HOXA9 methylation detection reagent
Technical Field
The invention belongs to the field of gene diagnosis, and particularly relates to a lung cancer diagnostic reagent based on human HOXA9 gene methylation or a kit containing the reagent.
Technical Field
Lung cancer is a malignant tumor of the lung that originates in the bronchial mucosa, glands or alveolar epithelium. The classification can be made according to the type of pathology: 1. small Cell Lung Cancer (SCLC): one particular pathological type of lung cancer has a marked propensity to metastasize at distant sites, with a poor prognosis, but most patients are sensitive to chemotherapy and radiotherapy. 2. Non-small cell lung cancer (non-small cell lung cancer, NSCLC): other pathological types of lung cancer besides small cell lung cancer include squamous cell carcinoma, adenocarcinoma, large cell carcinoma, and the like. There are certain differences in biological behavior and clinical course. According to the occurrence position, the method can be divided into the following steps: 1. central lung cancer (central lung cancer): lung cancer that grows in the segmental bronchiectasis and above. 2. Peripheral lung cancer (periheral lung cancer): lung cancer that grows beyond the bronchial opening of the segment.
In recent years, the incidence and mortality of the lung cancer in China are gradually increased year by year due to the influence of factors such as aging population, air pollution, smoking and the like, and according to the annual report of 2017 Chinese tumor registration issued by the national cancer center, about 7 people per minute are diagnosed with the cancer nationally, wherein the incidence and mortality of the lung cancer are the first. China has become the world with the largest number of lung cancers, and experts predict that the number of lung cancers in China will reach 100 ten thousand in 2025. And according to epidemiological studies show that: smoking is an important factor causing lung cancer. About 80% -90% of lung cancers worldwide can be attributed to smoking. Compared with non-smokers, 1-19 cigarettes and more than 20 cigarettes smoked per day in the age of 45-64 years have relative risk of lung cancer of 4.27 and 8.61 respectively, and compared with non-smokers, 1-19 cigarettes and more than 20 cigarettes smoked per day for a long time have relative risk of lung cancer death of 6.14 and 10.73 respectively. Although the treatment technology of the lung cancer is changed day by day, the 5-year survival rate is only increased from 4% to about 12%, the existing antitumor drugs still only have the function of relieving the disease condition, the non-progress survival time of the patient is only prolonged by 3 months to 5 months on average, and for the first-stage lung cancer patient, the 5-year survival rate after the operation is as high as about 60% to 70%. Therefore, early diagnosis and early surgery of lung cancer are one of the most effective methods for improving 5-year survival rate and reducing mortality rate of lung cancer.
The current clinical auxiliary diagnosis of lung cancer mainly comprises the following diagnosis methods, but the diagnosis methods cannot completely realize early detection and early diagnosis:
1. biochemical examination of blood: for primary lung cancer, there is currently no specific blood biochemical examination. The increase of blood alkaline phosphatase or blood calcium in lung cancer patients takes into account the possibility of bone metastasis, and the increase of blood alkaline phosphatase, glutamic-oxalacetic transaminase, lactate dehydrogenase or bilirubin takes into account the possibility of liver metastasis.
2. Tumor marker examination: (1) CEA: abnormally high levels of CEA are found in the serum of 30-70% of lung cancer patients, but are found mainly in later stage lung cancer patients. The current examination of CEA in serum is mainly used to estimate lung cancer prognosis and to monitor the course of treatment. (2) NSE: the kit is a preferred marker for small cell lung cancer, is used for diagnosing the small cell lung cancer and monitoring the treatment response, and has different reference values according to different detection methods and used reagents. 3) CYFRA 21-1: the first choice marker of the non-small cell lung cancer has the sensitivity of 60 percent on the diagnosis of the squamous cell lung cancer, and the reference value is different according to different detection methods and used reagents.
3. Imaging examination: (1) chest X-ray examination: chest orthoses and lateral pieces should be included. In primary hospitals, the positive chest radiograph is still the most basic and preferred image diagnosis method for the initial diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, a chest CT examination is performed. (2) And (3) CT examination: chest CT is the most common and important examination method for lung cancer, and is used for diagnosis and differential diagnosis, staging and follow-up after treatment of lung cancer. The scope of a conditional hospital should include the adrenal gland during a chest CT scan of a lung cancer patient. Enhanced scanning should be used as much as possible, especially for patients with lung center type lesions. CT is the basic examination method for displaying brain metastasis, and patients with clinical symptoms or patients in the advanced stage should perform brain CT scanning and adopt enhanced scanning as much as possible. CT guided lung biopsy is an important diagnostic technique for lung cancer, and a conditional hospital can be used for the diagnosis of lung lesions which are difficult to characterize and the clinical diagnosis of lung cancer needs cytological and histological verification and other methods are difficult to obtain materials. (3) Ultrasonic examination: the kit is mainly used for finding whether the vital organs of the abdomen, the abdominal cavity and the retroperitoneal lymph nodes are transferred or not, and is also used for detecting the cervical lymph nodes. For lung lesions or chest wall lesions close to the chest wall, the cyst solidity can be identified and puncture biopsy can be carried out under ultrasonic guidance; ultrasound is also commonly used for pleural effusion extraction positioning. (4) Bone scanning: the sensitivity to the detection of the bone metastasis of the lung cancer is high, but the false positive rate is certain. The following can be used: preoperative examination of lung cancer; patients with local symptoms.
4. Other checks: (1) sputum cytology examination: the lung cancer is a simple and convenient noninvasive diagnosis method at present, the positive rate can be improved by about 60 percent through continuous smear examination, and the method is a routine diagnosis method for suspicious lung cancer cases. (2) Fiberbronchoscopy: one of the most important means in lung cancer diagnosis plays an important role in the qualitative and localized diagnosis of lung cancer and the selection of surgical schemes. Is a necessary routine examination item for a patient to be treated by surgery. And the bronchoscopy biopsy (TBNA) is beneficial to staging before treatment, but the technical difficulty and risk are higher, so that a person in need should go to a higher hospital for further examination. (3) And others: such as percutaneous lung puncture biopsy, thoracoscope biopsy, mediastinoscopic biopsy, hydrothorax cytology examination, etc., under the condition of an adaptation, the diagnosis can be assisted according to the existing conditions.
Multi-slice helical CT and Low Dose CT (LDCT) in imaging examinations are effective screening tools for finding early lung cancer and reducing mortality, and the national lung cancer screening study (NLST) in the united states has shown that LDCT can reduce mortality of 20% of lung cancer compared to chest X-ray screening. In clinical practice work, the success or failure of any lung cancer screening project is proved to depend on the identification of high risk groups, and a risk prediction model fusing multiple high risk factors is universally accepted as one of the methods for identifying the high risk groups of lung cancer. The risk model further improves the efficacy of lung cancer patients by assisting clinicians in improving interventions or treatments. Although the world has agreed that screening for high risk populations could reduce the current high mortality rate of lung cancer, high risk population definition remains an elusive problem. In order to maximize the benefit-to-injury ratio of lung cancer screening, the first critical issue is how to define the population at high risk; and secondly, screening the population by using what method, including definition of high risk factors, quantitative summarization of overall risks and selection of screening benefit threshold.
With the rapid development of the technology, the tumor marker detection becomes a new field of tumor diagnosis and treatment after the imaging diagnosis and the pathological diagnosis, and can have great influence on the diagnosis, the detection and the treatment of tumors. The tumor marker can be detected in body fluid or tissues and can reflect the existence, differentiation degree, prognosis estimation, personalized medicine, treatment effect and the like of tumors. Early lung cancer patients have no obvious symptoms and are difficult to detect by doctors and patients, and in addition, the early lung cancer patients have no obvious specific markers on blood or biochemical projects, so that early detection and early diagnosis are difficult to perform through a conventional diagnosis method, and the early lung cancer diagnosis, especially the screening of large-scale application population is difficult.
More and more studies have shown that two broad classes of mechanisms are involved in the process of tumor formation. One is the formation of mutations by changes in the nucleotide sequence of the DNA, a genetic mechanism. Tumors have been identified in the field of molecular biology as a genetic disease. Another is the epigenetic (epigenetics) mechanism, i.e., the change of gene expression level independent of DNA sequence change, and the role of it in the process of tumor formation is increasingly emphasized. The two mechanisms of genetics and epigenetics exist in a mutual crossing way, and the formation of tumors is promoted together. Aberrant methylation of genes occurs early in tumorigenesis and increases in the course of tumor progression. Analysis of the genome of 98 common primary human tumors revealed at least 600 abnormally methylated CpG islands per tumor.
