CN115725737A - Polygene methylation kit for early diagnosis of lung adenocarcinoma - Google Patents

Polygene methylation kit for early diagnosis of lung adenocarcinoma Download PDF

Info

Publication number
CN115725737A
CN115725737A CN202210978815.1A CN202210978815A CN115725737A CN 115725737 A CN115725737 A CN 115725737A CN 202210978815 A CN202210978815 A CN 202210978815A CN 115725737 A CN115725737 A CN 115725737A
Authority
CN
China
Prior art keywords
gene
methylation
probe
arid1b
sequence table
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210978815.1A
Other languages
Chinese (zh)
Other versions
CN115725737B (en
Inventor
王传新
杜鲁涛
李培龙
李娟�
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202210978815.1A priority Critical patent/CN115725737B/en
Priority to PCT/CN2022/134024 priority patent/WO2024036802A1/en
Publication of CN115725737A publication Critical patent/CN115725737A/en
Application granted granted Critical
Publication of CN115725737B publication Critical patent/CN115725737B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the field of tumor molecular biology, and relates to a polygene methylation kit for early diagnosis of lung adenocarcinoma. The kit comprises the following primers and probes: methylation specific primers for the NCOA2, RUNX3, BTD, BRE, ARID1B gene target sites; a methylation specific TaqMan probe of the NCOA2, RUNX3, BTD, BRE and ARID1B gene target site; internal reference gene primers and a TaqMan probe. The method is based on multi-gene methylation combined detection, has high sensitivity, and greatly improves the detection rate of early lung adenocarcinoma. The qPCR method is adopted, the operation is simple and convenient, and the result interpretation is simpler. Only 2-3ml of blood of a patient needs to be extracted, the trauma is small, the compliance of the patient is good, the operation is relatively simple and convenient, and the method is suitable for large-scale clinical application. The material is obtained from human peripheral blood mononuclear cells, and the detection result is more accurate.

