg cagacgagaa gcgtcatgag acagcttaca ccaagatagt 2040

tgagaagctc tttgagattg atcctgatgg tactgtgatg gcgtttgcag acatgatgag 2100

gaagaaaatc tcgatgcctg ctcacttgat gtacgatggg cgcgatgaaa gcctctttga 2160

caacttctct tccgtggctc agaggctcgg tgtgtacact gctaaagact atgcggacat 2220

tcttgagttt ttggttggga ggtggaagat tgagagctta accgggcttt caggtgaagg 2280

aaacaaagcg caagagtact tgtgtgggtt gactccgaga atcaggaggt tggatgagag 2340

agctcaagca agagccaaga aaggacccaa ggttcctttc agctggatac atgacagaga 2400

agtgcagctc taaaaaagga acaaagcttt aaaacctttt cactctccat tccccatttg 2460

atctgtctgc tcttgaaatt ggtgtagatt actatggttt gtgataatgt tcgtgggtct 2520

agttacaaag ttgagaagca gtgatttagt agctttgttg tttccagtct ttatatgttt 2580

ttgtgtttgg tccctttagt aaacttgttg tagttaaatc agttgaactg tctggtctgt 2640

actcagtttt cactgtggag ttttgtttca gtttgaggtt agtttcattg cagagagaac 2700

ttctttatcc attaatatga aacttgcttc aaggtatggc taacttgtag 2750

<210> 5

<211> 2665

<212> DNA

<213> Brassica napus BnaSAD.C3(Brassica napus)