Many studies have shown that promoter abnormal methylation is a frequent early event in the development of many tumors, and thus the methylation status of tumor-associated genes is an early sensitive indicator of tumorigenesis and is considered to be a promising molecular biomarker (biomarker). More importantly, the cancerous cells can release DNA into the peripheral blood. Free DNA is present in normal human peripheral blood on the nanogram scale. The research finds that abnormal methylation of the promoter of the tumor-related gene existing in the tumor tissue can be detected in peripheral blood plasma/serum and tumor-involved organ-related body fluid (such as saliva, sputum and the like). The biological samples are easy to obtain, and DNA in the biological samples can be sensitively detected after being massively amplified by a PCR technology, so that the methylation state of the promoter regions of certain tumor-related genes can be detected, and very valuable information can be provided for early diagnosis of tumors. There are many advantages to detecting promoter abnormal methylation compared to other types of tumor molecular markers. The abnormal methylation of a certain gene is a positive signal compared with a marker of allele deletion, and is easily distinguished from the negative background in normal tissues. Esteller et al examined the abnormal methylation state of the promoter regions of genes such as p16, DAPK, GSTP1 and MGM T in 22 cases of non-small cell lung cancer (NSCLC) tumor tissues and serum, and found that 68% (15/22) tumor tissues have promoter methylation of at least one gene; in 15 cases of tissue positivity, the presence of abnormal promoter methylation was also detected in the serum in 11 cases. In addition, many researchers have also detected the methylation of the promoters of some tumor-related genes from tumor tissues and sera of patients with liver cancer, head and neck cancer, esophageal cancer and colon cancer, respectively.
The existing lung cancer detection technology is mainly low in sensitivity, high in false positive and invasive, and the existing conventional detection technology is difficult to detect early lung cancer.
Noninvasive detection of lung cancer, such as sputum, is more difficult. Although some researchers research the tumor markers in the sputum of lung cancer patients, the success rate of sputum samples is very low when compared with the detection and evaluation of tumor markers of blood samples of other tumor patients.
This is because ① sputum has complex components, different populations have large differences in sputum components and viscosities under different diseases or environments, ② sputum contains large amounts of tracheal epithelial cells and bacteria, oral mucosa cells and other non-lung cancer cell components, general sample processing methods cannot effectively enrich sufficient lung cancer-derived DNA, ③ many smoking patients do not express expectoration, A J Hubers et al in Molecular analysis for the diagnosis of cancer showed that the median Methylation degree of the marker in lung cancer tissue is 48%, while the median Methylation degree of sputum is 38%, showing that the detection rate of the Methylation marker in tissue is significantly higher than that of sputum, and Rosalia rinone (Methylation in tissue transformed cancer tissue of cancer tissue is 54%, 365% and 365% in tissue of lung cancer tissue, 54% and 365% and 364% in tissue of lung cancer tissue, respectively, SSP is 54%, 365% and 364% respectively.
At present, the omission rate of lung cancer is high. Especially, for the adenocarcinoma type, noninvasive detection of sputum is more difficult and has extremely low detection rate. This is because most of adenocarcinoma originates in small bronchi, and is peripheral lung cancer, and exfoliated cells in the deep lung are more difficult to expectorate by sputum. Therefore, the sputum detection means of the adenocarcinoma is almost zero at present.
Although some tumor markers related to lung cancer have been found in the prior art, the detection reagent or detection means for these tumor markers are limited, so that the sensitivity and specificity of these tumor markers cannot meet the requirement, and therefore, further research on screening means capable of being applied to lung cancer in a practical manner is still needed in the art. However, while non-invasive screening has the unique advantage of sampling, it also has some limitations in other areas, for example, adenocarcinoma in lung cancer, which is often considered by researchers to be unsuitable for non-invasive screening, due to the difficulty in expectoration of exfoliated cells from deep lung portions by sputum.
On the other hand, even for other types of lung cancer, the non-invasive screening method reported at present is difficult to meet the requirements of clinical use. Although relevant research has progressed for many years, there is no noninvasive screening method for lung cancer that can be clinically advanced to date.
Disclosure of Invention
The invention aims to provide application of a nucleic acid fragment of a HOXA9 gene in preparation of lung cancer diagnosis.
The invention also aims to provide a primer and application thereof in preparing a lung cancer diagnostic reagent or a kit.
Another object of the present invention is to provide a probe and its use in preparing a lung cancer diagnostic reagent or kit.
It is still another object of the present invention to provide a reagent, a kit and a method for diagnosing methylation of the HOXA9 gene in human.
It is still another object of the present invention to provide a lung cancer diagnostic reagent and kit having high specificity and high sensitivity.
It is a further object of the present invention to provide a lung cancer diagnostic reagent and kit having high sensitivity and specificity against lung adenocarcinoma.
The invention also aims to provide a lung cancer diagnostic reagent and a kit which have wide application range on lung cancer.
It is still another object of the present invention to provide a noninvasive lung cancer diagnostic reagent and kit.
The above object of the present invention is achieved by the following technical means:
the inventors have conducted intensive studies and have provided a reagent for detecting methylation of HOXA9 gene. The inventor not only verifies that the detection reagent has higher specificity and sensitivity for detecting the lung cancer in a tissue sample, but also verifies that the detection reagent has the same high specificity and sensitivity in a sputum sample and a lavage fluid sample.
The HOXA9 gene is a member of the HOX (homeobox) gene family, belongs to the HOXA cluster gene on chromosome 7p15-p14, and like other HOX genes, contains a 180bp DNA fragment, transcribes a homology domain consisting of 60 amino acids. HOXA9 is a transcription regulation factor with coding sequence specificity, and has important functions in the space-time development of embryo, cell differentiation, proliferation and migration, malignant tumor evolution and apoptosis induction. At present, the abnormal expression of HOXA9 plays an important role in the occurrence and development of leukemia, and some cancers such as lung cancer and human glioma related to HOXA9 gene are reported.
The invention provides an application of a nucleic acid fragment in preparing a lung cancer diagnostic reagent or a kit; wherein the nucleic acid fragment is derived from a HOXA9 gene. Specifically, the nucleic acid fragment is selected from SEQ ID NO: 22. SEQ ID NO: 24 or SEQ ID NO: 26; as a preferred embodiment, the nucleic acid fragment is selected from the group consisting of SEQ id nos: 22, or a sequence shown in fig. 22.
In another aspect, the present invention further provides a primer, wherein the primer pair of SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 30. SEQ ID NO: 31. SEQ ID NO: 33. SEQ ID NO: 34. SEQ ID NO: 36. SEQ ID NO: 37. SEQ ID NO: 39. SEQ ID NO: 40. SEQ ID NO: 42. SEQ ID NO: 43. SEQ ID NO: 45. SEQ ID NO: 46. SEQ ID NO: 48. SEQ ID NO: 49. SEQ ID NO: 51. SEQ ID NO: 52. SEQ ID NO: 54. SEQ ID NO: 55. SEQ ID NO: 57. SEQ ID NO: 58; as a preferred embodiment of the present invention, the primer is selected from SEQ ID NO: 1 and SEQ ID NO: 2, respectively.
In another aspect, the present invention also provides a probe selected from the group consisting of SEQ ID NOs: 3. SEQ ID NO: 32. SEQ ID NO: 35. SEQ ID NO: 38. SEQ ID NO: 41. SEQ ID NO: 44. SEQ ID NO: 47. SEQ ID NO: 50. SEQ ID NO: 53. SEQ ID NO: 56. SEQ ID NO: 59, to any of which is shown in figure 59. As a preferred embodiment of the present invention, the nucleic acid probe is selected from SEQ ID NO: 3.
on the other hand, the invention also provides application of the primer or the nucleic acid probe in preparing a lung cancer diagnostic reagent or a kit.
In another aspect, the present invention provides a diagnostic reagent for lung cancer, which comprises a detection reagent for methylation of the HOXA9 gene.
Wherein the detection reagent for detecting the methylation of the HOXA9 gene detects the sequence of the HOXA9 gene modified by the transformation reagent. Wherein the conversion reagent is a reagent which deaminates cytosine in DNA to uracil while leaving 5-MeC substantially unaffected. Exemplary conversion reagents include one or more of a hydrazine salt, a bisulfite salt (e.g., sodium bisulfite and the like), a bisulfite salt (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite and the like), or a compound that generates a hydrazine salt, a bisulfite salt under appropriate reaction conditions. As an exemplary embodiment, the detection reagent for methylation of the HOXA9 gene detects a sequence modified by bisulfite.
Methylation is caused by adding one more methyl group on cytosine, and cytosine can be changed into uracil after being treated by bisulfite or hydrazinate, because uracil is similar to thymine and can be identified as thymine when PCR amplification is carried out, namely cytosine which is not methylated is changed into thymine (C is changed into T) on a PCR amplification sequence, and methylated cytosine (C) is not changed. The technique for detecting methylated genes by PCR is usually Methylation Specific PCR (MSP), wherein primers are designed for the treated methylated fragments (i.e., unchanged C in the fragments), PCR amplification is carried out, if amplification exists, methylation occurs, and if amplification does not occur, methylation does not occur. In an alternative embodiment, the detection region of the HOXA9 gene to which the reagent is directed is a CG-rich region or a non-CG-rich region or a CTCF (CTCF-binding sites) region of the HOXA9 gene. In a preferred embodiment, the detection region of the reagent is a CG-rich region or a CTCF (CTCF-binding sites) region of the HOXA9 gene.