Description

Polygene methylation kit for early diagnosis of lung adenocarcinoma
Technical Field
The invention belongs to the field of tumor molecular biology, and particularly relates to a polygene methylation kit for early diagnosis of lung adenocarcinoma.
Background
Lung cancer is one of the most common malignancies of the respiratory system, the leading cause of cancer-related death, and is a serious health hazard to humans. From the viewpoint of pathological typing, lung cancer includes small cell lung cancer and non-small cell lung cancer, of which non-small cell lung cancer accounts for about 85%. Lung adenocarcinoma accounts for approximately 50% of non-small cell lung cancers. Adenocarcinoma is the most common pathological type of lung cancer. Despite advances in treatment technologies such as surgery, radiotherapy, chemotherapy, and targeted therapies, the prognosis of lung adenocarcinoma remains optimistic. One of the important reasons is that early diagnosis of lung adenocarcinoma is difficult, and a considerable number of patients are already in the middle and late stages at the initial diagnosis, and the prognosis is poor. Currently, low-dose helical CT is a commonly used examination means for screening early lung adenocarcinoma, but it has the disadvantage of poor characteristics, and many benign lesions in the lung may be misdiagnosed as lung cancer. Conventional serum tumor markers (NSE, SCC, cyfra 21-1, proGRP, CEA, etc.) have limited sensitivity and specificity. Therefore, it is important to find a novel noninvasive lung adenocarcinoma diagnostic marker with high specificity.
DNA methylation, a form of epigenetic modification, plays an important role in the development of tumors. DNA methylation refers to the addition of a methyl group provided by S-adenosylmethionine to the fifth carbon atom of cytosine under the action of methyltransferase, usually occurring in CpG islands, and has important roles in maintaining the stable structure of chromosomes, regulating gene expression and the like. Generally, hypermethylation inhibits gene expression, and hypomethylation promotes gene expression. The hypomethylation of proto-oncogenes and/or the hypermethylation of cancer suppressor genes can promote the development of tumors. It has been proved that there are abnormal changes in the methylation level of DNA in many malignant tumors, such as colorectal cancer, gastric cancer, breast cancer, pancreatic cancer, etc., and the use of the methylation level of genes as a biomarker for diagnosing malignant tumors has become a new research direction.
NCOA2 belongs to a member of the NCOA family, and studies have shown that the NCOA family, particularly NCOA2 and NCOA3, are involved in normal biological processes and carcinogenesis. For example, activation of NCOA3 promotes tumor growth of pancreatic ductal adenocarcinoma. The NCOA 2-mediated anti-tumor target gene co-activates and inhibits MYC-induced liver cancer. Inhibition of NCOA2 severely attenuates the survival, growth and metastatic potential of prostate cancer. In lung cancer, NCOA2 is phosphorylated by PFKFB4 at Ser487 site, and the transcriptional activity of NCOA2 is thereby altered, thereby promoting lung cancer cell proliferation, migration, and invasion.
The RUNX family of transcription factors are key regulators of development and are often deregulated in cancer. RUNX3 is a member of the RUNX family, described as a tumor promoter or repressor, reflecting its complex role in tumorigenesis. RUNX3 is a downstream effector molecule of a TGF-beta signaling pathway and plays an important role in regulating cell death, angiogenesis, endothelial mesenchymal transition, cell migration, invasion and the like. Runx3 silencing regulates YBX1 expression through miR-148a-3p and promotes the development of non-small cell lung cancer by increasing the levels of Cyclin D1, cyclin B1, slug-1, MMP-2 and MMP-9. Expression of RUNX3 was identified as a key factor in the propensity of pancreatic ductal adenocarcinoma cells to proliferate locally or disseminate systemically. Overexpression of RUNX3 promoted growth and inhibited apoptosis in head and neck cancer cells. In addition, studies have shown that RUNX3 plays an important role in immunity and inflammation, and thus RUNX3 may indirectly affect the development of tumors.
The BTD (biotinidase) gene is located on chromosome 3p25. To date, 61 mutations in three of the four exons of BTD and 1 mutation in one intron gene have been reported, which mutations result in severe BTD deficiency. BTD is an enzyme that can cleave biocytin, a product of the proteolytic digestion of whole carboxylase. Severe BTD deficiency (average normal activity in serum less than 10%) is an autosomal recessive genetic disease, in which patients are unable to cleave biocytin and recover biotin. Untreated individuals are secondarily deficient in biotin, which in turn leads to a reduced activity of biotin-dependent carboxylases, resulting in the accumulation of toxic metabolites and, in turn, the appearance of corresponding clinical symptoms. The biotin enzyme deficiency is characterized primarily by neurological, skin manifestations and metabolic abnormalities. However, the BTD gene has few reports in tumors and is worthy of further study.
BRE, also known as TNFRSF1A regulator and BRCC45, is an evolutionarily highly conserved protein. It is a death receptor-associated protein in the cytoplasm and is also part of the DNA repair complex containing BRCA1/2 in the nucleus. The research shows that BRE has anti-apoptosis activity, the high expression of BRE can enhance the growth of esophageal squamous carcinoma cells by promoting cell cycle process and resisting apoptosis, and the silencing of BRE inhibits the malignant phenotype of esophageal squamous carcinoma cells. Mechanistic studies indicate that BRE overexpression activates phosphorylation of AKT, and inhibition of the AKT pathway by MK2206 reduces BRE-induced esophageal squamous cell growth and apoptosis resistance.