<400> 5

gccgctgttt attcatctat tctgtggacg aaactcaacc tttaaaaagg agtccaacca 60

gagatagtgt gagagcatta gccttagaga gagagagaga gagctcgctt gtctctgaaa 120

gaatccacaa atggcattga agcttaacaa ccctttggca tctcagcctt acaacttccc 180

ttcctcggct cgtccgccaa tctctacttt cagatctccc aagttcctct gcctcgcttc 240

ttcttctccc gctctcagct ccaagtctgt ctcttcccct ctctctctct ccctcttgtt 300

taaggatgag atgtggttcc ttgtttcact gtgtttctgg gttcttgctt gcttgtcgat 360

ttcggatctt gattttcttg attctagcgt ggtcttgatt actcacattg gattaatcta 420

tcaaatggat gtgctttttt caatctggga atagtgatta aagatggggc cagcctctga 480

tattctctgt ttctcaggcc attgattcat ttaatgcttt cattctctta ttacacatca 540

tcatagcatt ctgagattgc tccatgtata aagtctttgc ctttaccatc ataatcattc 600

tgttaagatt aacaacattt gctaatgatc tttagattcc ttaagagtca ttaaagaatc 660

tgactttcaa ctagcttctt tactcaaatc ctgttcttcc ccccttgccc aaattttcaa 720

cttttgatgt ttttttttat tttctgtgca ttgagaggag attcttgaaa cgtgtcactt 780

ttcgtctgtt ttctttcttc ttaagtgaga atacaacttg cgtctatgca tgcgtacttc 840

gtggcctcct ctctctatag tttacgtcca aaatgtcctt tgatttgttt actctttttt 900

tgccttttta tcttgtctct atctgatctt tatctcttgt ctcttgtctc tacctttcac 960

cccctgcaag tttttttttt tttgcttcac attgccaagt gaatattgaa ctgcaagatg 1020

gattcataga tgcatatata acatctgttt agagatgtag acatgaatgt ttatccaaat 1080

gtgttcttgt ctcatctgtg tgcatcagaa ataagacctt tcatgtttgt ttcaatgaag 1140

tataactata tgctgatgat gcctctcttt tcttattatt gatgcaggga ggttgagagt 1200

ttgaagaagc cattcacacc accaaaggaa gtgcacgttc aagtcttgca ctccatgcca 1260

ccccagaaga tcgagatctt caaatccatg gaagactggg ccgagcagaa ccttctaact 1320

catctcaaag acgtggagaa gtcgtggcag ccccaggact tcttaccgga ccctgcatcc 1380

gatgggtttg aagatcaggt aagagagcta agagagaggg caagagagct ccctgatgat 1440

tacttcgttg ttcttgtggg agacatgatc acagaagaag cgcttccgac ctatcaaacc 1500

atgctgaaca ctttggatgg agtgagagat gaaactggtg ctagccccac ttcatgggct 1560

atttggacaa gagcttggac tgcagaagag aaccgacatg gtgatctttt gaataagtat 1620

ctttacttgt ctggccgtgt tgacatgagg cagattgaaa agaccattca gtacttgatt 1680

ggttcaggaa tggtaagaga gagactaatc ataatccatt tcttaacatg acttcctaat 1740

cagtacttaa cttctatgtc acaggatcct agaacagaga acaatcctta ccttggcttt 1800

atctacactt cattccaaga aagagccacc ttcatctctc acggaaacac agctcgccaa 1860

gccaaagagc acggagacct caagctagcc caaatctgcg gcacaatagc tgcagacgag 1920

aagcgtcatg agacagctta caccaagata gttgagaagc tctttgagat tgatcctgat 1980

ggtactgtgg tggcgtttgc agacatgatg aggaagaaaa tctcgatgcc tgctcacttg 2040

atgtacgatg ggcgcgatga aagcctcttt gacaacttct cttccgtggc tcagaggctc 2100

ggtgtgtaca ctgctaaaga ctatgcggac attcttgagt ttttggttgg gaggtggaag 2160

attgagaact taaccgggct ttcgggtgaa ggaaacaaag cgcaagacta cttgtgcggg 2220

ttgactccga gaatcaggag gctggatgag agagctcaag caagagccaa gaaaggaccc 2280

aaggttcctt tcagctggat acacgacaga gaagtgcagc tctaaaaagg aacaaagctt 2340

taaaaacctt ttcactctcc gtcgttcctc atttgatctg tctgctcttg aaattggtgt 2400

agattactat ggtttgtgat aatgttcgtg ggtctagtta caaagttgag aagcagtgat 2460

ttagtagctt tgttgtttcc agcctttata tgtttttgtg tttggtccct ttagtaaact 2520

tgttgtagtt aaatcagttg aactgtctgg tctgtactca gttttcactg tggagttttg 2580

tttcagtttg aggttagttt cattgcagag agaacttact tatccattaa tatgaaactt 2640

gcttcaaggt atggctaact tgtag 2665

<210> 6

<211> 23

<212> DNA

<213> target sequence T1(Brassica napus)

<400> 6

aacgccacca cagtaccatc agg 23

<210> 7

<211> 23

<212> DNA

<213> target sequence T2(Brassica napus)

<400> 7

actgctgaag agaatcgcca cgg 23

<210> 8

<211> 23

<212> DNA

<213> target sequence T3(Brassica napus)

<400> 8

agaagccatt caccccacca agg 23

<210> 9

<211> 23

<212> DNA

<213> target sequence T4(Brassica napus)

<400> 9

gctcgccaag ccaaagagca cgg 23

<210> 10

<211> 23

<212> DNA

<213> target sequence T5(Brassica napus)

<400> 10

tctggtggga gacatgatca cgg 23

<210> 11

<211> 23

<212> DNA

<213> Artificial sequence (T1-F)

<400> 11

gtcaacgcca ccacagtacc atc 23

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence (T1-R)

<400> 12

aaacgatggt actgtggtgg cgt 23

<210> 13

<211> 23

<212> DNA

<213> Artificial sequence (T2-F)

<400> 13

gtcactgctg aagagaatcg cca 23

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence (T2-R)

<400> 14

aaactggcga ttctcttcag cag 23

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence (T3-F)

<400> 15

gtcagaagcc attcacccca cca 23

<210> 16

<211> 23

<212> DNA

<213> Artificial sequence (T3-R)

<400> 16

aaactggtgg ggtgaatggc ttc 23

<210> 17

<211> 23

<212> DNA

<213> Artificial sequence (T4-F)

<400> 17

attgctcgcc aagccaaaga gca 23

<210> 18

<211> 23

<212> DNA

<213> Artificial sequence (T4-R)

<400> 18

aaactgctct ttggcttggc gag 23

<210> 19

<211> 24

<212> DNA

<213> Artificial sequence (T5-F)

<400> 19

attgtctggt gggagacatg atca 24

<210> 20

<211> 24

<212> DNA

<213> Artificial sequence (T5-R)

<400> 20

aaactgatca tgtctcccac caga 24

<210> 21

<211> 22

<212> DNA

<213> Artificial sequence (U-F)

<400> 21

ctccgtttta cctgtggaat cg 22

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence (gR-R)