Or the detection region to which the reagent is directed is the genome of the HOXA9 gene or a promoter region thereof.
As a preferred embodiment of the present invention, the reagent contains SEQ ID NO: 22 (region 1), SEQ ID NO: 24 (region 2) or SEQ ID NO: 26 (region 3). As a more preferred embodiment, the reagent comprises SEQ ID NO: 22, or a sequence shown in fig. 22.
The inventor finds that the selection of the HOXA9 gene detection region can affect the detection efficiency of the tumor, the detection results of the primer pairs designed in different regions are obviously different according to the primer designed in the CG enrichment region of the HOXA9 gene, and the detection rate of the good region to the tumor is 50-60% higher than that of the poor region. The inventor finds that the detection result of the GC enrichment region or the CTCF (CTCF-binding sites) region is obviously better than that of the non-hypermethylated region through experimental comparison.
The diagnostic reagent of the present invention contains an amplification primer. As an alternative embodiment, the primer is selected from SEQ id no: 1. SEQ ID NO: 2. SEQ ID NO: 30. SEQ ID NO: 31. SEQ ID NO: 33. SEQ ID NO: 34. SEQ ID NO: 36. SEQ ID NO: 37. SEQ ID NO: 39. SEQ ID NO: 40. SEQ ID NO: 42. SEQ ID NO: 43. SEQ ID NO: 45. SEQ ID NO: 46. SEQ ID NO: 48. SEQ ID NO: 49. SEQ ID NO: 51. SEQ ID NO: 52. SEQ ID NO: 54. SEQ ID NO: 55. SEQ ID NO: 57. SEQ ID NO: 58. As a preferred embodiment, the primer is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
The primers were used to amplify a specific region of the HOXA9 gene. It is well known in the art that successful design of primers is crucial for PCR. Compared with general PCR, in the methylation detection of genes, the design influence of primers is more critical, because the methylation reaction promotes the conversion of 'C' in a DNA chain into 'U', the GC content is reduced, long continuous 'T' appears in the sequence after the PCR reaction, the DNA chain is easy to break, and the selection of primers with proper Tm value and stability is difficult; on the other hand, in order to distinguish between DNA that is treated with and without sulfurization and not treated completely, a sufficient number of "C" s are required for the primers, which all increase the difficulty in selecting stable primers. Therefore, in the detection of DNA methylation, the selection of the amplified fragment to which the primer is directed, such as the length and position of the amplified fragment, the selection of the primer, and the like, all influence the sensitivity and specificity of the detection. The inventor also finds that different amplified target fragments and primer pairs have different detection effects through experiments. Many times, some genes or nucleic acid fragments are found to have expression difference between tumor and non-tumor, however, the distance is converted into a tumor marker, and the application in clinic still has a long distance. The main reason is that the detection sensitivity and specificity of the potential tumor marker cannot meet the detection requirement due to the limitation of detection reagents, or the detection method is complex in operation and high in cost, and is difficult to apply in large scale in clinic.
The diagnostic reagent of the present invention further comprises a probe. As an alternative embodiment, the probe is as set forth in SEQ ID NO: 3. SEQ ID NO: 32. SEQ ID NO: 35. SEQ ID NO: 38. SEQ ID NO: 41. SEQ ID NO: 44. SEQ ID NO: 47. SEQ ID NO: 50. SEQ ID NO: 53. SEQ ID NO: 56 or SEQ ID NO: shown at 59. In a preferred embodiment, the probe is as set forth in SEQ ID NO: 3, respectively. As a preferred mode of the present invention, for convenience of clinical use, the fluorescent group labeled with the detection probe may be VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED, Texas Red, etc.; the quenching group can be TAMRA, BHQ, MGB, Dabcyl and the like, so that the method is suitable for a multi-channel PCR detection system commonly used for clinical detection at present and realizes multicolor fluorescence detection in one reaction tube.
As a more preferred embodiment, the diagnostic reagent of the present invention comprises SEQ ID NO: 1 and SEQ ID NO: 2 and the primer pair shown as SEQ ID NO: 3, and (b) a probe shown in (3).
As an alternative embodiment, the reagent according to the invention also contains a bisulfite, bisulfite or hydrazinate salt for modifying methylated cytosine to thymine. Of course, the reagent of the present invention may not be contained. Can be purchased independently when used.
In an alternative embodiment, the reagent of the present invention further comprises DNA polymerase, dNTPs, Mg2+One or more of ions and buffer solution; preferably, the DNA polymerase, dNTPs and Mg are contained2+Ions and buffer for carrying out amplification reaction on HOXA9 gene.
As an alternative embodiment, the reagent of the invention also contains a detection reagent of an internal reference gene, preferably β -actin or COL2A1, and besides the two internal reference genes, other methylation detection internal reference genes in the prior art can be adopted.
The invention also provides the primer, the probe and a kit of the lung cancer diagnostic reagent.
As an alternative embodiment, the kit of the invention comprises: divided into one or more containers within which reagents are received. Preferably, a first container is included that contains a reagent that sensitively converts unmethylated cytosine; a second container containing amplification primers; a third container comprising a probe.
In another aspect, the present invention provides a method for detecting DNA methylation of the HOXA9 gene, comprising the steps of:
(1) processing a sample to be detected by bisulfite or hydrazine to obtain a modified sample to be detected;
(2) and (3) carrying out HOXA9 gene methylation detection on the modified sample to be detected in the step (1) by using the reagent or the kit.
Alternatively, detection is performed using methylation-specific polymerase chain reaction (MSP) or real-time fluorescent quantitative methylation-specific polymerase chain reaction (qssp). Other DNA methylation detection methods reported in the prior art can also be applied to the present invention. Methylation detection methods of the prior art are incorporated into the present invention by the USSN62/175,916 patent.
In another aspect of the present invention, there is provided a system for diagnosing lung cancer, the system comprising:
a means for detecting DNA methylation of the HOXA9 gene, and,
b. and a result judging means.
Preferably, the DNA methylation detection component of the HOXA9 gene comprises the reagent or the kit;
preferably, the result judging means is used for outputting the risk of lung cancer and/or the type of lung cancer according to the DNA methylation result of the HOXA9 gene detected by the detecting means;
in a preferred embodiment, the disease risk is determined by comparing the methylation results of the test sample and the normal sample by the result determination component, and when the methylation of the test sample and the methylation of the normal sample have a significant difference or a very significant difference, the result determination component outputs that the disease risk of the test sample is high.
In the present invention, the reagent/kit/method is used to detect a sample selected from sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, prostatic fluid, tears or feces. In a preferred embodiment, the test sample of the diagnostic/test reagent is selected from sputum, tissue or lung lavage. In a more preferred embodiment, the test sample of the diagnostic/test reagent is selected from sputum.
The methylation level of the HOXA9 gene in tissues is highly correlated with the onset of lung cancer. In 185 tissues, compared with the normal group and the whole lung cancer group of the HOXA9 gene, the specificity is up to 95%, and the sensitivity is 78.6%, although the sensitivity is lower than that of the other tumor marker SHOX2 (sensitivity is 80.6%) gene in the experiment of the invention, the surprising finding is that the methylation level of the HOXA9 gene detected in sputum and lung lavage fluid keeps higher correlation with the onset of lung cancer, and in the sputum, the sensitivity of HOXA9 is 74.3%, and the specificity is 95%; in lung lavage, sensitivity was 61.9% and specificity was 95%.
None of the various molecular markers studied by the inventors was a significant reduction in the detection sensitivity or specificity of sputum samples versus tissue samples. For example, several of SHOX2, PCDHGA12, HOXD8, GATA3 were reported to be associated with lung cancer, with SHOX2 having a detection sensitivity in tissues of 80.6% higher than that of HOXA9, and a sensitivity in sputum that was greatly reduced to 51.4% significantly lower than 74.3% of the HOXA9 gene (note, normal group versus all cancer groups). Therefore, when sputum is used as a sample for detection, the HOXA9 gene is particularly suitable as a tumor marker.
The research finds that the various lung cancer markers only show good detection sensitivity and specificity in tissues; however, in sputum and lung lavage fluid samples, no matter how to design and optimize detection regions, detection primers, probes and the like, the sensitivity is still greatly reduced, and the diagnosis of lung cancer is seriously influenced.