ARID1B is located at 6q25.3 and is a typical nuclear tumor suppressor. However, cytoplasmic-localized ARID1B can bind c-RAF (RAF 1) and PPP1CA, thereby stimulating RAF-ERK signaling and β -catenin (CTNNB 1) transcriptional activity. The cytoplasmic localization of ARID1B, and the increase in ERK1 and ERK2 (also known as MAPK3 and MAPK 1) active forms and β -catenin levels, were significantly correlated with late stage tumor progression and lymph node positive levels. In breast cancer, high expression of ARID1B is closely associated with the histological grade and tumor size of invasive breast cancer. In aggressive triple negative breast cancer subtypes, the expression of ARID1B is often increased and is associated with a decreased five-year disease-free survival rate. MDA-MB-231 cells with reduced ARID1B activity exhibited a delay in G1 phase to S phase cell cycle transition and thus reduced cell proliferation compared to the control group. Medulloblastoma is a common childhood malignant brain tumor, and decreased expression of ARID1B results in a significant increase in the malignant potential of medulloblastoma cells. In urothelial carcinoma of the bladder, ARID1B expression is significantly associated with tumor size, TNM staging, overall survival and progression-free survival. The benefit of adjuvant chemotherapy was superior to that observed in patients with high ARID1B expression in patients with low ARID1B expression, suggesting that ARID1B may be a predictive marker for selection of adjuvant chemotherapy patients in the high risk subgroup. Of the non-small cell lung cancers, 7% of non-small cell lung cancer patients carry the ARID1A mutation and 4% of non-small cell lung cancer patients carry the ARID1B mutation. Mutations in ARID1A and ARID1B have been shown to correlate with sensitivity to immune checkpoint inhibitors in non-small cell lung cancer patients. Patients carrying these mutations respond better to treatment and have prolonged progression-free survival.
Peripheral blood has the advantages of being less invasive and easier to obtain. Peripheral blood mononuclear cells comprise mononuclear cells and lymphocytes, can be extracted and separated by the kit, and are simple and convenient, and the cost is low. Peripheral blood mononuclear cells play an important role in tumor immunity as an important component of the immune system. Abnormal changes in the levels of DNA methylation in T and B lymphocytes have been shown to be associated with carcinogenesis. The method provides a basis for researching the DNA methylation level of the peripheral blood mononuclear cells of the lung adenocarcinoma patients, and provides a new idea for early diagnosis of the lung adenocarcinoma.
Compared with single-gene methylation detection, the method has lower detection limit of multi-gene methylation and higher sensitivity, and is particularly suitable for early diagnosis of lung adenocarcinoma. A polygene methylation kit for early diagnosis of lung adenocarcinoma is required to be a diagnostic reagent and meet the following conditions: firstly, the marker is enough to be stably existed in the peripheral blood mononuclear cell and is easy to detect; second, the marker should have high sensitivity and specificity to detect and distinguish the methylation state of tumor cells from that of normal cells, and also distinguish other tumor and non-tumor disease methylation states. Third, the level of this marker is not affected by other tumors, non-neoplastic diseases, exercise, diet, pregnancy, etc.
Disclosure of Invention
The invention provides a novel polygene methylation kit for early diagnosis of lung adenocarcinoma, aiming at the problems in the traditional early diagnosis of lung adenocarcinoma. The methylation level markers of NCOA2, RUNX3, BTD, BRE and ARID1B genes derived from the peripheral blood mononuclear cells can be used as diagnostic markers of lung adenocarcinoma patients, and the detection method is easily accepted by a subject and is more likely to be an effective means for early diagnosis of the lung adenocarcinoma patients.
In order to achieve the purpose, the invention is realized by adopting the following technical scheme:
a polygene methylation kit for early diagnosis of lung adenocarcinoma comprises the following six groups of primers and probes: methylation specific primers for the NCOA2, RUNX3, BTD, BRE, ARID1B gene target sites; a methylation specific TaqMan probe of the NCOA2, RUNX3, BTD, BRE and ARID1B gene target site; internal reference gene primers; an internal reference gene TaqMan probe. The reference gene is actin.
The methylation specific primers and probes of the NCOA2 gene target site comprise:
a forward primer: TAAAAGTTATTGTCGGTGGTAGAAGA,
reverse primer: attttactaaaataaatcttctttctccg;
and (3) probe: TCCTTCTTTCATTATATTTACTCATTTCTTTTC.
The methylation specific primers and probes of the RUNX3 gene target site comprise:
a forward primer: GGGGTTTATAGTTAGTTTGGGTTC,
reverse primer: aaataacactaaacctaaactcactaaactcaaact;
and (3) probe: ACCTACATCTATAATCCCGATATCTAT.
The methylation specific primers and probes of the target site of the BTD gene comprise:
a forward primer: TATATTTTTTTTTAATAAATTTTTTTTAGTATGCG,
reverse primer: aaaaaaccccaaaccactttat;
and (3) probe: AACTAACATTTTATTTTTATTTTAACTTAAAACCAACG.
The methylation specific primers and probes of the BRE gene target site comprise:
a forward primer: GTTTTATTTAATAAGTTTTTTTTAGAAGTTTTTCG,
reverse primer: AACATACCCTCAACTCACTATTCTCAA;
and (3) probe: AACGAAAACGAATTATAACAAAAATATCAACC.
The methylation specific primers and the methylation specific probes of the ARID1B gene target sites comprise:
a forward primer: TTTGTTAGGTAGTGCGGTTTG,
reverse primer: AATACTAATTCTAACACTCCCTAACAACG;
and (3) probe: ACCTCCTAAACTATAATTCTATCATCTAAAAATAACTACG.
The primer and the probe of the reference gene comprise:
a forward primer: TGGTGATGGAGGAGGTTTAGTAAGT,
reverse primer: AACCAATAAAACCTACTCTCTCCCCTTTAAA;
and (3) probe: ACCACACCCAACCCAACAATAACAACACACA.
In the kit, the kit further comprises: KAPA PROBE FAST qPCR Master Mix (2 ×); KAPA PROBE FAST ROX Low (50 ×); ddH 2 O。
In the kit, the PCR amplification reaction system comprises: KAPA PROBE FAST qPCR Master Mix (2 ×): 5 mu l of the solution; KAPA PROBE FAST ROX Low (50 ×): 0.2 mul; NCOA2 forward primer (F): 0.25 μ l; NCOA2 reverse primer (R): 0.25 μ l; NCOA2 probe: 0.1 mul; RUNX3 forward primer (F): 0.25 μ l; RUNX3 reverse primer (R): 0.25 μ l; RUNX3 probe: 0.1 μ l; BTD forward primer (F): 0.25 μ l; BTD reverse primer (R): 0.25 μ l; BTD probe: 0.1 μ l; BRE forward primer (F): 0.25 μ l; BRE reverse primer (R): 0.25 μ l; BRE probe: 0.1 mul; ARID1B forward primer (F): 0.25 μ l; ARID1B reverse primer (R): 0.25 μ l; ARID1B probe: 0.1 mul; actin forward primer (F): 0.06 mul; actin reverse primer (R): 0.06 mul; actin probe: 0.05 μ l; DNA:1 mul; ddH 2 O：0.63μl。
The invention is based on the joint detection of the methylation of NCOA2, RUNX3, BTD, BRE and ARID1B genes, and the detection result is judged by calculating the PCR amplification result of the NCOA2, RUNX3, BTD, BRE and ARID1B genes and the internal reference gene, so that the sensitivity and the stability of the detection result are improved. The PCR amplification results of NCOA2, RUNX3, BTD, BRE, ARID1B gene and reference gene refer to the Ct value, i.e., the number of cycles that the fluorescence signals of NCOA2, RUNX3, BTD, BRE, ARID1B gene and reference gene have reached a predetermined threshold. The criteria for judging the detection result by calculating the PCR amplification results of the NCOA2, RUNX3, BTD, BRE, ARID1B genes and the internal reference gene are as follows: delta Ct value (Ct value of NCOA2, RUNX3, BTD, BRE, ARID1B gene-Ct value of internal reference gene) is less than or equal to-1.236, and the judgment result is that: methylation is positive; Δ Ct value (NCOA 2, RUNX3, BTD, BRE, ARID1B Gene Ct value-reference Gene Ct value) > -1.236, and the results were determined: methylation is negative. If the actin Ct value is greater than 32 or no amplification exists, all results are invalid, and re-detection is needed.