<400> 22

cggaggaaaa ttccatccac 20

<210> 23

<211> 42

<212> DNA

<213> Artificial sequence (Pps-GGL)

<400> 23

ttcagaggtc tctctcgact agtatggaat cggcagcaaa gg 42

<210> 24

<211> 37

<212> DNA

<213> Artificial sequence (Pgs-GG2)

<400> 24

agcgtgggtc tcgtcagggt ccatccactc caagctc 37

<210> 25

<211> 38

<212> DNA

<213> Artificial sequence (Pps-GG2)

<400> 25

ttcagaggtc tctctgacac tggaatcggc agcaaagg 38

<210> 26

<211> 38

<212> DNA

<213> Artificial sequence (Pgs-GG3)

<400> 26

agcgtgggtc tcgtcttcac tccatccact ccaagctc 38

<210> 27

<211> 38

<212> DNA

<213> Artificial sequence (Pps-GG3)

<400> 27

ttcagaggtc tctaagactt tggaatcggc agcaaagg 38

<210> 28

<211> 38

<212> DNA

<213> Artificial sequence (Pgs-GG4)

<400> 28

agcgtgggtc tcgagtcctt tccatccact ccaagctc 38

<210> 29

<211> 38

<212> DNA

<213> Artificial sequence (Pps-GG4)

<400> 29

ttcagaggtc tctgactaca tggaatcggc agcaaagg 38

<210> 30

<211> 38

<212> DNA

<213> Artificial sequence (Pgs-GG5)

<400> 30

agcgtgggtc tcggtccaca tccatccact ccaagctc 38

<210> 31

<211> 38

<212> DNA

<213> Artificial sequence (Pps-GG5)

<400> 31

ttcagaggtc tctggacttg tggaatcggc agcaaagg 38

<210> 32

<211> 42

<212> DNA

<213> Artificial sequence (Pgs-GGR)

<400> 32

agcgtgggtc tcgaccgacg cgtatccatc cactccaagc tc 42

<210> 33

<211> 27

<212> DNA

<213> Artificial sequence (PB-L)

<400> 33

gcgcgcggtc tcgctcgact agtatgg 27

<210> 34

<211> 27

<212> DNA

<213> Artificial sequence (PB-R)

<400> 34

gcgcgcggtc tctaccgacg cgtatcc 27

<210> 35

<211> 25

<212> DNA

<213> Artificial sequence (BP119-F)

<400> 35

tccttacctt ggctttatct acact 25

<210> 36

<211> 19

<212> DNA

<213> Artificial sequence (BP119-R)

<400> 36

aagaggcttt catcgcgcc 19

<210> 37

<211> 20

<212> DNA

<213> Artificial sequence (BP122-F)

<400> 37

attccatgcc accccagaag 20

<210> 38

<211> 20

<212> DNA

<213> Artificial sequence (BP122-R)

<400> 38

cgccagtttc atccctcact 20

<210> 39

<211> 22

<212> DNA

<213> Artificial sequence (BP123-F)

<400> 39

ttcattccaa gaaagagcca cc 22

<210> 40

<211> 21

<212> DNA

<213> Artificial sequence (BP123-R)

<400> 40

tgtcaaagag gctttcatcg c 21

<210> 41

<211> 22

<212> DNA

<213> Artificial sequence (BP124-F)

<400> 41

actatatgct gatgatgatg cc 22

<210> 42

<211> 25

<212> DNA

<213> Artificial sequence (BP124-R)

<400> 42

acaacaaagc tactaaatca ctgct 25

<210> 43

<211> 20

<212> DNA

<213> Artificial sequence (BP127-F)

<400> 43

gggtgacatg atcacagaag 20

<210> 44

<211> 25

<212> DNA

<213> Artificial sequence (BP127-R)

<400> 44

ctgatgaagt aaagataatt gtctg 25

<210> 45

<211> 23

<212> DNA

<213> Artificial sequence (BP128-F)

<400> 45

acttcatcag ttactaattc gct 23

<210> 46

<211> 18

<212> DNA

<213> Artificial sequence (BP128-R)

<400> 46

ctcgtgacgc ttctcgtc 18

<210> 47

<211> 24

<212> DNA

<213> Artificial sequence (BP131-F)

<400> 47

tgcaacattg attcgtagat tgtc 24

<210> 48

<211> 20

<212> DNA

<213> Artificial sequence (BP131-R)