The HOXA9 gene also keeps high sensitivity and specificity of up to 95% in sputum and lung lavage fluid samples, so that the gene can be used as a reliable lung cancer marker in the sputum and lung lavage fluid samples. One reason for this is that the present invention is optimized for the detection region, primers, probes, etc. of HOXA 9.
In the present invention, the lung cancer is selected from Small Cell Lung Cancer (SCLC) and non-small cell lung cancer (non-small cell lung cancer, NSCLC); further, the non-small cell lung cancer is selected from squamous cell carcinoma, adenocarcinoma or large cell carcinoma. In a preferred embodiment, the lung cancer is selected from adenocarcinoma.
Experiments prove that the reagent/kit disclosed by the invention has high specificity and high sensitivity in various lung cancers and has higher sensitivity than other tumor markers even in lung adenocarcinoma, such as the detection sensitivity of HOXA9 in sputum is 55.6%, and the sensitivity of SHOX2 is 11.1% (see example table 6), and further, the HOXA9 is particularly suitable for detecting sputum as a detection sample, particularly for detecting lung adenocarcinoma. At present, the omission rate of lung adenocarcinoma is high. On one hand, as the lung adenocarcinoma is easy to occur in women and people who do not smoke, the incidence rate is lower than that of squamous carcinoma and undifferentiated carcinoma, the onset age is smaller, and the number of women is relatively more frequent; on the other hand, most adenocarcinomas originate from small bronchi and are peripheral lung cancers, and exfoliated cells in the deep lung are more difficult to expectorate through sputum; in yet another aspect, early stages of lung adenocarcinoma are generally free of overt clinical symptoms. Therefore, detection of lung adenocarcinoma is more difficult and valuable.
The invention has the beneficial effects that:
1. the lung cancer diagnostic reagent/kit provided by the invention can not only take tissues as detection samples, but also has higher sensitivity in sputum and lung lavage fluid, and can simply and conveniently take the sputum and the lung lavage fluid as the detection samples to reliably diagnose the lung cancer. The sputum sample is very easy to obtain, and does not cause any pain or inconvenience to the patient. The sample volume is very small, the sampling process is very convenient and has no influence on patients. Meanwhile, the sample is convenient to mail or bring to a hospital for examination.
2. The lung cancer diagnostic reagent/kit can detect various types of lung cancer, and has higher sensitivity relative to other markers for adenocarcinoma difficult to detect.
3. The lung cancer diagnostic reagent/kit does not need to consider the detection object and age, and has wide application range.
4. The reagent/kit provided by the invention is used for detecting and diagnosing cancer through methylation level, more and more researches prove that methylation change is an early event in the tumorigenesis process, and early lesions are easier to discover when methylation abnormality is detected.
Drawings
FIG. 1 ROC curves for detection of HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3 in all tissue specimens;
FIG. 2 ROC curves for detection of HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3 in sputum samples;
FIG. 3 ROC curves for detection of HOXA9 and SHOX2-n3 in all sputum specimens;
FIG. 4 shows the amplification curves of HOXA9 and SHOX2_ n3 in sputum specimen (A is the amplification chart of HOXA9, B is the amplification chart of SHOX2_ n 3;
FIG. 5 ROC curves for detection of HOXA9 and SHOX2_ n3 in all lavage samples;
FIG. 6 shows the amplification curves of HOXA9 and SHOX2_ n3 in lavage fluid specimens (A is the amplification chart of HOXA9, and B is the amplification chart of SHOX2_ n 3).
Detailed Description
The technical solutions of the present invention are further illustrated by the following specific examples, which do not represent limitations to the scope of the present invention. Insubstantial modifications and adaptations of the present invention by others of the concepts fall within the scope of the invention.
The sample to be tested of the present invention comprises: alveolar lavage fluid, tissue from the lesion, pleural fluid, sputum, blood, serum, plasma, urine, prostatic fluid, stool, saliva, tears, etc.
A "primer" or "probe" in the present invention refers to an oligonucleotide comprising a region complementary to a sequence of at least 6 contiguous nucleotides of a target nucleic acid molecule (e.g., a target gene). In some embodiments, the primer or probe comprises a region complementary to a sequence of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous or non-contiguous blocked nucleotides of the target molecule. When a primer or probe comprises a region that is "complementary to at least x consecutive nucleotides of a target molecule," the primer or probe is at least 95% complementary to at least x consecutive nucleotides of the target molecule. In some embodiments, the primer or probe is at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target molecule.
The "diagnosis" in the present invention includes, in addition to the early diagnosis of lung cancer, the diagnosis of the middle and late stages of lung cancer, and also includes screening of lung cancer, risk assessment, prognosis, disease identification, diagnosis of the stage of the disease, and selection of therapeutic targets.
The use of the lung cancer marker HOXA9 enables early diagnosis of lung cancer. When it is determined that a gene methylated in cancer cells is methylated in cells that are clinically or morphologically normal in appearance, this indicates that the cells in the normal appearance are progressing toward cancer. Thus, lung cancer can be diagnosed at an early stage by methylation of the lung cancer specific gene HOXA9 in normally represented cells.
In addition to early diagnosis of lung cancer, the reagents/kits of the invention are also promising for lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of disease stage and selection of therapeutic targets.
As an alternative to stage diagnosis of the condition, diagnosis may be made by measuring the degree of methylation of HOXA9 obtained from a sample as it progresses through different stages or stages of lung cancer. A particular stage of lung cancer in a sample can be detected by comparing the degree of methylation of the HOXA9 gene of nucleic acids isolated from the sample at each stage of lung cancer to the degree of methylation of the HOXA9 gene of one or more nucleic acids isolated from the sample in lung tissue free of cell proliferative abnormalities.
Example 1: detection of target Gene selection
In order to complete the present invention, the inventors have screened several rounds of candidate genes for better HOXA9, SHOX2, PCGA DH 12, HOXD8, GATA3 as candidate detection genes, β -action genes as reference genes, studied the distribution of methylation sites of each gene, and designed primer probes for real-time fluorescent quantitative methylation-specific polymerase chain reaction (qMSP) detection, respectively, as follows:
the detection primers and probes for HOXA9 were:
SEQ ID NO: 1HOXA9-F2 primer F: TTAGTTTTTTCGGTAGGCGGC
SEQ ID NO: 2HOXA9-R2 primer R: AAACGCCAAACACCGTCG
SEQ ID NO: 3HOXA9-P2 probe:
FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1
the detection primers and probes for SHOX2 were:
SEQ ID NO: 4SHOX2 primer F: TTTAAAGGGTTCGTCGTTTAAGTC
SEQ ID NO: 5SHOX2 primer R: AAACGATTACTTTCGCCCG
SEQ ID NO: 6SHOX2 Probe:
FAM-TTAGAAGGTAGGAGGCGGAAAATTAG-BQ1
the detection primers and probes of the PCDHGA12 are as follows:
SEQ ID NO: 7PCDHGA12 primer F: TTGGTTTTTACGGTTTTCGAC
SEQ ID NO: 8PCDHGA12 primer R: AAATTCTCCGAAACGCTCG
SEQ ID NO: 9PCDHGA12 probe:
FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1
the detection primers and probes for HOXD8 were:
SEQ ID NO: 10HOXD8 primer F: TTAGTTTCGGCGCGTAGC
SEQ ID NO: 11HOXD8 primer R: CCTAAAACCGACGCGATCTA
SEQ ID NO: 12HOXD8 probe:
FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1
the detection primers and probes of GATA3 are:
SEQ ID NO: 13GATA3 primer F: TTTCGGTAGCGGGTATTGC
SEQ ID NO: 14GATA3 primer R: AAAATAACGACGAACCAACCG
SEQ ID NO: 15GATA3 Probe:
FAM-CGCGTTTATGTAGGAGTGGTTGAGGTTC-BQ1
β -actin comprises the following detection primers and probes:
SEQ ID NO 16 β -actin primer F TTTTGGATTGTGAATTTGTG
SEQ ID NO 17 β -actin primer R AAAACCTACTCCTCCCTTAAA
18 β -actin probe FAM-TTGTGTGTTGGGTGGTGGTT-BQ1 Experimental Process:
1. extraction of DNA
Collecting the specimens of lung cancer patients and non-tumor patients respectively including paraffin tissue specimens, sputum specimens and lavage fluid specimens, pretreating the specimens and separating cells, and extracting DNA according to the instruction of HiPureFFPE DNA Kit (D3126-03) of the Mitsubishi bioscience.
2. DNA bisulfite treatment
EZ DNA Methylation using ZYMO RESEARCH Biochemical kitTMKIT (D5002) instructions for bisulphite modification.
3. Amplification and detection
TABLE 1 compounding System
An amplification system:
4. the result of the detection
4.1 detection results in Paraffin tissue
Sample information: the total number of lung tissue samples was 185, including 87 normal tissue samples, 98 cancer tissue samples, 15 squamous carcinomas in 98 cancer group samples, 81 adenocarcinoma samples, and 2 unidentified lung carcinomas in which there were 73 cancer and paracancer control samples.