Compared with the prior art, the invention has the advantages and positive effects that:
1. the method is based on multi-gene methylation joint detection, has high sensitivity, and greatly improves the detection rate of early lung adenocarcinoma. The qPCR method is adopted, so that the operation is simple and convenient, and the result interpretation is simple.
2. The invention only needs to extract 2-3ml of blood of a patient, has small wound, good patient compliance and relatively simple and convenient operation, and is suitable for large-scale clinical application.
3. The invention is based on the tumor immunity, and the detection result is more accurate by taking the single nuclear cell from the human peripheral blood.
Drawings
FIG. 1 is a qPCR amplification curve for methylation of internal reference genes, a qPCR amplification curve for methylation of single genes NCOA2, RUNX3, BTD, BRE, ARID1B, and a comparison of the qPCR amplification curves for methylation of multiple genes.
FIG. 2 is a scattergram of the results of sample testing.
FIG. 3 is a ROC curve of the results of sample detection.
Detailed Description
In order that the above objects, features and advantages of the present invention may be more clearly understood, the present invention will be further described with reference to specific embodiments. It should be noted that the embodiments and features of the embodiments of the present application may be combined with each other without conflict.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced otherwise than as specifically described herein and, therefore, the present invention is not limited to the specific embodiments disclosed in the following description.
Example 1
Screening and verification of target genes
1. Screening of target Gene
1.1 study object
In this example, the peripheral blood samples were obtained from 35 patients with lung adenocarcinoma and 30 healthy subjects who had been approved by the subjects. All peripheral blood specimens were obtained from the second hospital of Shandong university and the Qilu hospital of Shandong university. The 35 patients with lung adenocarcinoma were admitted to hospital for the first time, and had not undergone any related treatments such as operation, radiotherapy, chemotherapy and immunotherapy before admission, and the pathological types thereof were confirmed by pathological examination after surgery. All peripheral blood samples were taken before the patient was first admitted and received no treatment. 30 healthy examinees have no history of malignant tumors, autoimmune diseases and other serious diseases of heart, liver, kidney and the like.
1.2 specimen Collection
After each subject collected peripheral blood once (2-3 ml/tube), they were mixed gently by inversion 5-10 times and mononuclear cells were immediately extracted.
1.3 isolation of peripheral blood mononuclear cells
Peripheral blood was treated as follows to obtain mononuclear cells: adding 3ml of human lymphocyte separation liquid into a 15ml centrifuge tube, then gently transferring peripheral blood to the upper surface of the separation liquid, and then centrifuging for 30min at 400 g; taking 1 another 15ml centrifuge tube, adding 10ml PBS, sucking the middle albuginea layer from the centrifuge tube after centrifuging for 30min, transferring to PBS, centrifuging for 10min at 250 g; after the centrifugation is finished, removing the supernatant, adding 5ml of PBS, and centrifuging for 10min at 250g; discarding supernatant, precipitating to obtain peripheral blood mononuclear cells, and standing at-80 deg.C.
1.4 extraction of DNA from mononuclear cells of peripheral blood
(1) Peripheral blood mononuclear cells were centrifuged at 10000rpm (-11200 Xg) for 1min, the supernatant was decanted, 200. Mu.l of buffer GA was added, and the suspension was shaken to complete suspension.
(2) Add 20. Mu.l of protease K solution and mix well.
(3) Adding 200 μ l buffer GB, mixing by thoroughly reversing, standing at 70 deg.C for 10min, cleaning the solution, and centrifuging briefly to remove water droplets on the inner wall of the tube cover.
(4) Add 200. Mu.l of absolute ethanol, mix well for 15sec with shaking, at which time a flocculent precipitate may appear, and centrifuge briefly to remove water droplets on the inner wall of the tube cover.
(5) Adding the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (placing the adsorption column CB3 into a collecting pipe), centrifuging at 12000rpm (-13400 Xg) for 30sec, pouring the waste liquid, and placing the adsorption column CB3 back into the collecting pipe.
(6) To the adsorption column CB3, 500. Mu.l of buffer GD (to check whether or not absolute ethanol has been added before use) was added, and the mixture was centrifuged at 12000rpm (13400 Xg) for 30sec, and the waste liquid was discarded, and the adsorption column CB3 was returned to the collection tube.
(7) To the adsorption column CB3, 600. Mu.l of a rinsing solution PW (to check whether or not absolute ethanol has been added before use) was added, and centrifuged at 12000rpm (13400 Xg) for 30sec to discard the waste liquid, thereby placing the adsorption column CB3 back in the collection tube.
(8) And (5) repeating the operation step (7).
(9) The adsorption column CB3 was returned to the collection tube, centrifuged at 12000rpm (. About.13400 Xg) for 2min, and the waste liquid was discarded. The adsorption column CB3 was left at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.
(10) Transferring the adsorption column CB3 into a clean 1.5ml centrifuge tube, suspending and dripping 50-200 mu l of elution buffer TB into the middle part of an adsorption film, placing for 2-5min at room temperature, centrifuging for 2min at 12000rpm (-13400 Xg), and collecting the solution into the centrifuge tube.
1.5 modification of peripheral blood mononuclear cell DNA
(1) CT conversion Reagent is centrifuged briefly (3000 r is multiplied by 5 min), the cover is opened in the dark, 900ul double distilled water, 300ul M-Dilution Buffer and 50ul M-Dissolving Buffer are added, the mixture is inverted and mixed evenly, and the mixture is shaken for 10min at room temperature (tin paper is wrapped during shaking and the light is shielded), and the mixture is dissolved completely. (prepare PCR tube at shaking).
(2) 20ul of DNA samples were added to the PCR tubes (DNA amount calculated from DNA concentration, 1000/DNA concentration, if 20 is greater than or equal to 20, 20 was taken, if 3.1, 4 was added, 2ul was minimum (i.e. up 1), 20ul total, and insufficient double distilled water was filled up), and 130ul of fully solubilized CT conversion reagent was added to each PCR tube.
(3) Mixing liquid vortex in the PCR tube uniformly, adding the mixture into a PCR instrument after short centrifugation, and setting a program: 98 ℃,10min,64 ℃,2.5h,4 ℃, hold.