<400> 48

atcttttggg gtggcatgga 20

<210> 49

<211> 21

<212> DNA

<213> Artificial sequence (BP132-F)

<400> 49

ttggagacat gatcacagaa g 21

<210> 50

<211> 28

<212> DNA

<213> Artificial sequence (BP132-R)

<400> 50

gtcaaacaaa agataatgtt tctgaaac 28

<210> 51

<211> 25

<212> DNA

<213> Artificial sequence (BP133-F)

<400> 51

tgactttcta attcgctttg ttgac 25

<210> 52

<211> 20

<212> DNA

<213> Artificial sequence (BP133-R)

<400> 52

ctgtttcatg acgcttctcg 20

<210> 53

<211> 18

<212> DNA

<213> Artificial sequence (BP120-F)

<400> 53

gagggcaaga gagctccc 18

<210> 54

<211> 19

<212> DNA

<213> Artificial sequence (BP120-R)

<400> 54

acgacggaga gtgaaaagg 19

<210> 55

<211> 21

<212> DNA

<213> Artificial sequence (BP129-F)

<400> 55

tgaacgacat tacgttgaac g 21

<210> 56

<211> 18

<212> DNA

<213> Artificial sequence (BP129-R)

<400> 56

cttgtcgtca cgcccatc 18

<210> 57

<211> 21

<212> DNA

<213> Artificial sequence (BP134-F)

<400> 57

cattgagagg gagggttctt g 21

<210> 58

<211> 21

<212> DNA

<213> Artificial sequence (BP134-R)

<400> 58

acaccatcac tagtagccaa a 21

Claims (3)

1. A method for changing the fatty acid composition of rape seeds by using a gene editing technology is characterized by comprising the following steps:

s1, designing and screening target sequences of five base sites according to the nucleotide sequences of Brassica napus BnaSAD.C4, BnaSAD.A5, BnaSAD.A3 and BnaSAD.C3 genes, and designing primers aiming at the target sequences, wherein the base sequences of BnaSAD.C4 are shown in SEQ ID NO:2 is shown in the specification; the base sequence of BnaSAD.A5 is shown as SEQ ID NO:3 is shown in the specification; the base sequence of BnaSAD.A3 is shown as SEQ ID NO: 4 is shown in the specification; the base sequence of BnaSAD.C3 is shown as SEQ ID NO: 5 is shown in the specification; the five target sequences 5 '-3' are respectively shown in SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: 9. SEQ ID NO: 10, the primer sequences are respectively shown in SEQ ID NO: 11. SEQ ID NO: 12. SEQ ID NO: 13. SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 16. SEQ ID NO: 17. SEQ ID NO: 18. SEQ ID NO: 19. SEQ ID NO: 20;

s2, constructing a five-target gene editing vector pBnaSAD2 vector, which comprises the following steps:

amplifying sgRNA expression cassette fragments, wherein primers for amplifying a T1 sgRNA expression cassette are shown in SEQ ID NO. 23 and SEQ ID NO. 24, primers for amplifying a T2 sgRNA expression cassette are shown in SEQ ID NO. 25 and SEQ ID NO. 26, primers for amplifying a T3 sgRNA expression cassette are shown in SEQ ID NO. 27 and SEQ ID NO. 28, primers for amplifying a T4 sgRNA expression cassette are shown in SEQ ID NO. 29 and SEQ ID NO. 30, and primers for amplifying a T5 sgRNA expression cassette are shown in SEQ ID NO. 31 and SEQ ID NO. 32;

mixing the sgRNA expression cassette fragments obtained by amplification, carrying out enzyme digestion connection with a binary vector PYLCRISPR/CAS 935S-H, and verifying to obtain a pBnaSAD2 vector;

s3, the pBnaSAD2 carrier is genetically transformed by the hypocotyl of cabbage type rape as receptor material to obtain the mutant with modified rape seed fatty acid composition.

2. The method for changing fatty acid composition of rape seeds by gene editing technology as claimed in claim 1, wherein the BnaSAD.C4, BnaSAD.A5, BnaSAD.A3 and BnaSAD.C3 genes are obtained by gene family analysis according to arabidopsis fab2 gene.

3. Use of a method for modifying the fatty acid composition of rape seeds by gene editing techniques as claimed in any one of claims 1 to 2 in the breeding of rape.

Images