ROC plot 1 of the results of detection of HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3 in all tissue specimens. The statistical results of the detection of each gene in the tissues are shown in Table 3.
TABLE 3 results of the assays in the organization
From the above results, it can be seen that, in the tissue samples, no matter the lung cancer was comparatively analyzed as a whole, or according to the subtype of the lung cancer, the detection effect of SHOX2 and HOXA9 was the best, and the detection effect of PCDHGA12 and GATA3 was the second best, and the detection effect of HOXD8 was only 40.8%.
According to the above results, in order to study the detection of different genes in the sputum, 5 markers HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 were further screened in the sputum, because the sputum is more significant as a non-invasive detection sample.
Example 2: detection of HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 genes in sputum
Sample information: the total number of the sputum samples tested was 90, wherein 55 samples of the normal control group, 35 samples of the cancer group, 12 samples of squamous carcinoma, 6 samples of small cell carcinoma, 9 samples of adenocarcinoma, 2 samples of large cell carcinoma and 6 samples of lung cancer which is not classified clearly are included in the 35 samples of cancer group.
The test process comprises the following steps:
a. sputum specimens of patients diagnosed with lung cancer and non-lung cancer were collected, and after being de-thickened with DTT, the cells were separated by centrifugation, washed 2 times with PBS, and then DNA was extracted using the DNA extraction Kit (HiPure FFPEDNA Kit, D3126-03) of Meiji Bio Inc. (Magen).
b. The bisulphite modification of DNA was carried out using the DNA conversion Kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH Bio Inc.
c. The liquid preparation system is as follows:
TABLE 4 liquid formulation system
d. The amplification system was as follows:
TABLE 5 amplification System
e. The detection results are as follows:
TABLE 6 detection results in sputum
The ROC curves of HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 detected in the sputum specimen are shown in fig. 2, and the statistical results are shown in table 6, and it can be seen from the above results that, when 5 genes are simultaneously detected and compared in the sputum specimen, the detection effect of HOXA9 is superior to that of the other 4 genes regardless of whether the lung cancer is compared and analyzed as a whole or according to the subtype of the lung cancer. Particularly, the detection effect on adenocarcinoma is that the detection rate of HOXA9 is far higher than that of other genes. Adenocarcinoma is generally peripheral, and due to the dendritic physiological structure of bronchi, exfoliated cells in the deep lung are more difficult to expectorate through sputum, and most tumor markers are ineffective or have reduced efficacy when the sputum is used as a detection sample, for example, in the present invention, SHOX2, which has the highest sensitivity to adenocarcinoma in tissues, has the sensitivity greatly reduced to 11.1% in the sputum, so that the detection of the part is more difficult and meaningful.
Example 3: detection of HOXA9 and SHOX2 genes in sputum
There are a number of documents showing that SHOX2 can be used as a marker for detecting lung cancer, and there are patents [ CN 201510203539-method and kit for diagnosing methylation of human SHOX2 gene and human RASSF1A gene-application publication ], SHOX2 has a high detection rate in samples of alveolar lavage fluid, lesion site tissue, pleural fluid, sputum, and the like. In order to verify the detection effect of HOXA9, in this example, the detection efficiency of SHOX2 gene was determined using primer and probe sequences disclosed in patent CN201510203539, and SHOX2 gene was expressed as SHOX2_ n3, to be distinguished from SHOX2 gene detected using self-designed primers and probes in examples 1 and 2 of the present invention.
The gene detection primer probes are as follows:
the detection primers and probes for HOXA9 were:
SEQ ID NO: 1HOXA9-F2 primer F: TTAGTTTTTTCGGTAGGCGGC
SEQ ID NO: 2HOXA9-R2 primer R: AAACGCCAAACACCGTCG
SEQ ID NO: 3HOXA9-P2 probe:
FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1
the detection primers and probes for SHOX2_ n3 were:
SEQ ID NO: 19SHOX2_ n3 primer F: TTTGGATAGTTAGGTAATTTTCG
SEQ ID NO: 20SHOX2_ n3 primer R: CGTACACGCCTATACTCGTACG
SEQ ID NO: 21SHOX2_ n3.2 Probe:
FAM-CCCCGATCGAACAAACGAAAC-BQ1
a. the liquid preparation system is as follows:
TABLE 7 compounding System
|
HOXA9
|
SHOX2_n3
|
β-actin
|
Reaction component
|
Addition amount (ul)
|
Addition amount (ul)
|
Addition amount (ul)
|
Upstream primer (100uM)
|
0.125
|
0.125
|
0.125
|
Downstream primer (100)uM)
|
0.125
|
0.125
|
0.125
|
Probe (100uM)
|
0.05
|
0.05
|
0.05
|
Magnesium ion (25mM)
|
4
|
5
|
5
|
dNTPs(10mM)
|
1
|
1
|
1
|
Taq polymerase (5unit/ul)
|
0.5
|
0.5
|
0.5
|
5 Xbuffer solution
|
5
|
5
|
5
|
Sterilized water
|
13.2
|
12.2
|
12.2
|
Template DNA
|
1
|
1
|
1
|
Total volume
|
25
|
25
|
25 |
b. The amplification system was as follows:
TABLE 8 amplification System
TABLE 9SHOX 2n3 reaction procedure
c. The detection results are as follows:
calculating the methylation copy number of each gene in a specimen by using a standard curve, judging the methylation degree of two groups of samples by adopting a ratio of the methylation copy number to the ACTB copy number 100, finally selecting a HOXA9 threshold value of 2.3 and a SHOX2_ n3 threshold value of 1.3 as standards for judging a cancer group and a control group, and judging the methylation copy number of each gene in the specimen to be positive "+" when the converted ratio exceeds a set threshold value and judging the methylation copy number to be negative "-" when the converted ratio is equal to or less than the set threshold value. According to this standard, the results of 90 sputum specimens were as follows:
TABLE 10 test results
d. Analysis of results
TABLE 11 statistical results
The ROC curve of the detection of HOXA9 and SHOX2_ n3 in all sputum specimens is shown in FIG. 3, and the amplification curve of HOXA9 and SHOX2_ n3 in the sputum specimens is shown in FIG. 4. from the above results, it can be seen that the detection effect of HOXA9 is superior to that of the SHOX2 gene in the sputum samples, regardless of the comparative analysis of lung cancer as a whole or according to the subtype of lung cancer. Particularly, the detection effect on adenocarcinoma is that the detection rate of HOXA9 is far higher than 33.3% of SHOX2 gene, adenocarcinoma is generally peripheral, and cast-off cells in the deep lung are more difficult to expectorate through sputum due to the dendritic physiological structure of bronchus. The invention discovers a marker which can detect adenocarcinoma by taking sputum as a sample for the first time and can greatly increase the sensitivity to 55.6%, and the breakthrough has great significance for detecting adenocarcinoma.
Example 4: detection of HOXA9 and SHOX2 genes in lavage fluid
Sample information: the total number of alveolar lavage fluid samples tested was 79, 58 samples of the normal control group, 21 samples of the cancer group, 6 samples of squamous cell carcinoma, 4 samples of small cell carcinoma, and 11 samples of adenocarcinoma in the 21 cancer group.
The test process comprises the following steps:
a. alveolar lavage fluid specimens of patients diagnosed with lung cancer and non-lung cancer were collected, cells were centrifuged, and then DNA was extracted using a DNA extraction Kit from magenta (HiPure FFPE DNA Kit, D3126-03).
b. The bisulphite modification of DNA was carried out using the DNA conversion Kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH Bio Inc.
c. The amplification detection system is as follows:
TABLE 12 amplification System
|
HOXA9
|
SHOX2_n3
|
β-actin
|
Reaction component
|
Addition amount (ul)
|
Addition amount (ul)
|
Addition amount (ul)
|
Upstream primer (100uM)
|
0.125
|
0.125
|
0.125
|
Downstream primer (100uM)
|
0.125
|
0.125
|
0.125
|
Probe (100uM)
|
0.05
|
0.05
|
0.05
|
Magnesium ion (25mM)
|
4
|
5
|
5
|
dNTPs(10mM)
|
1
|
1
|
1
|
Taq polymerase (5unit/ul)
|
0.5
|
0.5
|
0.5
|
5 Xbuffer solution
|
5
|
5
|
5
|
Sterilized water
|
13.2
|
12.2
|
12.2
|
Template DNA
|
1
|
1
|
1
|
Total volume
|
25
|
25
|
25 |
d. The detection system is as follows:
TABLE 13 test System
TABLE 14 SHOX2n3 reaction procedure
e. The detection results are as follows:
calculating the methylation copy number of each gene in a specimen by using a standard curve, judging the methylation degree of two groups of samples by adopting a ratio of the methylation copy number to the ACTB copy number 100, finally selecting a HOXA9 threshold value of 0.5 and a SHOX2_ n3 threshold value of 0.6 as standards for judging a cancer group and a control group, and judging the methylation copy number of each gene in the specimen to be positive "+" when the converted ratio exceeds a set threshold value and judging the methylation copy number to be negative "-" when the converted ratio is equal to or less than the set threshold value. According to this standard, the results of the detection of 79 lavage samples are as follows:
TABLE 15 test results
Table 16 analysis results
The results of examination of HOXA9 and SHOX2_ n3 in all lavage samples are shown in fig. 5, and the results of amplification are shown in fig. 6, and from the results, it can be seen that in the lavage samples, HOXA9 and SHOX2 were examined simultaneously, lung cancer was analyzed in comparison as a whole, the detection rate of HOXA9 was 61.9% and higher than 52.4% of SHOX2, and in comparison analysis according to the subtype of lung cancer, the detection rate of HOXA9 was higher than that of SHOX2_ n3, and since adenocarcinoma is generally peripheral, alveolar lavage fluid does not easily contact with deep lung alveoli or cancerous tissues due to the dendritic physiological structure of bronchi, and therefore, detection of this part was more difficult and meaningful. Furthermore, for small cell carcinoma, the sensitivity of HOXA9 was up to 100%, significantly higher than 75.0% of SHOX 2.
By combining the above 4 embodiments, it can be fully demonstrated that HOXA9 has better detection effect on lung cancer detection and diagnosis, especially on biological samples such as sputum and alveolar lavage fluid. The method can be more easily applied to large-scale crowd screening, and has more excellent social and economic values.
Example 5: effect of detection region, primer and probe of HOXA9 on detection Effect
Various research data show that the methylation state and distribution of the same gene are not uniform, so that for the same gene, methylation primers and probe detection systems designed by selecting different regions have different diagnostic detection efficiencies on the same sample, the same tumor has different diagnostic detection efficiencies, even the selected regions are not suitable for completely having no diagnostic effect on the tumor, and the inventor repeatedly researches and compares a plurality of detection regions, and partial exemplary detection regions are shown in the following table 17.
TABLE 17 sequences to be detected
We designed different methylation primers and probes according to sequence region 1, region 2 and region 3, and the information of each primer and probe is shown in Table 18, wherein group 1, group 2, group 3, group 4 and group 5 are methylation primers and probes designed according to region 1; group 6, group 7, group 8 are methylation primers and probes designed according to region 2; groups 9, 10, 11 are methylation primers and probes designed based on region 3 (see Table 20 for primer and probe sequences).
The above 11 primer probe sets were tested on 36 lung tissue samples, wherein 11 normal tissue samples, 25 cancer tissue samples, 4 squamous carcinomas and 21 adenocarcinoma samples were detected in 25 cancer group samples. The results are shown in the following table.
TABLE 18 results of measurements in tissues
The results show that regardless of the design of primers and probes for regions 2 and 3, the detection sensitivity for these two regions can only reach 32% at the highest, whereas regardless of the primers and probes designed according to the present invention, the detection sensitivity for region 1 can reach 40% at the lowest and 76% at the highest. Thus, the detection rate for region 1 was significantly higher than for regions 2 and 3 (see table 18).
Based on the detection results of each set of primer probes, preferred detection sequences are shown in Table 19 below.
TABLE 19 optimized test sequences
Second, influence of primer and probe on detection effect
In addition to the detection effect influenced by the detection region, the primers and probes also have great influence on the detection effect of the tumor marker, and in the research process, the inventor designs a plurality of pairs of primers and corresponding probes to find the probes and primers which improve the detection sensitivity and specificity as much as possible, so that the detection reagent of the invention can be practically applied to clinical detection. The partial primers and detection probes are shown in Table 20 below, and the detection results are shown in Table 21. All primers and probes were synthesized by England Shafer (Shanghai) trade Limited.
TABLE 20 primers and probes
TABLE 21 results of measurements in tissues
Group of
|
Primer probe combination
|
Specificity of
|
Sensitivity of the reaction
|
Group 1
|
H9-F2,H9-R2,H9-P2
|
100%
|
76%
|
Group 2
|
H9-F3,H9-R3,H9-P3
|
100%
|
76%
|
Group 3
|
H9-F4,H9-R4,H9-P4
|
100%
|
40%
|
Group 4
|
H9-F5,H9-R5,H9-P5
|
100%
|
60%
|
Group 5
|
H9-F6,H9-R6,H9-P6
|
100%
|
68%
|
Group 6
|
H9-F7,H9-R7,H9-P7
|
100%
|
32%
|
Group 7
|
H9-F8,H9-R8,H9-P8
|
100%
|
20%
|
Group 8
|
H9-F9,H9-R9,H9-P9
|
100%
|
12%
|
Group 9
|
H9-F10,H9-R10,H9-P10
|
100%
|
16%
|
Group |
10
|
H9-F11,H9-R11,H9-P11
|
100%
|
24%
|
Group 11
|
H9-F12,H9-R12,H9-P12
|
100%
|
24% |
The above 11 primer probe sets were tested on 36 lung tissue samples, wherein 11 normal tissue samples, 25 cancer tissue samples, 4 squamous carcinomas and 21 adenocarcinoma samples were detected in 25 cancer group samples. The results show that group 1, group 2, group 4, and group 5 all have better detectable rates.
In order to further verify the detection rate of the sputum, 22 sputum specimens were selected for verification, including 7 normal controls, 15 lung cancer controls, 7 squamous cancers, 7 adenocarcinoma and 1 large cell cancer in 15 lung cancers, and the detection results are shown in table 22 below.
TABLE 22 test results in sputum
Group of
|
Primer probe combination
|
Specificity of
|
Sensitivity of the reaction
|
Group 1
|
H9-F2,H9-R2,H9-P2
|
100%
|
66.7%
|
Group 2
|
H9-F3,H9-R3,H9-P3
|
100%
|
44.6%
|
Group 4
|
H9-F5,H9-R5,H9-P5
|
100%
|
33.3%
|
Group 5
|
H9-F6,H9-R6,H9-P6
|
100%
|
40.0% |
From the results of 22 sputum specimens, group 1: the detection rates of H9-F2, H9-R2 and H9-P2 are the highest and reach 66.7 percent. Although the sensitivity of both group 1 and group 2 in the tissue sample can reach 76%, the sensitivity of group 2 in the sputum detection sample is greatly reduced to 44.6%, which proves that the design of a detection reagent with high sensitivity is particularly difficult for the sputum sample.
Finally, the most preferred primer probe sequences are shown in Table 23 below according to the detection results of each primer probe set.
TABLE 23 optimized primers
Sequence listing
<110> Congliming Biotechnology, Inc. of Guangzhou City
<120> HOXA9 methylation detection reagent
<130>PT20181307-DD-P
<160>62
<170>SIPOSequenceListing 1.0
<210>1
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ttagtttttt cggtaggcgg c 21
<210>2
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
aaacgccaaa caccgtcg 18
<210>3
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
acgttggtcg agtatttcga ttttagttc 29
<210>4
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
tttaaagggt tcgtcgttta agtc 24
<210>5
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
aaacgattac tttcgcccg 19
<210>6
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ttagaaggta ggaggcggaa aattag 26
<210>7
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ttggttttta cggttttcga c 21
<210>8
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
aaattctccg aaacgctcg 19
<210>9
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
attcggtgcg tataggtatc gcgc 24
<210>10
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ttagtttcgg cgcgtagc 18
<210>11
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
cctaaaaccg acgcgatcta 20
<210>12
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
aaaacttacg atcgtctacc ctccg 25
<210>13
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
tttcggtagc gggtattgc 19
<210>14
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
aaaataacga cgaaccaacc g 21
<210>15
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
cgcgtttatg taggagtggt tgaggttc 28
<210>16
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
ttttggattg tgaatttgtg 20
<210>17
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
aaaacctact cctcccttaa a 21
<210>18
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
ttgtgtgttg ggtggtggtt 20
<210>19
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
tttggatagt taggtaattt tcg 23
<210>20
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
cgtacacgcc tatactcgta cg 22
<210>21
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
ccccgatcga acaaacgaaa c 21
<210>22
<211>345
<212>DNA
<213>Homo sapiens
<400>22
aatttccgtg ggtcgggccg ggcgggccag gcgctgggca cggtgatggc caccactggg 60
gccctgggca actactacgt ggactcgttc ctgctgggcg ccgacgccgc ggatgagctg 120
agcgttggcc gctatgcgcc ggggaccctg ggccagcctc cccggcaggc ggcgacgctg 180
gccgagcacc ccgacttcag cccgtgcagc ttccagtcca aggcgacggt gtttggcgcc 240
tcgtggaacc cagtgcacgc ggcgggcgcc aacgctgtac ccgctgcggt gtaccaccac 300
catcaccacc acccctacgt gcacccccag gcgcccgtgg cggcg 345
<210>23
<211>345
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>23
aattttcgtg ggtcgggtcg ggcgggttag gcgttgggta cggtgatggt tattattggg 60
gttttgggta attattacgt ggattcgttt ttgttgggcg tcgacgtcgc ggatgagttg 120
agcgttggtc gttatgcgtc ggggattttg ggttagtttt ttcggtaggc ggcgacgttg 180
gtcgagtatt tcgattttag ttcgtgtagt ttttagttta aggcgacggt gtttggcgtt 240
tcgtggaatt tagtgtacgc ggcgggcgtt aacgttgtat tcgttgcggt gtattattat 300
tattattatt atttttacgt gtatttttag gcgttcgtgg cggcg 345
<210>24
<211>1898
<212>DNA
<213>Homo sapiens
<400>24
gacaggacgg ggccatttcg gagttcattg tgtcggccac ttccctcttc caggcgcggg 60
tgcaggaagg ggcacccagt cggtatccgc gcggcttggc agcctcgctg gtatttggga 120
gtcccagccg gaagtgtgtc agggtgtttg agggggggat tactggaact gctggtgagg 180
atgaaggcaa aagagagaga gagagatgga agcgcccgag gccgccagcc tcgccgccag 240
ggaagtgggc taatgaaaaa cacactgttg caggcacagt atccacacgt gaatttgatt 300
acccctgttc taggagtcgc tgctttctgt taggaattgg gggcaggggg agtttccttc 360
caattaacgg agtggcggcg accttttaat ttacccccaa cgggtgagaa ataaacttcc 420
ccaacgtggc caggcccagg aatgggactg gagtcgatgc ccttttaccc ctccccgttc 480
taatttccag ccctggcctt gagctgtggc tgcctctctt tgggccttgt acctctccgc 540
cgagtctccg ggccccgtag gtaaccaagg cgaggcccgg agtagcagct ggaaagggag 600
gaaggagccc tgaaaggctc acgcggcccc gggacaggcc acatcggtgc gggcctccca 660
ggttccggag ctgcggggtc tcttaggcga ggctgccttt tcccaaaccg aacttgcctt 720
ccattcatgc cacttgtagt tttttcccca gctgggattc acggagcgca accaggcttg 780
cagcgctcat ggttagagcc tctgaggctg gagcacaggg ctgggtcgcc agccgcctgc 840
gcctgggaat cctgattgcc agctgatgag aaaggcgggc tgggcgcgcg tgtgcgtggg 900
gtcgagggcc ggggaccgag cgcgccgcac aaccaaccag gccctcaaaa ccttcgccct 960
ggtggcggct ggccgctccc tcctggccag ctcctccgtg gggtcctcgt agcaaaggcg 1020
aatttaaggg ttgcccgggc gcccctcgct ccaggcgggt agctgtgggg acctacaccc 1080
gcggtactcc ctgagcggcc ggtccctgcc tggagtgccc tggtagggcc ggcggcggct 1140
ccgtttggga cggatcctgc gttgaatttg acttttcgag ggcggccgcg ggtaaactcg 1200
cctctcccgg ggaccgcagg gattatttac agggagctcg ccaaccaaac acaacagtct 1260
aacctttcca agtcctcgta aatttttaca gctgggagcc acggcgaggc aaacgaatct 1320
gttggtcgtt tccgacttcc cgccagcctg tgtggcttct gaaacaataa ctccttatga 1380
aatatcataa atatagattt aaatacagta gagcgacaat gcgatttggc tgctttttta 1440
tggcttcaat tattgtctaa ttttatgtga ggggctccgc tggccgcact cgcacgcggg 1500
acccgcgcct tcttgatggc gtgattaatt gtgatataaa atagtccgct taagaagtgt 1560
gtgtatgggg ggggagacgg gagagtacag agacaaggct agatttgatc ttttaatcgt 1620
cgttggccac aattaaaaca aaccccatcg tagagcggca cgatcccttt acataaaaac 1680
atatggcttt tgctataaaa attatgactg caaaacatcg gaccattaat agcgtgcgga 1740
gtgatttacg cgttattgtt ctgctggacg ggcacgtgac gcgcacggcc aatgggggcg 1800
cgggcgccgg caacttatta ggtgactgta cttccccccc ggtgccacca agttgttaca 1860
tgaaatctgc agtttcataa tttccgtggg tcgggccg 1898
<210>25
<211>1898
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>25
gataggacgg ggttatttcg gagtttattg tgtcggttat tttttttttt taggcgcggg 60
tgtaggaagg ggtatttagt cggtattcgc gcggtttggt agtttcgttg gtatttggga 120
gttttagtcg gaagtgtgtt agggtgtttg agggggggat tattggaatt gttggtgagg 180
atgaaggtaa aagagagaga gagagatgga agcgttcgag gtcgttagtt tcgtcgttag 240
ggaagtgggt taatgaaaaa tatattgttg taggtatagt atttatacgt gaatttgatt 300
atttttgttt taggagtcgt tgttttttgt taggaattgg gggtaggggg agtttttttt 360
taattaacgg agtggcggcg attttttaat ttatttttaa cgggtgagaa ataaattttt 420
ttaacgtggt taggtttagg aatgggattg gagtcgatgt ttttttattt tttttcgttt 480
taatttttag ttttggtttt gagttgtggt tgtttttttt tgggttttgt attttttcgt 540
cgagttttcg ggtttcgtag gtaattaagg cgaggttcgg agtagtagtt ggaaagggag 600
gaaggagttt tgaaaggttt acgcggtttc gggataggtt atatcggtgc gggtttttta 660
ggtttcggag ttgcggggtt ttttaggcga ggttgttttt ttttaaatcg aatttgtttt 720
ttatttatgt tatttgtagt ttttttttta gttgggattt acggagcgta attaggtttg 780
tagcgtttat ggttagagtt tttgaggttg gagtataggg ttgggtcgtt agtcgtttgc 840
gtttgggaat tttgattgtt agttgatgag aaaggcgggt tgggcgcgcg tgtgcgtggg 900
gtcgagggtc ggggatcgag cgcgtcgtat aattaattag gtttttaaaa ttttcgtttt 960
ggtggcggtt ggtcgttttt ttttggttag ttttttcgtg gggttttcgt agtaaaggcg 1020
aatttaaggg ttgttcgggc gtttttcgtt ttaggcgggt agttgtgggg atttatattc 1080
gcggtatttt ttgagcggtc ggtttttgtt tggagtgttt tggtagggtc ggcggcggtt 1140
tcgtttggga cggattttgc gttgaatttg atttttcgag ggcggtcgcg ggtaaattcg 1200
tttttttcgg ggatcgtagg gattatttat agggagttcg ttaattaaat ataatagttt 1260
aattttttta agttttcgta aatttttata gttgggagtt acggcgaggt aaacgaattt 1320
gttggtcgtt ttcgattttt cgttagtttg tgtggttttt gaaataataa ttttttatga 1380
aatattataa atatagattt aaatatagta gagcgataat gcgatttggt tgttttttta 1440
tggttttaat tattgtttaa ttttatgtga ggggtttcgt tggtcgtatt cgtacgcggg 1500
attcgcgttt ttttgatggc gtgattaatt gtgatataaa atagttcgtt taagaagtgt 1560
gtgtatgggg ggggagacgg gagagtatag agataaggtt agatttgatt ttttaatcgt 1620
cgttggttat aattaaaata aattttatcg tagagcggta cgattttttt atataaaaat 1680
atatggtttt tgttataaaa attatgattg taaaatatcg gattattaat agcgtgcgga 1740
gtgatttacg cgttattgtt ttgttggacg ggtacgtgac gcgtacggtt aatgggggcg 1800
cgggcgtcgg taatttatta ggtgattgta tttttttttc ggtgttatta agttgttata 1860
tgaaatttgt agttttataa ttttcgtggg tcgggtcg 1898
<210>26
<211>947
<212>DNA
<213>Homo sapiens
<400>26
cccaggcgcc cgtggcggcg gcggcgccgg acggcaggta catgcgctcc tggctggagc 60
ccacgcccgg tgcgctctcc ttcgcgggct tgccctccag ccggccttat ggcattaaac 120
ctgaaccgct gtcggccaga aggggtgact gtcccacgct tgacactcac actttgtccc 180
tgactgacta tgcttgtggt tctcctccag ttgatagaga aaaacaaccc agcgaaggcg 240
ccttctctga aaacaatgct gagaatgaga gcggcggaga caagcccccc atcgatccca 300
gtaagtgtct cctcccttca aatccgccgc cgcctccacg ccggcctccc ggatctgctg 360
gcccgccagg tttctctcga gcctgccttc gtcctcgctg gaagcctctc gagttggggc 420
caggagccag aagttggtgt ttgggacgcc tcagataggg ccccaagtct ggagagcagt 480
gaagagcggc ccgcagggct acgggagagg aggcggctgc tgcagcgaga gggggcgggg 540
cgggcacttc gggacgagcc aagactggcc gcccctctcc ttggctgccc aggcccagga 600
ccgagatact ttgggccgtt cttcgaaagc agtgcagccc agagagcctt ttgtacaact 660
agattgtccg tgagcggcgg cagccagggc agccggagct gggacgctgg gggagacggc 720
cgattccttc cacttcttgc cttcggccag tggcggcgta aatcctgcca agatgaggct 780
gcgggcgacc cgggccacaa gggtccccat gacagattat tcaaataagc cacagacgtg 840
atcagcggcc ttagggcgcc ctgacggctt gcccagctcc gaaggccttc caggaaggtt 900
aaataaggag tggggggcgt agagggacag gttgggaaag aaagacg 947
<210>27
<211>947
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>27
tttaggcgtt cgtggcggcg gcggcgtcgg acggtaggta tatgcgtttt tggttggagt 60
ttacgttcgg tgcgtttttt ttcgcgggtt tgttttttag tcggttttat ggtattaaat 120
ttgaatcgtt gtcggttaga aggggtgatt gttttacgtt tgatatttat attttgtttt 180
tgattgatta tgtttgtggt ttttttttag ttgatagaga aaaataattt agcgaaggcg 240
ttttttttga aaataatgtt gagaatgaga gcggcggaga taagtttttt atcgatttta 300
gtaagtgttt ttttttttta aattcgtcgt cgtttttacg tcggtttttc ggatttgttg 360
gttcgttagg tttttttcga gtttgttttc gttttcgttg gaagtttttc gagttggggt 420
taggagttag aagttggtgt ttgggacgtt ttagataggg ttttaagttt ggagagtagt 480
gaagagcggt tcgtagggtt acgggagagg aggcggttgt tgtagcgaga gggggcgggg 540
cgggtatttc gggacgagtt aagattggtc gttttttttt ttggttgttt aggtttagga 600
tcgagatatt ttgggtcgtt tttcgaaagt agtgtagttt agagagtttt ttgtataatt 660
agattgttcg tgagcggcgg tagttagggt agtcggagtt gggacgttgg gggagacggt 720
cgattttttt tattttttgt tttcggttag tggcggcgta aattttgtta agatgaggtt 780
gcgggcgatt cgggttataa gggtttttat gatagattat ttaaataagt tatagacgtg 840
attagcggtt ttagggcgtt ttgacggttt gtttagtttc gaaggttttt taggaaggtt 900
aaataaggag tggggggcgt agagggatag gttgggaaag aaagacg 947
<210>28
<211>972
<212>DNA
<213>Homo sapiens
<400>28
agcccggggc ggggtggggc tggagctcct gtctcttggc cagctgaatg gaggcccagt 60
ggcaacacag gtcctgcctg gggatcaggt ctgctctgca ccccaccttg ctgcctggag 120
ccgcccacct gacaacctct catccctgct ctgcagatcc ggtcccatcc ccactgccca 180
ccccaccccc ccagcactcc acccagttca acgttccacg aacccccaga accagccctc 240
atcaacaggc agcaagaagg gccccccgcc catcgcccca caacgccagc cgggtgaacg 300
ttggcaggtc ctgaggcagc tggcaagacg cctgcagctg aaagatacaa ggccagggac 360
aggacagtcc catccccagg aggcagggag tatacaggct ggggaagttt gcccttgcgt 420
ggggtggtga tggaggaggc tcagcaagtc ttctggactg tgaacctgtg tctgccactg 480
tgtgctgggt ggtggtcatc tttcccacca ggctgtggcc tctgcaacct tcaagggagg 540
agcaggtccc attggctgag cacagccttg taccgtgaac tggaacaagc agcctccttc 600
ctggccacag gttccatgtc cttatatgga ctcatctttg cctattgcga cacacactca 660
gtgaacacct actacgcgct gcaaagagcc ccgcaggcct gaggtgcccc cacctcacca 720
ctcttcctat ttttgtgtaa aaatccagct tcttgtcacc acctccaagg agggggagga 780
ggaggaaggc aggttcctct aggctgagcc gaatgcccct ctgtggtccc acgccactga 840
tcgctgcatg cccaccacct gggtacacac agtctgtgat tcccggagca gaacggaccc 900
tgcccacccg gtcttgtgtg ctactcagtg gacagaccca aggcaagaaa gggtgacaag 960
gacagggtct tc972
<210>29
<211>972
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>29
agttcggggc ggggtggggt tggagttttt gttttttggt tagttgaatg gaggtttagt 60
ggtaatatag gttttgtttg gggattaggt ttgttttgta ttttattttg ttgtttggag 120
tcgtttattt gataattttt tatttttgtt ttgtagattc ggttttattt ttattgttta 180
ttttattttt ttagtatttt atttagttta acgttttacg aatttttaga attagttttt 240
attaataggt agtaagaagg gtttttcgtt tatcgtttta taacgttagt cgggtgaacg 300
ttggtaggtt ttgaggtagt tggtaagacg tttgtagttg aaagatataa ggttagggat 360
aggatagttt tatttttagg aggtagggag tatataggtt ggggaagttt gtttttgcgt 420
ggggtggtga tggaggaggt ttagtaagtt ttttggattg tgaatttgtg tttgttattg 480
tgtgttgggt ggtggttatt ttttttatta ggttgtggtt tttgtaattt ttaagggagg 540
agtaggtttt attggttgag tatagttttg tatcgtgaat tggaataagt agtttttttt 600
ttggttatag gttttatgtt tttatatgga tttatttttg tttattgcga tatatattta 660
gtgaatattt attacgcgtt gtaaagagtt tcgtaggttt gaggtgtttt tattttatta 720
ttttttttat ttttgtgtaa aaatttagtt ttttgttatt atttttaagg agggggagga 780
ggaggaaggt aggttttttt aggttgagtc gaatgttttt ttgtggtttt acgttattga 840
tcgttgtatg tttattattt gggtatatat agtttgtgat tttcggagta gaacggattt 900
tgtttattcg gttttgtgtg ttatttagtg gatagattta aggtaagaaa gggtgataag 960
gatagggttt tt 972
<210>30
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>30
aattttcgtg ggtcgggtc 19
<210>31
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>31
ccaaacaccg tcgccttaa 19
<210>32
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>32
acgtggattc gtttttgttg ggc 23
<210>33
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>33
cgtcgcggat gagttgagc 19
<210>34
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>34
cacgaacgcc taaaaataca cg 22
<210>35
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>35
tggtcgttat gcgtcgggga tt 22
<210>36
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>36
agcgttggtc gttatgcgtc 20
<210>37
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>37
ccaaacaccg tcgccttaaa c 21
<210>38
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>38
gacgttggtc gagtatttcg attttag 27
<210>39
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>39
cgacgttggt cgagtatttc 20
<210>40
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>40
gccacgaacg cctaaaaat 19
<210>41
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>41
ttagtttaag gcgacggtgt ttgg 24
<210>42
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>42
cgttttggtg gcggttggtc 20
<210>43
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>43
aataatccct acgatccccg a 21
<210>44
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>44
gggcgttttt cgttttaggc gg 22
<210>45
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>45
tcgtttggga cggattttgc 20
<210>46
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>46
acaaattcgt ttacctcgcc g 21
<210>47
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>47
attcgttttt ttcggggatc gtagg 25
<210>48
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>48
aatagcgtgc ggagtgattt ac 22
<210>49
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>49
cgacccgacc cacgaaaat 19
<210>50
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>50
cgttattgtt ttgttggacg ggtacg 26
<210>51
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>51
tttaggcgtt cgtggcggc 19
<210>52
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>52
cccttctaac cgacaacgat tc 22
<210>53
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>53
cggacggtag gtatatgcgt ttttgg 26
<210>54
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>54
aattcgtcgt cgtttttacg tc 22
<210>55
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>55
tcccgtaacc ctacgaaccg 20
<210>56
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>56
tcggatttgt tggttcgtta ggtttttttc 30
<210>57
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>57
ttagattgtt cgtgagcggc 20
<210>58
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>58
ttataacccg aatcgcccg 19
<210>59
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>59
ttgggacgtt gggggagacg gt 22
<210>60
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>60
ttttggattt aaggggaaga taaa 24
<210>61
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>61
tttttccttc tctacatctt tctacct 27
<210>62
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>62
aagggaaatt gagaaatgag agaaggga 28