(4) The collection tube was nested into the Zymo-spin Tm Ic Column, 600ul M-Binding Buffer was added.
(5) The PCR internal solution was added (about 150 ul) to the Zymo-spin containing 600ul M-Binding Buffer Tm In Ic Column, close the lid, reverse and mix for 1min (shake back and forth by hand).
(6) Centrifuging at constant speed (13400 r/min) for 30s, and discarding the waste liquid.
(7) Adding 100ul M-wash Buffer into Colum, centrifuging at constant speed for 30s, and discarding the waste liquid.
(8) Adding 200ul M-depletion Buffer into Colum, standing at room temperature for 15-20min, centrifuging at constant speed for 30s, and removing waste liquid.
(9) Adding 200ul M-wash Buffer into Colum, centrifuging at constant speed for 30s, and discarding the waste liquid.
(10) Step 9 is repeated.
(11) The adsorption plug was placed in a 1.5ml EP tube, 20ul M-Elution Buffer was added to the nuclear region (bottom of the column), and the modified DNA was eluted by centrifugation at full speed for 30s (supernatant only).
(12) A1.5 ml EP tube was labeled and placed at-20 ℃ until use.
1.6 Illumina Infinium Methylation EPIC Beadchip test
(1) The DNA Methylation level of the mononuclear cells in the peripheral blood of 35 patients with lung adenocarcinoma and 30 healthy examinees is detected by adopting Illumina Infinium Methylation EPIC Beadchip, and sequencing data is mainly analyzed by using a ChAMP package in R language.
(2) And expressing the DNA methylation level by using a beta value, and calculating the adj.p value by adopting a Benjamini-Hochberg method after probe filtration, matrix normalization and batch effect correction.
(3) By comparing the methylation levels of lung adenocarcinoma and healthy control group, we initially screened 1415 differentially methylated sites, including 1178 hypermethylated sites and 237 hypomethylated sites, by defining CpG with | Δ β | > 0.06 and adj.p value < 0.05 as differentially methylated sites. Further, we adjusted the screening conditions to | Δ β | > 0.08 and an adj.p value < 1.0E-05. The results showed a total of 29 differentially methylated sites, including 26 hypermethylated sites and 3 hypomethylated sites. Finally, the position relation between the genes and the sites, primer design factors and the like are comprehensively considered, 5 hypermethylation sites are selected for subsequent verification, and the genes corresponding to the 5 hypermethylation sites are NCOA2, RUNX3, BTD, BRE and ARID1B respectively.
2. Verification of target Gene
The peripheral blood samples were obtained from 35 patients with lung adenocarcinoma and 50 healthy subjects with subject consent. All peripheral blood specimens were obtained from the second hospital of Shandong university and the Qilu hospital of Shandong university. The method comprises the steps of grouping standards, collecting samples, separating peripheral blood mononuclear cells, extracting DNA of the peripheral blood mononuclear cells, modifying the DNA of the peripheral blood mononuclear cells and screening the same target genes.
The 5 hypermethylated sites selected are analyzed by pyrosequencing.
2.1 primer design: primer Design was performed using PyroMark Assay Design 2.0, and the primer sequence information is shown in table 1 below.
TABLE 1 primer sequences
Figure 68951DEST_PATH_IMAGE001
2.2PCR amplification: PCR amplification system (50. Mu.L) is shown in Table 2.
TABLE 2PCR amplification System
Figure 923774DEST_PATH_IMAGE002
The PCR amplification procedure was as follows:
Figure 234670DEST_PATH_IMAGE003
。
2.3 Pyrosequening assay
Reaction binding beads 2. Mu.L, binding buffer 38. Mu.L, and PCR product 40. Mu.L were added to a 96-well PCR reaction plate and mixed well at room temperature for 10min. The vacuum pump was started to suck the binding beads and PCR product suspension, and the beads and PCR product suspension were sequentially immersed in 70% ethanol, 0.2M NaOH and wash buffer for 5s each. The vacuum pump was turned off, the beads on the probe and the PCR product were placed in 40. Mu.L of annealing buffer (1.5. Mu.L containing the sequencing primer), denatured at 85 ℃ for 2min, cooled to room temperature, and the primers were annealed to the template for hybridization. The dose was calculated from Pyrosequencing software sequence design information, and the substrate mixture, enzyme mixture, and four dntps (QIAGEN) were sequentially added to the reagent compartment. The reagent chamber and the 96-well reaction plate were placed in a Pyrosequencing apparatus (PyroMark Q96 ID, QIAGEN) for reaction.
2.4 Data analysis
Pyrosequencing data are analyzed, 5 hypermethylated sites are verified, and the pyrosequencing data can be used for early diagnosis of lung adenocarcinoma. The genes corresponding to the 5 hypermethylated sites are NCOA2, RUNX3, BTD, BRE and ARID1B respectively.
In conclusion, through the screening and verification, the invention finally determines 5 methylated genes for early diagnosis of lung adenocarcinoma: NCOA2, RUNX3, BTD, BRE and ARID1B, and provides a novel detection method for early diagnosis of lung adenocarcinoma.
Example 2
A multigene methylation kit for early diagnosis of lung adenocarcinoma, wherein the kit comprises: KAPA PROBE FAST qPCR Master Mix (2 ×); KAPA PROBE FAST ROX Low (50 ×); ddH 2 O; methylation specific primers for the NCOA2, RUNX3, BTD, BRE, ARID1B gene target sites; a methylation specific TaqMan probe of the NCOA2, RUNX3, BTD, BRE and ARID1B gene target site; internal reference gene primers; an internal reference gene TaqMan probe. The reference gene is actin. The NCOA2 gene destination site is a methylation modified site located in 5'UTR, the RUNX3 gene destination site is a methylation modified site located in Body, the BTD gene destination site is a methylation modified site located in 3' UTR, the BRE gene destination site is a methylation modified site located in Body, and the ARID1B gene destination site is a methylation modified site located in Body.
The kit has the advantages that the 5 genes are simultaneously subjected to combined detection in one PCR reaction hole, the detection sensitivity is improved, and the kit is particularly suitable for early detection of lung adenocarcinoma.
The methylation specific primers and probes of the NCOA2 gene target site comprise:
a forward primer: TAAAGTTTATTGTCGGTGGTAGAAGA,
reverse primer: ATTTTACTAAATAATAATCTTCTTTCTCCG;
and (3) probe: TCCTTCTTTCATTATATTTACTCATTTCTTTTC.
The methylation specific primers and probes of the RUNX3 gene target site comprise:
a forward primer: GGGGTTTATAGTTAGTTTGGGTTC,
reverse primer: aaataacactaaactctacctaaaacg;
and (3) probe: ACCTACATCTATAATCCCGATATCTAT.
The methylation specific primers and probes of the target site of the BTD gene comprise:
a forward primer: TATATTTTTTTTTAATAAATTTTTTTTAGTATGCG,
reverse primer: aaaaaaccccaaaccactttat;
and (3) probe: AACTAACATTTTATTTTTATTTTAACTTAAAACCAACG.
The methylation specific primers and probes of the BRE gene target site comprise:
