WO2020063903A1 - Hoxa9 methylation detection reagent - Google Patents

Abstract

Disclosed is a reagent and a kit for detecting the methylation of HOXA9 gene, wherein same are used for the detection and diagnosis of lung cancer.

Description

HOXA9 methylation detection reagent Technical field

The present disclosure belongs to the field of gene diagnosis, and more particularly, the present disclosure relates to a lung cancer diagnosis reagent or a kit containing the same based on human HOXA9 gene methylation.

technical background

Lung cancer is a malignant tumor of the lungs that originates from the bronchial mucosa, glands, or alveolar epithelium. According to the pathological type, it can be divided into: 1. Small cell lung cancer (SCLC): A special pathological type of lung cancer with a significant distant metastasis tendency and a poor prognosis, but most patients are sensitive to chemoradiotherapy. 2. Non-small cell lung cancer (NSCLC): In addition to small cell lung cancer, other pathological types of lung cancer, including squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. There are certain differences in biological behavior and clinical course. According to the occurrence location, it can be divided into: 1. Central lung cancer: Lung cancer that grows in the bronchus opening of the lung segment and above. 2. Peripheral lung cancer: Lung cancer that grows beyond the bronchial openings in the lung segment.

Early diagnosis and early operation of lung cancer is one of the most effective methods to improve the 5-year survival rate and reduce mortality of lung cancer.

The current clinical auxiliary diagnosis of lung cancer mainly includes the following types, but they can not completely detect and diagnose early:

1. Blood biochemical examination: For primary lung cancer, there is currently no specific blood biochemical examination. Elevated blood alkaline phosphatase or calcium in patients with lung cancer considers the possibility of bone metastasis, and elevated blood alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, or bilirubin consider the possibility of liver metastasis.

2. Tumor marker examination: (1) CEA: 30% to 70% of lung cancer patients have abnormally high levels of CEA in serum, but mainly found in patients with advanced lung cancer. The current examination of CEA in serum is mainly used to estimate the prognosis of lung cancer and to monitor the treatment process. (2) NSE: It is the first choice marker of small cell lung cancer. It is used for the diagnosis and monitoring of treatment response of small cell lung cancer. Depending on the detection method and the reagents used, the reference value is different. 3) CYFRA21-1: It is the first choice marker for non-small cell lung cancer, and the sensitivity to lung squamous cell carcinoma can reach 60%. The reference value varies according to the detection method and the reagents used.

3. Imaging examination: (1) X-ray examination of the chest: it should include chest upright and lateral radiographs. In primary hospitals, chest orthotopic radiography is still the most basic and preferred imaging diagnostic method for the first diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, a chest CT scan is performed. (2) CT examination: Chest CT is the most common and important examination method for lung cancer. It is used for the diagnosis and differential diagnosis of lung cancer, staging and follow-up after treatment. Conditional hospitals should include adrenal glands when performing chest CT scans of lung cancer patients. Enhanced scanning should be used as much as possible, especially in patients with lung-centric lesions. CT is the basic examination method for showing brain metastases. Patients with clinical symptoms or advanced patients should undergo brain CT scans, and enhanced scans should be used whenever possible. CT-guided lung biopsy is an important diagnostic technique for lung cancer. Conditional hospitals can use it for the diagnosis of difficult-to-characterize lung lesions, and clinical diagnosis of lung cancer requires cytological and histological confirmation, but other methods are difficult to obtain. Case. (3) Ultrasound examination: It is mainly used to detect the presence of metastases in the abdominal organs and lymph nodes in the abdominal cavity and retroperitoneum. It is also used in the examination of cervical lymph nodes. For lung lesions or chest wall lesions adjacent to the chest wall, cystic solidity can be identified and ultrasound-guided puncture biopsy can be performed; ultrasound is also commonly used for pleural fluid extraction and localization. (4) Bone scan: The sensitivity to lung cancer bone metastasis is high, but there is a certain false positive rate. It can be used in the following cases: preoperative examination of lung cancer; patients with local symptoms.

4. Other examinations: (1) sputum cytology examination: currently a simple and convenient non-invasive diagnosis method for lung cancer. Continuous smear examination can increase the positive rate by about 60%, which is a routine diagnosis method for suspicious lung cancer cases. (2) Fiber bronchoscopy: One of the most important methods in the diagnosis of lung cancer, it plays an important role in the qualitative localization diagnosis of lung cancer and the selection of surgical schemes. It is a necessary routine examination item for patients who are going to undergo surgery. Transbronchoscopic biopsy (TBNA) is helpful for staging before treatment, but because of technical difficulties and risks, those in need should be transferred to a higher level hospital for further examination. (3) Others: such as percutaneous lung biopsy, thoracoscopy biopsy, mediastinoscopy biopsy, pleural fluid cytology, etc., if there are indications, they can be used separately to assist diagnosis according to the existing conditions.

Multi-slice spiral CT and low-dose CT (LDCT) in imaging studies are effective screening tools to detect early lung cancer and reduce mortality. The National Lung Cancer Screening Study (NLST) has shown that LDCT is more effective than chest X-ray screening. Reduce lung cancer mortality by 20%. It has been proved in clinical practice that the success of any lung cancer screening program depends on the identification of high-risk populations. A risk prediction model incorporating multiple high-risk factors has been recognized by the world as one of the methods to identify high-risk populations of lung cancer. Risk models further improve the efficacy of lung cancer patients by assisting clinicians to improve interventions or treatments. Although the world has agreed that screening for high-risk groups can reduce the current high mortality rate of lung cancer, the definition of high-risk groups is still a difficult problem. In order to maximize the benefit-to-injury ratio of lung cancer screening, the key question is first how to define the population at high risk of the disease; the second is how to screen the population, including the definition of high-risk factors, and the overall risk. Quantitative summary and selection of screening benefit cutoffs.

Existing lung cancer detection technologies mainly include low sensitivity, high false positives, and invasiveness. Moreover, it is difficult to detect early lung cancer with current conventional detection technologies.

Noninvasive tests for lung cancer, such as sputum testing, are more difficult. Although some researchers have also studied tumor markers in the sputum of patients with lung cancer, compared with the detection and evaluation of tumor markers in blood samples of other tumor patients, the success rate of sputum samples is very low.