a forward primer: GTTTTATTTAATAAGTTTTTTTTAGAAGTTTTTCG,
reverse primer: AACATACCCTCAACTCACTATTCTCAA;
and (3) probe: AACGAAAACGAATTATAAAATATCAACC.
The methylation specific primers and probes of the ARID1B gene target site comprise:
a forward primer: TTTGTTAGGTAGTGCGGTTTG,
reverse primer: AATACTAATTCTAACACTCCCTAACAACG;
and (3) probe: ACCTCCTAAACTATAATTCTATCATCTAAAAATAACTACG.
The primer and the probe of the reference gene comprise:
a forward primer: TGGTGATGGAGGAGGTTTAGTAAGT,
reverse primer: AACCAATAAAACCTACTCTCTCCCCTTTAAA;
and (3) probe: ACCACACCCAACCCAACAATAACAACACACA.
(1) Instruments, reagents, primers:
the instrument comprises the following steps: NANODROP 2000, ABI QuantstudioDX, centrifuge, water bath, vortex oscillator, and refrigerator.
Reagent: histopaque-1077 human lymphocyte isolate (SIGMA), DNA extraction Kit (TIANGEN), EZ DNA Methylation-Gold Kit (Zymo), KAPA PROBE FAST qPCR Master Mix (2X); KAPA PROBE FAST ROX Low (50X), ddH 2 O。
Primer: all primers should be of electrophoretic (PAGE) or HPLC grade and contain no miscellaneous bands. Providing quality inspection evidence of the synthetic product from the synthesis mechanism, such as PAGE electrophoresis result or HPLC analysis map, and proving that after the synthetic product is purified by using PAGE or HPLC, a single peak PAGE or HPLC analysis map is obvious, and the concentration is 10 ng/mul for standby.
(2) Study object
The peripheral blood samples were obtained from 84 patients with lung adenocarcinoma and 84 healthy subjects with subject consent. All peripheral blood specimens were obtained from the second hospital of Shandong university and the Qilu hospital of Shandong university. Grouping standard same target gene screening stage.
(3) Specimen collection
The same procedure as in example 1 was repeated to select a desired gene.
(4) Isolation of peripheral blood mononuclear cells
The same procedure as in example 1 was repeated for the selection of the desired gene.
(5) Extraction of peripheral blood mononuclear cell DNA
The same procedure as in example 1 was repeated to select a desired gene.
(6) Modification of peripheral blood mononuclear cell DNA
The same procedure as in example 1 was repeated for the selection of the desired gene.
(7) Establishment of polygene methylation joint detection method
Based on the qPCR method, methylation levels of a plurality of genes are quantitatively detected in one reaction well at the same time. Thus, this example designs a multiplex methylation PCR detection method with two different fluorophore probes. FAM fluorophore was used to label 5 methylated genes and VIC fluorophore was used to label an internal reference gene, and the method quantitatively detected the total methylation level of 5 genes.
(8) System and conditions for qPCR reactions
The qPCR amplification reaction system consists of: KAPA PROBE FAST qPCR Master Mix (2 ×): 5 mu l of the solution; KAPA PROBE FAST ROX Low (50 ×): 0.2 μ l; NCOA2 forward primer (F): 0.25 μ l; NCOA2 reverse primer (R): 0.25 μ l; NCOA2 probe: 0.1 μ l; RUNX3 forward primer (F): 0.25 μ l; RUNX3 reverse primer (R): 0.25 μ l; RUNX3 Probe: 0.1 μ l; BTD forward primer (F): 0.25 μ l; BTD reverse primer (R): 0.25 μ l; BTD probe: 0.1 mul; BRE forward primer (F): 0.25 μ l; BRE reverse primer (R): 0.25 μ l; and (3) BRE probe: 0.1 mul; ARID1B forward primer (F): 0.25 μ l; ARID1B reverse primer (R): 0.25 μ l; ARID1B probe: 0.1 μ l; actin forward primer (F): 0.06 mul; actin reverse primer (R): 0.06 mul; actin probe: 0.05 μ l; DNA:1 mul; ddH 2 O：0.63μl。
The detection genes are NCOA2 methylation gene, RUNX3 methylation gene, BTD methylation gene, BRE methylation gene and ARID1B methylation gene, and the reference genes are actin. The probe 5 'end report fluorescent group of the NCOA2, RUNX3, BTD, BRE and ARID1B genes is FAM, the probe 3' end quenching group of the NCOA2, RUNX3, BTD, BRE and ARID1B genes is BHQ1, the probe 5 'end report fluorescent group of the reference gene is VIC, and the probe 3' end quenching group of the reference gene is BHQ1.
Preparing a mixed solution in a qPCR tube according to the step (8), and then carrying out PCR reaction according to the following conditions: pre-denatured Reps:1, 95 ℃ for 3min; and (3) cyclic reaction: reps:40 95 ℃ for 3sec;58 ℃ for 30sec.
(9) Sample application layout for PCR reactions (see Table 3, table 4)
Samples to be tested are loaded in a 96-well plate of a PCR instrument, and the layout is shown in the following table. In the table, NC represents healthy human specimens, and LUAD represents lung adenocarcinoma patient specimens.
TABLE 3 sample addition layout for PCR reactions
Figure 301983DEST_PATH_IMAGE005
TABLE 4 sample addition layout for PCR reactions
Figure 381935DEST_PATH_IMAGE006
(10) Detection results and result analysis
The internal reference genes actin of the sample should have amplification signals, the actin Ct value is less than or equal to 32, and the samples are S-shaped amplification curves, and when the conditions are met, the experiment is proved to be effective, and the analysis can be continued. Otherwise, a retest is recommended.
FIG. 1 is a qPCR amplification curve for methylation of internal reference genes, a qPCR amplification curve for methylation of single genes NCOA2, RUNX3, BTD, BRE, ARID1B, and a comparison of the qPCR amplification curves for methylation of multiple genes. Where the abscissa indicates the number of cycles required for qPCR amplification to reach a threshold, and the ordinate indicates the logarithmic value of the corrected fluorescence intensity. It can be seen that the amplification effect of the multi-gene methylation qPCR is the superposition of the amplification effects of the methylation qPCR of a plurality of single genes.
FIG. 2 is a schematic diagram: and drawing a scatter diagram according to the detection result of the sample. Wherein, the abscissa represents the sample type, and the ordinate represents the difference between the cycle times of the polygenes and the cycle times of the reference genes when the qPCR amplification reaches the threshold value. It can be seen that the polygene methylation of lung adenocarcinoma patients was significantly different from that of healthy controls (P < 0.0001).
FIG. 3: and drawing an ROC curve according to the detection result of the sample. Diagnostic cutoff was-1.236, auc =0.893, sensitivity was 88.1%, specificity was 82.1%.
The above description is only a preferred embodiment of the present invention, and not intended to limit the present invention in other forms, and any person skilled in the art may apply the above modifications or changes to the equivalent embodiments with equivalent changes, without departing from the technical spirit of the present invention, and any simple modification, equivalent change and change made to the above embodiments according to the technical spirit of the present invention still belong to the protection scope of the technical spirit of the present invention.

Claims (4)

1. The application of the methylation level markers of NCOA2, RUNX3, BTD, BRE and ARID1B genes in peripheral blood mononuclear cells in a lung adenocarcinoma early diagnosis kit.
2. A polygene methylation kit for early diagnosis of lung adenocarcinoma is characterized by comprising methylation specific primers and methylation specific TaqMan probes of target sites of NCOA2, RUNX3, BTD, BRE and ARID1B genes, as well as an internal reference actin gene primer and an internal reference actin gene TaqMan probe,
methylation specific primer sequences of NCOA2 gene target sites are shown in a sequence table SEQ ID NO.1 and a sequence table SEQ ID NO.2, and probe sequences are shown in a sequence table SEQ ID NO. 3;
methylation specific primer sequences of the RUNX3 gene target site are shown in a sequence table SEQ ID NO.4 and a sequence table SEQ ID NO.5, and probe sequences are shown in a sequence table SEQ ID NO. 6;
methylation specific primer sequences of target sites of the BTD gene are shown in sequence tables SEQ ID NO.7 and SEQ ID NO.8, and probe sequences are shown in sequence table SEQ ID NO. 9;
methylation specific primer sequences of BRE gene target sites are shown in a sequence table SEQ ID NO.10 and a sequence table SEQ ID NO.11, and probe sequences are shown in a sequence table SEQ ID NO. 12;
methylation specific primer sequences of the target site of the ARID1B gene are shown in a sequence table SEQ ID NO.13 and a sequence table SEQ ID NO.14, and probe sequences are shown in a sequence table SEQ ID NO. 15;
methylation specific primer sequences of the target sites of the internal reference actin gene are shown in sequence tables SEQ ID NO.16 and SEQ ID NO.17, and probe sequences are shown in sequence table SEQ ID NO. 18.
3. The polygenic methylation kit for early diagnosis of lung adenocarcinoma according to claim 2, wherein the reporter group at the 5 'end of the probe for the genes NCOA2, RUNX3, BTD, BRE, and ARID1B is FAM, the quencher group at the 3' end of the probe for the genes NCOA2, RUNX3, BTD, BRE, and ARID1B is BHQ1, the reporter group at the 5 'end of the probe for the gene endogactin is VIC, and the quencher group at the 3' end of the probe for the gene endogactin is BHQ1.
4. A multi-gene methylation kit for early diagnosis of lung adenocarcinoma according to claim 2, further comprising a diagnostic model having the formula:
Δ Ct value = (NCOA 2, RUNX3, BTD, BRE, ARID1B gene total Ct value) -reference gene Ct value;
if the delta Ct value is less than or equal to-1.236, the methylation is positive;
if the delta Ct value is > -1.236, the methylation is negative;
actin Ct value > 32 or no amplification, invalid results, need to be re-detected.
CN202210978815.1A 2022-08-16 2022-08-16 Polygene methylation kit for early diagnosis of lung adenocarcinoma Active CN115725737B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202210978815.1A CN115725737B (en) 2022-08-16 2022-08-16 Polygene methylation kit for early diagnosis of lung adenocarcinoma
PCT/CN2022/134024 WO2024036802A1 (en) 2022-08-16 2022-11-24 Multi-gene methylation kit for early diagnosis of lung adenocarcinoma