This is because ① the composition of sputum is more complicated, and the differences in the composition and viscosity of sputum in different populations under different diseases or environments are large; ② sputum contains more tracheal epithelial cells and bacteria, oral mucosal cells, etc. For components of non-lung cancer cells, general sample processing methods cannot effectively enrich DNA from a sufficient number of lung cancer sources. ③ Many smokers do not exhibit sputum. AJ Hubers et al. In "Molecular analysis of diagnosis" of the past 10 literature studies show that the median degree of methylation of markers in lung cancer tissues is 48%, while the median sputum The degree of methylation was 38%, and the results showed that the detection rate of methylation markers in tissues was significantly higher than that in sputum. At the same time, Rosalia Cirincione (Methylation profile and sample samples of lung cancer patients detected by spiral computed computed tomography: A conneted case-contro) reported that RARbeta2, P16, and RASSF1A were detected in lung cancer tissues at rates of 65.5%, 41.4%, and 51.4%, respectively. % And only 44.4%, 5%, and 5% in sputum, respectively.

The current rate of missed detection of lung cancer is high. In particular, for this type of adenocarcinoma, noninvasive detection of sputum is more difficult and the detection rate is extremely low. This is because most adenocarcinomas originate from smaller bronchial tubes, which are peripheral lung cancers. It is more difficult to cough out sputum cells in the deep lungs. Therefore, the current sputum detection method for adenocarcinoma is almost zero.

Although some tumor markers related to lung cancer have been found in the prior art, the sensitivity and specificity of these tumor markers cannot meet the requirements due to the limited detection reagents or detection methods for these tumor markers. There is still a need in the art for further research on screening methods that can be practically applied to lung cancer. Although non-invasive screening has unique advantages in sampling, it also has some other limitations. For example, the type of adenocarcinoma in lung cancer, because the exfoliated cells in the deep lungs are difficult to cough through sputum, usually In other words, researchers would consider this type of lung cancer unsuitable for noninvasive screening.

On the other hand, even for other types of lung cancer, the currently reported non-invasive screening methods are difficult to meet the requirements for clinical use. Although related research has been progressing for many years, there is still no non-invasive screening method for lung cancer that can be promoted to clinical.

Summary of the Invention

The purpose of the present disclosure is to provide an application of a nucleic acid fragment of the HOXA9 gene in the diagnosis of lung cancer.

Another object of the present disclosure is to provide a primer and its application in preparing a lung cancer diagnostic reagent or kit.

Another object of the present disclosure is to provide a probe and its application in preparing a lung cancer diagnostic reagent or kit.

Another object of the present disclosure is to provide a reagent, a kit and a method for diagnosing human HOXA9 gene methylation.

Another object of the present disclosure is to provide a lung cancer diagnosis reagent and a kit with high specificity and sensitivity.

A further object of the present disclosure is to provide a lung cancer diagnosis reagent and a kit with high sensitivity and specificity for lung adenocarcinoma.

Another object of the present disclosure is to provide a lung cancer diagnostic reagent and a kit having a wide application range for lung cancer.

Another object of the present disclosure is to provide a non-invasive diagnostic reagent and kit for lung cancer.

The above objective of the present disclosure is achieved by the following technical means:

After intensive research, the inventors provided a detection reagent for HOXA9 gene methylation. The inventors not only verified that the detection reagent has high specificity and sensitivity for the detection of lung cancer in tissue samples, but also verified that they have the same high specificity and sensitivity in sputum samples and lavage fluid samples.

The HOXA9 gene is a member of the HOX (homebox homology box) gene family. It belongs to the HOXA cluster gene on chromosome 7p15-p14. Like other HOX genes, it contains a 180-bp DNA fragment and transcribes the same 60-amino acid homolog. Source domain. HOXA9 is a coding sequence-specific transcriptional regulatory factor. It plays an important role in the development of spatiotemporal space in embryos, cell differentiation, proliferation, and migration, malignant evolution of tumors, and inducing apoptosis. At present, more researches are concerned that the abnormal expression of HOXA9 plays an important role in the occurrence and development of leukemia. There are also reports of HOXA9 gene related to lung cancer, human glioma and other cancers.

A first aspect of the present disclosure provides an application of a nucleic acid fragment in preparing a diagnostic reagent or kit for lung cancer; wherein the nucleic acid fragment is derived from the HOXA9 gene. Specifically, the nucleic acid fragment includes a sequence shown in SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 26; as a preferred embodiment, the nucleic acid fragment includes a sequence shown in SEQ ID NO: 22 .

In another aspect, the present disclosure also provides a primer comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO : 34, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 46 , SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID ID NO: 58 Any one is shown; as a preferred embodiment in the present disclosure, the primer includes the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2.

In another aspect, the present disclosure also provides a probe comprising SEQ ID NO: 3, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ IDNO: 47, SEQ IDNO: 50, SEQ IDNO: 53, SEQ IDNO: 56, SEQ IDNO: 59. As a preferred embodiment in the present disclosure, the nucleic acid probe comprises a sequence shown in SEQ ID NO: 3.

In another aspect, the present disclosure also provides the application of the above-mentioned primers or nucleic acid probes in the preparation of a lung cancer diagnostic reagent or kit.

In another aspect, the present disclosure also provides a diagnostic reagent for lung cancer, the reagent containing a detection reagent for methylation of the HOXA9 gene.

Wherein, the detection reagent for methylation of the HOXA9 gene detects a sequence of the HOXA9 gene modified by a transformation reagent. Among them, the transformation reagent refers to a reagent that deaminates cytosine in DNA into uracil, and at the same time makes 5-MeC substantially unaffected. Exemplary transformation reagents include hydrazine, bisulfite (such as sodium bisulfite, etc.), bisulfite (such as sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.), Or, under appropriate reaction conditions, one or more compounds can be generated, such as hydrazine, bisulfite, and bisulfite. As an exemplary embodiment, the detection reagent for methylation of the HOXA9 gene detects a bisulfite-modified sequence.

Methylation occurs when there is an additional methyl group on cytosine. After treatment with bisulfite or bisulfite or hydrazine, cytosine will become uracil, because uracil and Thymine is similar and will be recognized as thymine. It is reflected in the PCR amplified sequence that thymine that has not been methylated has become thymine (C becomes T), and methylated cytosine (C) is not Will change. The technique for detecting methylated genes by PCR is usually methylation-specific PCR (MSP). Primers are designed for the methylated fragments after treatment (that is, the unchanged C in the fragments), and PCR amplification is performed. The presence of amplification indicates methylation, and the absence of amplification indicates no methylation. As an optional embodiment, the detection region of the HOXA9 gene targeted by the reagent is a CG-enriched region or a non-CG-enriched region or a CTCF (CTCF-binding sites) region of the HOXA9 gene. As a preferred embodiment, the detection region of the reagent is a CG-enriched region or a CTCF (CTCF-binding sites) region of the HOXA9 gene. Alternatively, the detection region targeted by the reagent is the genome of the HOXA9 gene or its promoter region.

As a preferred embodiment in the present disclosure, the detection region of the reagent includes a sequence represented by SEQ ID NO: 22 (Region 1), SEQ ID NO: 24 (Region 2), or SEQ ID NO: 26 (Region 3). As a more preferred embodiment, the detection region of the reagent includes a sequence shown in SEQ ID NO: 22.

The inventors have found through experiments that the selection of the HOXA9 gene detection region will affect the detection efficiency of the tumor. Primers designed according to the CG-rich region of the HOXA9 gene, and the primers designed in different regions have significant differences in detection results. The detection rate of tumors is 50% to 60% higher than that of poor areas. The inventors have found through experiments and comparisons that the detection results of GC-enriched regions or CTCF (CTCF-binding sites) regions are significantly better than non-hypermethylated regions.

The diagnostic reagent of the present disclosure includes an amplification primer. As an alternative embodiment, the primers include SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO : 36, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 48 At least one of SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 57, and SEQ ID NO: 58. As a preferred embodiment, the primers include primer pairs as shown in SEQ ID NO: 1 and SEQ ID NO: 2.

The primers are used to amplify a specific region of the HOXA9 gene. It is well known in the art that the successful design of primers is critical for PCR. Compared to ordinary PCR, the design of primers is more critical in the methylation detection of genes. This is because the methylation reaction promotes the conversion of "C" in the DNA strand to "U", resulting in a decrease in GC content and making PCR After the reaction, a long continuous "T" appears in the sequence, which easily causes the DNA strand to break, making it difficult to choose a primer with a suitable Tm value and stability; on the other hand, in order to distinguish between curing treatment and no curing treatment and incomplete treatment DNA requires a sufficient number of "C" s for the primers, all of which increase the difficulty of selecting stable primers. Therefore, in the detection of DNA methylation, the selection of the amplified fragment targeted by the primer, such as the length and position of the amplified fragment, and the selection of the primer, etc., have an impact on the sensitivity and specificity of the detection. The inventors also found through experiments that different amplification target fragments and primers have different detection effects. Many times, it is found that certain genes or nucleic acid fragments have differential expression in tumors and non-tumors, but their distance is converted into tumor markers, and there is still a long distance for clinical application. The most important reason is that the detection sensitivity and specificity of this potential tumor marker are difficult to meet the detection requirements due to the limitation of detection reagents, or the detection method is complicated and expensive to operate, and it is difficult to apply it in clinical practice on a large scale.

The diagnostic reagent of the present disclosure further contains a probe. As an alternative embodiment, the probe comprises SEQ ID NO: 3, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56 or SEQ ID NO: 59. As a preferred embodiment, the probe is shown in SEQ ID NO: 3. As a preferred mode of the present disclosure, for the convenience of clinical use, the detection probe-labeled fluorescent group includes VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED, Texas Red, etc .; the quenching group includes TAMRA, BHQ, MGB, Dabcyl, etc., are applicable to multi-channel PCR detection systems commonly used in clinical detection at present, and realize multi-color fluorescence detection in one reaction tube.

As a more preferred embodiment, the diagnostic reagent of the present disclosure includes a primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2 and a probe shown in SEQ ID NO: 3.

As an alternative embodiment, the reagents of the present disclosure further comprise bisulfite, bisulfite or hydrazine salts for modifying methylated cytosines to thymine. Of course, it may not be included in the reagent of the present disclosure. It can be purchased separately when used.

As an alternative embodiment, the present disclosure further comprises a DNA polymerase reagents, one or more dNTPs, Mg ²⁺ ions, buffer; preferably, comprising a DNA polymerase, dNTPs, Mg ²⁺ ions and buffer Solution for the amplification of HOXA9 gene.

As an optional embodiment, the reagents of the present disclosure further include a detection reagent for an internal reference gene. Preferably, the internal reference gene comprises β-actin or COL2A1. In addition to these two internal reference genes, other internal reference genes for methylation detection in the prior art can also be used. Further, the detection reagent for the internal reference gene includes a primer and a probe for the internal reference gene. As a preferred embodiment, the detection reagent for the internal reference gene β-actin includes a primer pair represented by SEQ ID NO: 16, SEQ ID NO: 17, and a probe of SEQ ID NO: 18. The detection reagent for the internal reference gene COL2A1 includes a primer pair shown by SEQ ID NO: 60 (TTTTGGATTTAAGGGGAAGATAAA) and SEQ ID NO: 61 (TTTTTCCTTCTCTACATCTTTCTACCT), and a probe of SEQ ID NO: 62 (AAGGGAAATTGAGAAATGAGAGAGAAGGGA).

Another aspect of the present disclosure provides a kit for the above-mentioned primers, probes, and diagnostic reagents for lung cancer.

As an optional embodiment, the kit of the present disclosure includes one or more containers divided into receiving reagents therein, provided that they contain at least one of the primers or probes of the present disclosure or other detection components.

In one embodiment, the kit may further include nucleic acid extraction reagents and materials.

In one embodiment, the kit may further include reagents and materials commonly used for amplifying nucleic acids, such as DNA polymerases, dNTPs, Mg ²⁺ ions, buffers, and the like.

In one embodiment, the kit may further include a conversion reagent that sensitively converts unmethylated cytosine.

In one embodiment, the kit includes a first container containing a reagent that sensitively converts unmethylated cytosine; a second container containing amplification primers; and a third container containing a probe.

In one embodiment, the kit further comprises instructions.

In one embodiment, the kit further comprises a sampling device.

Another aspect of the present disclosure provides a method for detecting DNA methylation of the HOXA9 gene, which includes the following steps:

(1) Treating the test sample with bisulfite or bisulfite or hydrazine to obtain a modified test sample;

(2) Use the above reagent or kit to perform the detection of the methylation of HOXA9 gene on the modified detection sample in step (1).

As an alternative, a methylation-specific polymerase chain reaction (MSP) or real-time fluorescent methylation-specific PCR (qMSP) is used for detection. The DNA methylation detection methods reported in the remaining prior art can also be applied in the present disclosure. The methylation detection method of the prior art can be incorporated into the present disclosure through the patent USSN62 / 175,916.

Another aspect of the present disclosure provides a diagnostic system for lung cancer, the system comprising:

a. The DNA methylation detection building block of the HOXA9 gene, and,

b. Result judgment component.

In one embodiment, the DNA methylation detecting member of the HOXA9 gene includes the above-mentioned reagent or kit.

In some embodiments, the methylation detection member includes one or more of a quantitative PCR instrument, a PCR instrument, and a sequencer.

In one embodiment, the result determining component is configured to output a diagnosis result such as a risk of lung cancer and / or a type of lung cancer according to a DNA methylation level of the HOXA9 gene detected by the detecting component.

In one embodiment, the diagnosis result is obtained by comparing a methylation level of the sample to be tested with a normal sample by a result judgment component, and based on a deviation between the methylation level of the sample to be tested and the normal sample.

In some embodiments, the result determination component includes a data processing machine.

In some embodiments, the data processing machine includes any device or instrument or device that can be used by those skilled in the art to perform data processing.

In some embodiments, the data processing machine includes one or more of a calculator and a computer. The computer is loaded with any software or program that can be used by those skilled in the art to perform data processing or statistical analysis. In some embodiments, the computer includes a computer with one or more of SPSS, SAS, Excel software attached.

In some embodiments, the result judgment component further includes a result outputter. The output device includes any device or instrument or device capable of displaying data processing results as readable content. In some embodiments, the result outputter includes one or more of a screen and a paper report.

Another aspect of the present disclosure provides a method for diagnosing lung cancer. The method includes the following steps:

(1) detecting the methylation level of HOXA9 gene from a test sample derived from a subject;

(2) Compare the methylation level of HOXA9 gene between the test sample and the normal sample;

(3) Diagnose lung cancer based on the deviation of the methylation level between the test sample and the normal sample.

In some embodiments, when the methylation level of the sputum sample to be tested is greater than 2.3%, the sample to be tested is a lung cancer sample, and when the methylation level is less than or equal to 2.3%, the sample to be tested is determined to be a non-lung cancer sample. .

In some embodiments, when the methylation level of the test lavage sample is greater than 0.5%, it is determined that the test sample is a lung cancer sample, and when the methylation level is 0.5% or less, the test sample is determined to be non- Lung cancer sample.

The diagnostic method of the present disclosure can be used before and after lung cancer treatment or in combination with lung cancer treatment. Post-treatment use can be used to evaluate the success of treatment or to monitor the remission, recurrence, and / or progression (including metastasis) of lung cancer after treatment.

Another aspect of the present disclosure provides a method for treating lung cancer. The method includes administering surgery, chemotherapy, radiotherapy, radiochemotherapy, immunotherapy, oncolytic virus therapy, or other methods for patients diagnosed with lung cancer by the above-mentioned diagnostic method. Any other type of lung cancer treatment used in the art and a combination of these treatments.

In the present disclosure, the reagent / kit / method test sample includes sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, prostate fluid, tear fluid, or feces. As a preferred embodiment, the detection sample of the diagnostic / detection reagent includes sputum, tissue, or lung lavage fluid. As a more preferred embodiment, the detection sample of the diagnostic / detection reagent contains sputum.

The methylation level of HOXA9 gene in tissues is highly correlated with the incidence of lung cancer. In 185 tissues, the HOXA9 gene normal group compared with all lung cancer groups has a specificity of 95% and a sensitivity of 78.6%, although the sensitivity is lower than that of the other tumor marker SHOX2 (sensitivity 80.6%) gene in the experiment disclosed, and It was surprisingly found that the methylation level of HOXA9 gene detected in sputum and lung lavage fluid also maintained a high correlation with the incidence of lung cancer. In sputum, the sensitivity of HOXA9 was 74.3%, specificity 95%; in lung lavage fluid, the sensitivity was 61.9%, specificity 95%.

Among the various molecular markers studied by the inventors, none of them is that the detection sensitivity or specificity of sputum samples is significantly lower than that of tissue samples. For example, SHOX2, PCDHGA12, HOXD8, and GATA3 have been reported as genes related to lung cancer. Among them, the detection sensitivity of SHOX2 in tissues is 80.6%, which is higher than the sensitivity of the HOXA9 gene. In sputum, the sensitivity is large. The amplitude was reduced to 51.4%, which was significantly lower than 74.3% of the HOXA9 gene (Note, comparison between normal group and all cancer groups). Therefore, when sputum is used as a test sample, the HOXA9 gene is particularly suitable as a tumor marker.

Studies have found that a variety of lung cancer markers only show good detection sensitivity and specificity in tissues; while in sputum and lung lavage fluid samples, no matter how to design and optimize the detection area, detection primers, probes, etc. However, the sensitivity is still greatly reduced, which seriously affects the diagnosis of lung cancer.

The HOXA9 gene also maintains high sensitivity in sputum and lung lavage samples, and maintains specificity as high as 95%, which makes this gene extremely useful as sputum and lung lavage samples. Reliable lung cancer markers. Among them, one reason is that the present disclosure is optimized for the detection area, primers, probes, etc. of HOXA9.

In the present disclosure, the lung cancer is selected from small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC); further, the non-small cell lung cancer is selected from squamous cells Cancer, adenocarcinoma or large cell carcinoma. As a preferred embodiment, the lung cancer is selected from adenocarcinoma.

It has been confirmed by experiments that the reagents / kits of the present disclosure have high specificity and high sensitivity in many different types of lung cancer. Even in lung adenocarcinoma, they have higher sensitivity than other tumor markers. For example, in sputum, the detection sensitivity of HOXA9 is 55.6%, while the sensitivity of SHOX2 is 11.1% (see Table 6 in the Example), which further illustrates that HOXA9 is particularly suitable for using sputum as a test sample, especially for lungs. Detection of adenocarcinoma. At present, the rate of missed detection of lung adenocarcinoma is high. On the one hand, because lung adenocarcinoma is more likely to occur in women and non-smokers, the incidence is lower than that of squamous cell carcinoma and undifferentiated cancer. Bronchus is a peripheral lung cancer. It is more difficult to cough out sputum from deep lungs. On the other hand, lung adenocarcinoma generally does not have obvious clinical symptoms in the early stage. Therefore, the detection of lung adenocarcinoma is more difficult and valuable.

A beneficial effect of one of the above technical solutions is that the lung cancer diagnostic reagent / kit can not only use tissue as a detection sample, but also prominently, it has higher sensitivity in sputum and lung lavage fluid, Sputum and lung lavage fluid can be easily used as test samples to reliably diagnose lung cancer. Sputum samples are easy to obtain and do not cause any pain or inconvenience to the patient. The sample size is very small, the sampling process is very convenient and has no impact on the patient. At the same time, samples are easy to mail or take to the hospital for examination.

A beneficial effect of one of the above technical solutions is that the lung cancer diagnostic reagent / kit can detect multiple types of lung cancer, and it also has higher sensitivity than other markers for difficult-to-detect adenocarcinomas.

A technical solution of the above technical solution has the beneficial effect that the lung cancer diagnosis reagent / kit does not need to consider the detection object and age, and has a wide application range.

The beneficial effect of one of the above technical solutions is that the reagents / kits described in the present disclosure detect and diagnose cancer by methylation level, and more and more studies have confirmed that the methylation changes are in the process of tumorigenesis. Early events, detection of abnormal methylation are more likely to detect early lesions.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 ROC curves of HOXA9, SHOX2, PCDHGA12, HOXD8, and GATA3 in all tissue samples;

Figure 2 ROC curves of HOXA9, SHOX2, PCDHGA12, HOXD8, and GATA3 in sputum samples;

Figure 3 ROC curves of HOXA9 and SHOX2-n3 in all sputum samples;

Figure 4 Amplification curve of HOXA9 and SHOX2_n3 in sputum samples (A is the amplification map of HOXA9, B is the amplification map of SHOX2_n3;

Figure 5 ROC curves detected by HOXA9 and SHOX2_n3 in all lavage fluid samples;

Figure 6 Amplification curves of HOXA9 and SHOX2_n3 in lavage fluid samples (A is the amplification map of HOXA9, B is the amplification map of SHOX2_n3).

detailed description

The technical solutions of the present disclosure are further described below through specific embodiments, and the specific embodiments do not represent a limitation on the protection scope of the present disclosure. Some non-essential modifications and adjustments made by others based on the concept of the present disclosure still belong to the protection scope of the present disclosure.

A "primer" or "probe" in this disclosure refers to an oligonucleotide comprising a region that is complementary to the sequence of at least 6 consecutive nucleotides of a target nucleic acid molecule (eg, a target gene). In some embodiments, at least a portion of the sequence of the primer or probe is not complementary to the amplified sequence. In some embodiments, the primer or probe comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 with the target molecule. A region of complementary sequence of consecutive or discontinuous block nucleotides. When a primer or probe comprises a region "complementary to at least x consecutive nucleotides of a target molecule", the primer or probe is at least 95% complementary to at least x consecutive nucleotides of the target molecule. In some embodiments, the primer or probe is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, 96%, at least 97%, at least 98%, at least 99%, or 100% are complementary.

"Diagnosis" in the present disclosure includes, in addition to the early diagnosis of lung cancer, the diagnosis of intermediate and advanced lung cancer, and also includes lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of the stage of the disease, and selection of therapeutic targets.

The application of lung cancer marker HOXA9 makes early diagnosis of lung cancer possible. When a methylated gene is determined to be methylated in a clinically or morphologically normal cell in a cancer cell, this indicates that the normally expressed cell is developing towards cancer. In this way, lung cancer can be diagnosed at an early stage by methylation of the lung cancer-specific gene HOXA9 in normal-representing cells.

In addition to the early diagnosis of lung cancer, the reagents / kits of the present disclosure also have the potential to be used for lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of stage of disease, and selection of therapeutic targets.

As an alternative embodiment of diagnosis at the stage of the disease, diagnosis can be made by measuring the degree of methylation of HOXA9 obtained from the sample during the progression of lung cancer at different stages or periods. By comparing the degree of methylation of the HOXA9 gene of a nucleic acid isolated from a sample of each stage of lung cancer with the HOXA9 gene methylation of one or more nucleic acids isolated from a sample of lung tissue without abnormal cell proliferation It can detect the specific stage of lung cancer in the sample.

In the present disclosure, a "normal" sample refers to a sample of the same type isolated from an individual known to be free of the cancer or tumor.

In the present disclosure, the "subject" is a mammal, such as a human.

Samples for methylation detection in the present disclosure include, but are not limited to, DNA, or RNA, or mRNA- and DNA-containing samples, or DNA-RNA hybrids. The DNA or RNA may be single-stranded or double-stranded.

Methods for methylation detection are well known, such as methylation-specific polymerase chain reaction, real-time fluorescence quantitative methylation-specific polymerase chain reaction, pyrosequencing, and the use of methylated DNA-specific binding proteins. PCR, quantitative PCR, and DNA chips, differential methylation detection-methylation-sensitive restriction enzymes, differential methylation detection-sulfite sequencing, etc. The methylation detection method can be introduced by the patent US62007687.

In the present disclosure, "methylation level" is the same as "degree of methylation" and can usually be expressed as the percentage of methylated cytosines, which is the number of methylated cytosines divided by the number of methylated cytosines and The sum of the number of methylated cytosines; and the method of dividing the number of methylation-targeted genes by the number of internal reference genes is currently commonly used to represent the methylation level; and other methylation levels commonly used in the prior art.

Example 1: Selection of detection target genes

Using methylated DNA as a detection target has obvious advantages. Compared to protein-based markers, DNA can be amplified and easily detected; compared to mutant markers, the sites where DNA methylation occurs are all located Specific parts of the gene, usually in the promoter region, make detection easier and more convenient. In order to complete the present disclosure, the inventors have selected HOXA9, SHOX2, PCDHGA12, HOXD8, and GATA3 as candidate detection genes from hundreds of candidate genes through several rounds of screening. Β-actin gene is used as an internal reference gene. Distribution of gene methylation sites. Primer probes designed for detection were used for real-time fluorescent methylation-specific PCR (qMSP) detection. The primer probes for each gene are as follows:

HOXA9 detection primers and probes are:

SEQ ID NO: 1 HOXA9-F2 Primer F: TTAGTTTTTTCGGTAGGCGGC

SEQ ID NO: 2 HOXA9-R2 Primer R: AAACGCCAAACACCGTCG

SEQ ID NO: 3 HOXA9-P2 Probe: FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1

SHOX2 detection primers and probes are:

SEQ ID NO: 4 SHOX2 Primer F: TTTAAAGGGTTCGTCGTTTAAGTC

SEQ ID NO: 5 SHOX2 Primer R: AAACGATTACTTTCGCCCG

SEQ ID NO: 6 SHOX2 probe: FAM-TTAGAAGGTAGGAGGCGGAAAATTAG-BQ1

The detection primers and probes for PCDHGA12 are:

SEQ ID NO: 7 PCDHGA12 Primer F: TTGGTTTTTACGGTTTTCGAC

SEQ ID NO: 8 PCDHGA12 Primer R: AAATTCTCCGAAACGCTCG

SEQ ID NO: 9 PCDHGA12 Probe: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

HOXD8's detection primers and probes are:

SEQ ID NO: 10 HOXD8 Primer F: TTAGTTTCGGCGCGTAGC

SEQ ID NO: 11 HOXD8 Primer R: CCTAAAACCGACGCGATCTA

SEQ ID NO: 12 HOXD8 Probe: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

GATA3's detection primers and probes are:

SEQ ID NO: 13 GATA3 primer F: TTTCGGTAGCGGGTATTGC

SEQ ID NO: 14 GATA3 Primer R: AAAATAACGACGAACCAACCG

SEQ ID NO: 15 GATA3 probe: FAM-CGCGTTTATGTAGGAGTGGTTGAGGTTC-BQ1

The detection primers and probes for β-actin are:

SEQ ID NO: 16 β-actin primer F: TTTTGGATTGTGAATTTGTG

SEQ ID NO: 17 β-actin primer R: AAAACCTACTCCTCCCTTAAA

SEQ ID NO: 18 β-actin probe: FAM-TTGTGTGTTGTGGGTGGTGGTT-BQ1

experiment procedure:

1.Extract DNA

Collect specimens from patients diagnosed with lung cancer and specimens from non-tumor patients, including paraffin tissue specimens, sputum fluid specimens, lavage fluid specimens, sample pretreatment and cell isolation. Follow HiPure FFPE DNA Kit (D3126-03) Instructions for DNA extraction.

2.DNA bisulfite treatment

The bisulfite modification was performed using the ZYMO RESEARCH Biologicals kit EZ DNA Methylation ^TM KIT (D5002) instructions.

3.Amplification and detection

Table 1 Liquid distribution system

Amplification system:

4, test results

4.1 Test results in paraffin tissue

Sample information: A total of 185 lung tissue samples, of which 87 were normal tissue samples, 98 were cancer tissue samples, 15 were squamous cell carcinoma in the 98 cancer group samples, 81 were adenocarcinomas, and 2 were lung cancers that were not clearly classified. And 73 pairs of adjacent cancer control samples.

The ROC curves of HOXA9, SHOX2, PCDHGA12, HOXD8, and GATA3 in all tissue specimens are shown in Figure 1. The statistical results of the detection of each gene in the tissue are shown in Table 3.

Table 3 Test results in tissues

From the above results, it can be seen that in the tissue samples, whether it is comparative analysis of lung cancer as a whole or comparative analysis of lung cancer subtypes, SHOX2 and HOXA9 have the best detection effect, and PCDHGA12 and GATA3 have the second most effective detection results. The detection effect of HOXD8 is the worst, only reaching 40.8%.

Based on the above results, in order to study the detection of different genes in sputum, it was invented to further screen the five markers HOXA9, SHOX2, PCDHGA12, HOXD8, and GATA3 in sputum because sputum is used as a non-invasive test sample. More important.

Example 2: Detection of HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 genes in sputum

Sample information: A total of 90 sputum samples were tested, of which 55 were in the normal control group, 35 were in the cancer control group, 12 were squamous cell carcinoma, 6 were small cell cancer, 9 were adenocarcinoma, and 35 were large in the 35 cancer group. There were 2 cases of cell carcinoma and 6 cases of lung cancer without a clear classification.

Experimental procedure:

a. Collect sputum samples from patients diagnosed with lung cancer and non-lung cancer patients, use DTT to de-thicken them, centrifuge the pellet to isolate the cells, wash them twice with PBS, and then use Magen's DNA extraction kit (HiPure FFPE DNA Kit, D3126-03).

b. Bisulphite modification of DNA was performed using DNA Transformation Kit (EZ 500 DNA Kit, D5002) from ZYMORESEARCH Biologicals.

c. The dosing system is as follows:

Table 4 Dosing system

d. The amplification system is as follows:

Table 5 Amplification system

e. The test results are as follows:

Table 6 Test results in sputum

f. The ROC curves detected by HOXA9, SHOX2, PCDHGA12, HOXD8, and GATA3 in sputum samples are shown in Figure 2 and the statistical results are shown in Table 6. From the above results, it can be seen that in the sputum samples, the five genes are detected simultaneously In comparison, no matter whether the lung cancer as a whole is compared or analyzed according to the lung cancer subtype, the detection effect of HOXA9 is better than that of the other four genes. Especially for the detection of adenocarcinoma, the detection rate of HOXA9 is much higher than other genes. Adenocarcinoma is generally of the peripheral type. Due to the tree-like physiological structure of the bronchus, exfoliated cells in the deep lungs are more difficult to cough out of sputum. Most tumor markers will fail or reduce their effectiveness when sputum is used as the test specimen. As in the present disclosure, SHOX2, which has the highest sensitivity to adenocarcinoma in tissues, has a greatly reduced sensitivity to 11.1% in sputum, so the detection of this part is more difficult and meaningful.

Example 3: Detection of HOXA9 and SHOX2 genes in sputum

A large number of documents show that SHOX2 can be used as a marker for detecting lung cancer, and there are patents showing [CN201510203539-method and kit for diagnosing methylation of human SHOX2 gene and human RASSF1A gene-application publication], SHOX2 is used in alveolar lavage fluid and lesions Tissue, pleural fluid, sputum and other samples have higher detection rates. In order to verify the detection effect of HOXA9, in this embodiment, the detection efficiency of the SHOX2 gene uses the primer and probe sequences disclosed in the patent CN201510203539, and the SHOX2 gene is expressed as SHOX2_n3 to distinguish it from the examples 1 and 2 of the present disclosure. The SHOX2 gene was detected by self-designed primers and probes.

The primer probes for each gene are as follows:

HOXA9 detection primers and probes are:

SEQ ID NO: 1 HOXA9-F2 Primer F: TTAGTTTTTTCGGTAGGCGGC

SEQ ID NO: 2 HOXA9-R2 Primer R: AAACGCCAAACACCGTCG

SEQ ID NO: 3 HOXA9-P2 Probe: FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1

The detection primers and probes for SHOX2_n3 are:

SEQ ID NO: 19 SHOX2_n3 Primer F: TTTGGATAGTTAGGTAATTTTCG

SEQ ID NO: 20 SHOX2_n3 Primer R: CGTACACGCCTATACTCGTACG

SEQ ID NO: 21 SHOX2_n3.2 Probe: FAM-CCCCGATCGAACAAACGAAAC-BQ1

a. The dosing system is as follows:

Table 7 Dosing system

b. The amplification system is as follows:

Table 8 Amplification system

Table 9 SHOX2_n3 reaction program

c. The test results are as follows:

Use the standard curve to calculate the methylation copy number of each gene in the specimen, and use the ratio = target gene copy number / ACTB copy number * 100 to determine the methylation degree of the two groups of samples. Finally, the HOXA9 threshold is 2.3. The threshold value of SHOX2_n3 is 1.3. As a criterion for judging the cancer group and the control group, the converted ratio exceeding the set threshold value can be judged as a positive "+", and equal to or less than the set threshold value can be judged as a negative "-". According to this standard, the test results of 90 sputum samples were as follows:

Table 10 test results

d. Analysis of results

Table 11 Statistical results

e. The ROC curves detected by HOXA9 and SHOX2_n3 in all sputum samples are shown in Figure 3, and the amplification curves of HOXA9 and SHOX2_n3 in sputum samples are shown in Figure 4. From the above results, it can be seen that in the sputum samples, whether For lung cancer as a whole for comparative analysis, or for lung cancer subtypes, the detection effect of HOXA9 is better than that of SHOX2 gene. Especially for the detection of adenocarcinoma, the detection rate of HOXA9 is much higher than 33.3% of the SHOX2 gene. Adenocarcinoma is generally peripheral. Due to the tree-like physiological structure of the bronchus, exfoliated cells in the deep lungs are more difficult to cough through sputum. And this disclosure has found for the first time a marker that can detect adenocarcinoma using sputum as a sample and can greatly increase the sensitivity to 55.6%. This breakthrough has great significance for the detection of adenocarcinoma.

Example 4: Detection of HOXA9 and SHOX2 genes in lavage fluid

Sample information: A total of 79 alveolar lavage fluid samples were tested, including 58 normal control samples, 21 cancer control samples, 21 cancer group samples including squamous cell carcinoma, 4 small cell carcinomas, and 11 adenocarcinomas. .

Experimental procedure:

a. Collect alveolar lavage fluid samples from patients diagnosed with lung cancer and non-lung cancer, centrifuge cells, and then use Magen's DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) to extract DNA.

b. Bisulphite modification of DNA was performed using DNA Transformation Kit (EZ 500 DNA Kit, D5002) from ZYMORESEARCH Biologicals.

c. The amplification detection system is as follows:

Table 12 Amplification system

Zh	HOXA9	SHOX2_n3	β-actin
Reaction component	Addition (ul)	Addition (ul)	Addition (ul)
Upstream primer (100uM)	0.125	0.125	0.125
Downstream primer (100uM)	0.125	0.125	0.125
Probe (100uM)	0.05	0.05	0.05
Magnesium (25mM)	4	5	5
dNTPs (10mM)	1	1	1
Taq polymerase (5unit / ul)	0.5	0.5	0.5
5X buffer	5	5	5
Sterile water	13.2	12.2	12.2
Template DNA	1	1	1
total capacity	25	25	25

d. The detection system is as follows:

Table 13 Testing system

Table 14 SHOX2_n3 reaction procedure

e. The test results are as follows:

Use the standard curve to calculate the methylation copy number of each gene in the specimen, and use the ratio = target gene copy number / ACTB copy number * 100 to determine the methylation degree of the two groups of samples. Finally, the threshold value of HOXA9 is 0.5. The threshold value of SHOX2_n3 is 0.6. As a criterion for judging the cancer group and the control group, the converted ratio exceeding the set threshold value can be judged as positive “+”, and equal to or less than the set threshold value can be judged as negative “-”. According to this standard, the test results of 79 lavage fluid samples were as follows:

Table 15 Test results

Table 16 Analysis results

f. The ROC curve detected by HOXA9 and SHOX2_n3 in all lavage fluid samples is shown in Figure 5 and the amplification curve is shown in Figure 6. From the above results, it can be seen that in the lavage fluid sample, HOXA9 and SHOX2 were detected simultaneously, and lung cancer was treated as As a whole, comparative analysis shows that the detection rate of HOXA9 is 61.9%, which is higher than 52.4% of SHOX2. According to the comparison of lung cancer subtypes, the detection rate of HOXA9 in adenocarcinoma and small cell cancer is higher than SHOX2_n3. Cancer is generally peripheral. Due to the tree-like physiological structure of the bronchi, alveolar lavage fluid cannot easily contact the alveoli or cancerous tissues in the deep lung, so the detection of this part is more difficult and meaningful. In addition, for small cell carcinoma, the sensitivity of HOXA9 is as high as 100%, which is significantly higher than 75.0% of SHOX2.

Based on the above four examples, it can be fully explained that HOXA9 has a better detection effect on lung cancer detection and diagnosis, especially on biological samples such as sputum and alveolar lavage fluid. It can be more easily applied to large-scale population screening and has more superior socioeconomic value.

Example 5: The effect of the detection area, primers, and probes of HOXA9 on the detection effect

Various research data show that the methylation status and distribution of the same gene are not uniform. Therefore, for the same gene, methylation primers and probe detection systems designed in different regions are selected for the same sample and the same tumor. The diagnostic detection efficiency is not the same, and sometimes the selected area is not suitable to cause no diagnostic effect on the tumor at all. The inventor has repeatedly researched and compared multiple detection areas. Some exemplary detection areas are shown in Table 17 below.

Table 17 Sequences to be detected

We design different methylation primers and probes based on the sequence region 1, region 2 and region 3. The information of each primer probe is shown in Table 18, where group 1, group 2, group 3, group 4 and group 5 are based on region 1. Designed methylation primers and probes; Group 6, Group 7, and Group 8 are methylated primers and probes designed according to Region 2; Group 9, Group 10, and Group 11 are methylated primers designed according to Region 3 And probes (see Table 20 for primer and probe sequences).

The above 11 sets of primer probe combinations were detected in 36 lung tissue samples, of which 11 were normal tissue samples, 25 were cancer tissue samples, 4 were squamous cell carcinoma, and 21 were adenocarcinoma in the 25 cancer group samples. The test results are shown in the table below.

Table 18 Test results in tissues

Area	Group	Primer probe combination	Specificity	Sensitivity
Zone 1	Group 1	H9-F2, H9-R2, H9-P2	100%	76%
Zone 1	Group 2	H9-F3, H9-R3, H9-P3	100%	76%
Zone 1	Group 3	H9-F4, H9-R4, H9-P4	100%	40%
Zone 1	Group 4	H9-F5, H9-R5, H9-P5	100%	60%
Zone 1	Group 5	H9-F6, H9-R6, H9-P6	100%	68%
Zone 2	Group 6	H9-F7, H9-R7, H9-P7	100%	32%
Zone 2	Group 7	H9-F8, H9-R8, H9-P8	100%	20%
Zone 2	Group 8	H9-F9, H9-R9, H9-P9	100%	12%
Zone 3	Group 9	H9-F10, H9-R10, H9-P10	100%	16%
Zone 3	Group 10	H9-F11, H9-R11, H9-P11	100%	twenty four%
Zone 3	Group 11	H9-F12, H9-R12, H9-P12	100%	twenty four%

The results show that no matter how primers and probes are designed in Regions 2 and 3, the detection sensitivity for these two regions can only reach a maximum of 32%, and no matter which primers and probes are designed in this disclosure, Region 1 has the lowest detection sensitivity Can also reach 40%, up to 76%. Therefore, the detection rate in area 1 is significantly higher than in areas 2 and 3 (see Table 18).

Based on the detection results of each set of primer probes, the preferred detection sequence is shown in Table 19 below.

Table 19 Optimized detection sequences

Effects of primers and probes on detection

In addition to the detection area that will affect the detection effect, primers and probes also have a great impact on the detection effect of tumor markers. During the research process, the inventor designed multiple pairs of primers and their corresponding probes to find as much as possible Probes and primers that improve detection sensitivity and specificity, so that the detection reagents of the present disclosure can be practically applied to clinical detection. Some primers and detection probes are shown in Table 20 below, and the detection results are shown in Table 21. All primers and probes were synthesized by Invejet (Shanghai) Trading Co., Ltd.

Table 20 Primers and probes

Table 21 Test results in tissues

The above 11 sets of primer probe combinations were detected in 36 lung tissue samples, of which 11 were normal tissue samples, 25 were cancer tissue samples, 4 were squamous cell carcinoma, and 21 were adenocarcinoma in the 25 cancer group samples. The results showed that group 1, group 2, group 4, and group 5 all had better detection rates.

In order to further verify its detection rate in sputum, we selected 22 sputum samples for verification, including 7 normal controls, 15 lung cancer controls, 15 squamous carcinomas in 7 lung cancers, and 7 adenocarcinomas. In 1 case of large cell carcinoma, the test results are shown in Table 22 below.

Table 22 Test results in sputum

Group	Primer probe combination	Specificity	Sensitivity
Group 1	H9-F2, H9-R2, H9-P2	100%	66.7%
Group 2	H9-F3, H9-R3, H9-P3	100%	44.6%
Group 4	H9-F5, H9-R5, H9-P5	100%	33.3%
Group 5	H9-F6, H9-R6, H9-P6	100%	40.0%

The test results from 22 sputum samples showed that the detection rate of group 1: H9-F2, H9-R2, H9-P2 was the highest, reaching 66.7%. Although in the tissue samples, the sensitivity of group 1 and group 2 can reach 76%, but for the sputum test sample, the sensitivity of group 2 has dropped sharply to 44.6%, which also confirms that the design Detection reagents with high sensitivity are particularly difficult.

Finally, according to the detection results of each set of primer probes, the most preferred primer probe sequences are shown in Table 23 below.

Table 23 Optimized primers

name	Serial number	sequence	effect
H9-F2	SEQ ID NO: 1	TTAGTTTTTTCGGTAGGCGGC	HOXA9 gene upstream primer
H9-R2	SEQ ID NO: 2	AAACGCCAAACACCGTCG	HOXA9 gene downstream primer
H9-P2	SEQ ID NO: 3	FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1	HOXA9 gene detection probe

Claims (14)

1. Application of a nucleic acid fragment in preparing a diagnostic reagent or kit for lung cancer; the nucleic acid fragment comprises a sequence shown in SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 26; preferably, the nucleic acid The fragment contains the sequence shown in SEQ ID NO: 22.
2. A primer comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 58; preferably, all The primers include primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 2.
3. A nucleic acid probe comprising SEQ ID NO: 3, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID ID NO : 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID ID NO: 56, SEQ ID NO: 59; preferably, the nucleic acid probe comprises SEQ ID NO: 3 sequence.
4. Use of the primer or nucleic acid probe according to claim 2 or 3 in the preparation of a diagnostic reagent or kit for lung cancer.
5. A diagnostic reagent for lung cancer, said reagent comprising a detection reagent for methylation of HOXA9 gene.
6. The reagent according to claim 5, wherein the detection sample of the reagent comprises sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, saliva, prostate fluid, tear fluid, or feces;

   Preferably, the detection sample of the reagent comprises sputum, lung tissue or lung lavage fluid;

   More preferably, the detection sample of the reagent contains sputum.
7. The reagent according to any one of claims 5 to 6, wherein the detection reagent for methylation of the HOXA9 gene detects a sequence modified by the transformation reagent of the HOXA9 gene;

   Preferably, the conversion reagent comprises one or more of a hydrazine salt, a bisulfite salt and a bisulfite salt;

   Preferably, the conversion reagent comprises bisulfite.
8. The reagent according to any one of claims 5 to 7, wherein the detection region of the reagent comprises a gene body or a promoter region of HOXA9;

   Preferably, the detection region of the reagent comprises a sequence shown in SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 26;

   More preferably, the detection region of the reagent comprises the sequence shown in SEQ ID NO: 22.
9. The reagent according to any one of claims 5 to 8, said reagent comprising amplification primers;

   The primers include SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 37. SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID ID NO: 58;

   More preferably, the primer comprises a primer pair as shown in SEQ ID NO: 1 and SEQ ID NO: 2.
10. The reagent according to any one of claims 5-9, comprising a probe; the probe comprises SEQ ID NO: 3, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41 SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56 or SEQ ID NO: 59;

    More preferably, the probe comprises the sequence shown in SEQ ID NO: 3.
11. The reagent according to any one of claims 5 to 10, comprising a bisulfite, a bisulfite or a hydrazine salt.
12. The reagent according to any one of claims 5 to 11, comprising one or more of a DNA polymerase, dNTPs, Mg ²⁺ ions, and a buffer solution;

    Preferably, it comprises a DNA polymerase, dNTPs, Mg ²⁺ ions and a buffer.
13. The reagent according to any one of claims 5 to 12, comprising a detection reagent for an internal reference gene;

    Preferably, the internal reference gene comprises β-actin or COL2A1;

    Preferably, the detection reagent of the internal reference gene comprises a primer and a probe of the internal reference gene;

    More preferably, the detection reagent for the internal reference gene β-actin comprises a primer pair shown in SEQ ID NO: 16 and SEQ ID NO: 17 and a probe shown in SEQ ID NO: 18;

    More preferably, the detection reagent for the internal reference gene COL2A1 includes a primer pair represented by SEQ ID NO: 60 and SEQ ID NO: 61, and a probe indicated by SEQ ID NO: 62.
14. A kit comprising the primer according to claim 2, the probe according to claim 3, or the reagent according to any one of claims 5-13.

Images