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210978815.1A CN115725737B (en) 2022-08-16 2022-08-16 Polygene methylation kit for early diagnosis of lung adenocarcinoma

Publications (2)

Publication Number Publication Date
CN115725737A true CN115725737A (en) 2023-03-03
CN115725737B CN115725737B (en) 2023-09-08

Family

ID=85292764

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210978815.1A Active CN115725737B (en) 2022-08-16 2022-08-16 Polygene methylation kit for early diagnosis of lung adenocarcinoma

Country Status (2)

Country Link
CN (1) CN115725737B (en)
WO (1) WO2024036802A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190241633A1 (en) * 2016-05-04 2019-08-08 Curevac Ag Rna encoding a therapeutic protein
CN110964811A (en) * 2018-09-29 2020-04-07 广州市康立明生物科技有限责任公司 HOXA9 methylation detection reagent
WO2021216460A1 (en) * 2020-04-19 2021-10-28 Figene, Llc Gene modified fibroblasts for therapeutic applications
CN113817831A (en) * 2021-10-12 2021-12-21 湖南聚点生物科技有限公司 Primer and kit for diagnosis and detection of lung adenocarcinoma and detection method of methylation region

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10767231B2 (en) * 2008-03-14 2020-09-08 Genomictree, Inc. Method for detecting lung cancer using lung cancer-specific methylation marker gene
CN111187841A (en) * 2020-03-11 2020-05-22 华东医院 Methylated molecular marker for diagnosing lung adenocarcinoma and application thereof
EP3945135A1 (en) * 2020-07-27 2022-02-02 Les Laboratoires Servier Biomarkers for diagnosing and monitoring lung cancer
KR102194103B1 (en) * 2020-09-09 2020-12-22 강원대학교병원 Method for predicting survival rate of non-small cell lung cancer patients by differential methylation signal association analysis
CN113774131B (en) * 2020-12-21 2023-12-15 首都医科大学附属北京胸科医院 Molecular typing marker and kit for early diagnosis, treatment and prognosis detection of non-small cell lung cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190241633A1 (en) * 2016-05-04 2019-08-08 Curevac Ag Rna encoding a therapeutic protein
CN110964811A (en) * 2018-09-29 2020-04-07 广州市康立明生物科技有限责任公司 HOXA9 methylation detection reagent
WO2021216460A1 (en) * 2020-04-19 2021-10-28 Figene, Llc Gene modified fibroblasts for therapeutic applications
CN113817831A (en) * 2021-10-12 2021-12-21 湖南聚点生物科技有限公司 Primer and kit for diagnosis and detection of lung adenocarcinoma and detection method of methylation region

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JUN LIU 等: "Network Pharmacology-Based Analysis of the Effects of Corydalis decumbens (Thunb.) Pers. in Non-Small Cell Lung Cancer", EVIDENCE-BASED COMPLEMENTARY AND ALTERNATIVE MEDICINE, vol. 2021 *
鲁德;姬晓青;刘伟;: "非小细胞肺癌患者血清RUNX3基因异常甲基化的检测及意义", 肿瘤防治研究, no. 06 *

Also Published As

Publication number Publication date
CN115725737B (en) 2023-09-08
WO2024036802A1 (en) 2024-02-22

Similar Documents

Publication Publication Date Title
Wu et al. Advances in molecular biomarkers for gastric cancer: miRNAs as emerging novel cancer markers
CA2737137C (en) Method for diagnosing lung cancers using gene expression profiles in peripheral blood mononuclear cells
JP2015128442A (en) Plasma micrornas for detecting early colorectal cancer
CN106834462A (en) One group of application of stomach oncogene
AU2008220841A1 (en) Method for predicting the occurrence of metastasis in breast cancer patients
WO2016115354A1 (en) Methods for cancer diagnosis and prognosis
CA2679943A1 (en) Multigene assay to predict outcome in an individual with glioblastoma
JP2010537659A (en) Methods and tools for prognosis of cancer in ER-patients
CN110408703B (en) Colorectal cancer miRNA marker and application thereof
CN106967719B (en) Application of long-chain non-coding RNA as prostate cancer molecular marker
CN110229899B (en) Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer
KR102096498B1 (en) MicroRNA-4732-5p for diagnosing or predicting recurrence of colorectal cancer and use thereof
Sun et al. PBX3 hypermethylation in peripheral blood leukocytes predicts better prognosis in colorectal cancer: A propensity score analysis
JP2022534591A (en) Detection of hypermethylated genes for diagnosing pancreatic cancer
CN115725737B (en) Polygene methylation kit for early diagnosis of lung adenocarcinoma
AU2018244758B2 (en) Method and kit for diagnosing early stage pancreatic cancer
US10934590B2 (en) Biomarkers for breast cancer and methods of use thereof
CN111575374B (en) Molecular marker for early pancreatic tumor detection, detection method and application thereof
CN108753981A (en) Application of the quantitative detection of HOXB8 genes in colorectal cancer Index for diagnosis
KR102096499B1 (en) MicroRNA-3960 for diagnosing or predicting recurrence of colorectal cancer and use thereof
EP3050975A1 (en) Method for predicting the response to chemotherapy treatment in patients suffering from colorectal cancer
WO2023083308A1 (en) Method for evaluating prognosis of colorectal cancer based on dna methylation
Li et al. Prediction and analysis of hub genes in ovarian cancer based on network analysis
Li et al. ZFHX3 methylation in peripheral blood monocytes as a potential biomarker for pancreatic cancer detection
CN116732179A (en) Non-small cell lung cancer related lncRNA molecular marker and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant