CN110938641A

CN110938641A - Chimeric antigen receptor targeting APRIL and uses thereof

Info

Publication number: CN110938641A
Application number: CN201811113025.7A
Authority: CN
Inventors: 刘雅容
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2018-09-25
Filing date: 2018-09-25
Publication date: 2020-03-31

Abstract

The invention relates to a chimeric antigen receptor targeting APRIL and application thereof, in particular to a polynucleotide sequence selected from (1) a polynucleotide sequence containing a coding sequence of an anti-APRIL single-chain antibody, a coding sequence of a human CD8 α hinge region, a coding sequence of a human CD8 transmembrane region, a coding sequence of a human CD28 intracellular region, a coding sequence of a human 41BB intracellular region, a coding sequence of a human CD3 zeta intracellular region and an optional coding sequence of a fragment containing an extracellular domain III and an extracellular domain IV of EGFR, and (2) (1) a complementary sequence of the polynucleotide sequence.

Description

Chimeric antigen receptor targeting APRIL and uses thereof

Technical Field

The invention belongs to the field of chimeric antigen receptors, and particularly relates to a BCMA (brain cell activating antigen) targeted chimeric antigen receptor and application thereof.

Background

Multiple myeloma is a malignant plasma cell disease, which is characterized by malignant clonal proliferation of bone marrow plasma cells, secretion of monoclonal immunoglobulin or a fragment thereof (M protein), and damage to relevant target organs or tissues such as bones and kidneys, and is commonly and clinically manifested by bone pain, anemia, renal insufficiency, infection and the like [ Multiple myelotoma.N Engl J Med,2011.364(11): p.1046-60 ]. Multiple myeloma is the second most serious malignancy in the blood system, accounting for 10% of the malignancy in the blood system, and is frequently developed in men, the incidence rate of which increases year by year with the increase of age, and the multiple myeloma is more likely to become younger in recent years [ Siegel, R., et al, Cancer statistics,2014.CA Cancer J Clin,2014.64(1): p.9-29 ].

Proliferation-inducing ligand (APRIL), 1 of the 2 already established ligands of BCMA, has a stronger affinity to receptors on Plasma Cells (PC) than B cell activating factor (BAFF), is more specific, but is absent in other B and T lineage cells. APRIL binds to transmembrane activator and calcium modulator receptor (TACI) in addition to BCMA, and TACI is overexpressed on patients with malignant PC tumors. APRIL is secreted mainly by bone marrow cells and has the effect of maintaining abnormal bone marrow cell growth infiltrated by multiple myeloma. In ex vivo culture experiments, Osteoclasts (OCs) stimulate multiple myeloma growth while also stimulating bone lesions during disease progression, secreting more APRIL than CD14+ unstimulated monocytes. In contrast to BAFF, APRIL, in addition to receptor-mediated effects, can promote survival of malignant plasma cells by interacting with heparan sulfate proteoglycan CD138, and thus CD138 has the effects of modulating growth factor signaling, cytoskeletal composition and cell adhesion and migration. APRIL can rescue interleukin 6(IL-6) -dependent multiple myeloma cell lines from depriving IL-6 of apoptosis during culture. Taken together, these results indicate that there is a potential therapeutic strategy to prevent BCMA activation in myeloma cells with APRIL monoclonal antibodies.

The effect of targeting BCMA can be supplemented by blocking its binding to the ligands APRIL and BAFF, which are able to bind APRIL and BAFF due to TACI also expressed by the subcells of MM patients. However, TACI expression patterns are not restricted by BCMA, which is also present in normal T and B cells. Neutralizing BAFF monoclonal antibody (LY2127355) and combining bortezomib treated MM patients, the assay has a good tolerability and safety profile. Atacicept, a fusion protein that binds and neutralizes BAFF and APRIL and is intended to block B cell activation by TACI. It can inhibit the proliferation of MM cells and induce apoptosis in patients. The first therapeutic APRIL neutralizing monoclonal antibody has been used in preclinical studies of MM. The specific mechanism is to block APRIL-induced signaling cascade through BCMA, further inhibiting the growth and survival of MM cells in the bone marrow environment. The anti-APRIL monoclonal antibody can be conjugated to an anti-BCMA antibody drug or to a naked monoclonal antibody to further enhance cytotoxicity of either and overcome resistance in the bone marrow microenvironment.

Chimeric Antigen Receptor-T cell (CAR-T) T cell refers to a T cell that is genetically modified to recognize a specific Antigen of interest in an MHC non-limiting manner and to continuously activate expanded T cells. The international cell therapy association (interna) in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors besides surgery, radiotherapy and chemotherapy, and will become a necessary means for treating tumors in the future. CAR-T cell back-infusion therapy is the most clearly effective form of immunotherapy in current tumor therapy. A large number of studies show that the CAR-T cells can effectively recognize tumor antigens, cause specific anti-tumor immune response and remarkably improve the survival condition of patients.

Chimeric Antigen Receptors (CARs) are a core component of CAR-T, conferring on T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR-engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of a CAR includes a tumor-associated antigen (TAA) binding region (usually the scFV fragment from the antigen binding region of a monoclonal antibody), an extracellular hinge region, a transmembrane region, and an intracellular signaling region. The choice of antigen of interest is a key determinant for the specificity, efficacy of the CAR and safety of the genetically engineered T cells themselves.

With the continuous development of Chimeric Antigen Receptor T cell (CAR-T) technology, CAR-T can be divided into four generations.

The first generation CAR-T cells consist of an extracellular binding domain-single chain antibody (scFV), a transmembrane domain (TM), and an intracellular signaling domain-Immunoreceptor Tyrosine Activation Motif (ITAM), wherein the chimeric antigen receptor portions are linked as follows: scFv-TM-CD3 ζ. Although some specific cytotoxicity could be seen in the first generation CARs, it was found to be less effective when summarized in 2006 in clinical trials. The reason for this is because the first generation of CAR-T cells are rapidly depleted in the patient and have so poor persistence that CAR-T cells already apoptotic when they have not yet come into contact with a large number of tumor cells can elicit an anti-tumor cytotoxic effect, but rather less cytokine secretion, but their short survival time in vivo fails to elicit a persistent anti-tumor effect [ simple g2D-modified T cells inhibition system T-cell lymphoma growth in a mannenrinating multiple cytokines and cytotoxic pathways, Cancer 2007, 67 (22): 11029 vs 11036).

Optimization of T cell activation signaling regions in CAR design of second generation CAR-T cells remains a hotspot of research. Complete activation of T cells relies on dual signaling and cytokine action. Wherein the first signal is a specific signal initiated by the recognition of an antigen peptide-MHC complex on the surface of an antigen presenting cell by the TCR; the second signal is a co-stimulatory signal. Second generation CAR appeared as early as 1998 (J Immunol.1998; 161 (6): 2791-7). The 2 nd generation CAR adds a costimulatory molecule in the intracellular signal peptide region, namely the costimulatory signal is assembled into the CAR, and can better provide an activation signal for CAR-T cells, so that the CAR can simultaneously activate the costimulatory molecule and the intracellular signal after identifying tumor cells, double activation is realized, and the proliferation and secretion capacity of the T cells and the anti-tumor effect can be obviously improved. The first well-studied T cell costimulatory signal receptor was CD28, which was capable of binding to a B7 family member on the surface of target cells. Co-stimulation of CD28 promotes T cell proliferation, IL-2 synthesis and expression, and enhances T cell resistance to apoptosis. Costimulatory molecules such as CD134(OX40) and 41BB (4-1BB) are subsequently presented to increase cytotoxicity and proliferative activity of T cells, maintain T cell responses, prolong T cell survival, and the like. Such second generation CARs produced unexpected results in subsequent clinical trials, with shaking frequently triggered since 2010 based on clinical reports of second generation CARs, with complete remission rates of up to 90% and above, especially for relapsed, refractory ALL patients.

The third generation CAR signal peptide region integrates more than 2 costimulatory molecules, which can lead the T cells to continuously activate and proliferate, lead the cytokines to be continuously secreted, and lead the capability of the T cells to kill tumor cells to be more remarkable, namely, the new generation CAR can obtain stronger anti-tumor response (Mol ther., 2005, 12 (5): 933-941). Most typically, U Pen Carl June is added with a 41BB stimulating factor under the action of CD28 stimulating factor.

The fourth generation CAR-T cells are supplemented with cytokines or co-stimulatory ligands, for example the fourth generation CAR can produce IL-12, which can modulate the immune microenvironment-increase the activation of T cells, and simultaneously activate innate immune cells to act to eliminate target antigen negative cancer cells, thus achieving a bi-directional regulatory effect [ TRUCKs: the four generation of cars, Expert Opin Biol ther, 2015; 15(8): 1145-54 ].

One advantage of CAR-T cells is that they are active drugs, and once infused, physiological mechanisms regulate T cell balance, memory formation, and antigen-driven expansion. However, this treatment is not complete and T cells can miss the target and attack other tissues or expand too much beyond what is needed for treatment. Given that CAR-T cells have been included in the standard therapeutic range, it is very useful to design patient or drug-controlled turn-on or turn-off mechanisms to regulate the presence of CAR-T cells. For technical reasons, the shutdown mechanism is more easily applied to T cells. As one of them, the iCas9 system is under clinical study. When the cell expresses the iCas9, the small molecule compound can induce the iCas9 precursor molecule to form a dimer and activate an apoptosis pathway, thereby achieving the purpose of removing the cell. Small molecule AP1903 has been used to induce iCas9 dimers and clear T cells in graft versus host disease, demonstrating the feasibility of this approach (Making cutter clinical antibiotic candidates for adaptive T-cell therapy, Clin Cancer Res; 22(8), 2016, 15/4).

In addition, the clinical clearing antibody can be used to make CAR-T cells simultaneously express the protein against which these antibodies are directed, such as tEGFR, and after the treatment-related toxic reaction occurs or the treatment is completed, the corresponding CAR-T cells can be cleared by administration of antibody drugs (Rational resolution and characterization of humanized-EGFR variant III clinical anti-cancer receptors T cells for cytolethama, SciTransl Med 2015; 7: 275ra 22).

Disclosure of Invention

In a first aspect, the present invention provides a polynucleotide sequence selected from the group consisting of:

(1) a polynucleotide sequence comprising the coding sequence of an anti-APRIL single chain antibody, the coding sequence of a human CD8 α hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human CD28 intracellular region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 zeta intracellular region, and optionally the coding sequence of a fragment of EGFR containing extracellular domain III and extracellular domain IV, and

(2) (1) the complement of the polynucleotide sequence.

In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a signal peptide prior to the coding sequence of the anti-APRIL single chain antibody, in one or more embodiments, the amino acid sequence of the signal peptide is represented by amino acids 1-21 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the light chain variable region of the anti-APRIL single chain antibody is represented by amino acids 22-167 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequences of the human CD8 α hinge region and the CD8 transmembrane region are represented by amino acids 168-236 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the intracellular region of human CD28 is represented by amino acids 237-237 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the human 41BB intracellular region is represented by amino acids 325 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the extracellular region of human 41BB III is represented by amino acids 3 of SEQ ID NO. 35, the amino acids of the extracellular region of SEQ ID NO. 310, the EGFR III, the extracellular region of EGFR III, or the EGFR III-III domain consists of the extracellular region of the EGFR III, the EGFR III-III structure, the amino acid sequence of SEQ ID NO. 310, the extracellular region of SEQ ID NO. 23, or the EGFR III-III region of the EGFR III region of SEQ ID NO. 23, the EGFR III-III region of the EGFR III-III region of the EGFR structure.

In one or more embodiments, the coding sequence for the signal peptide preceding the coding sequence for the anti-APRIL single-chain antibody is represented by the nucleotide sequence from position 1 to 63 of SEQ ID NO. 1, in one or more embodiments, the coding sequence for the anti-APRIL single-chain antibody is represented by the nucleotide sequence from position 64 to 501 of SEQ ID NO. 1, in one or more embodiments, the coding sequence for the hinge region and the CD8 transmembrane region of human CD8 α is represented by the nucleotide sequence from position 502 to 708 of SEQ ID NO. 1. in one or more embodiments, the coding sequence for the intracellular region of human CD28 is represented by the nucleotide sequence from position 709 to 831 of SEQ ID NO. 1. in one or more embodiments, the coding sequence for the intracellular region of human 41BB is represented by the nucleotide sequence from position 832 to 975 of SEQ ID NO. 1. in one or more embodiments, the coding sequence for the intracellular region of human CD3 is represented by the nucleotide sequence from position 976 to position 1308 of SEQ ID NO. 1 or the nucleotide sequence from position 1308 to 1308.

In a second aspect, the invention provides a fusion protein selected from the group consisting of:

(1) a fusion protein comprising an anti-APRIL single-chain antibody, a human CD8 α hinge region, a human CD8 transmembrane region, a human CD28 intracellular region, a human 41BB intracellular region and a human CD3 zeta intracellular region, which are linked in this order, and optionally a coding sequence of a fragment of EGFR comprising extracellular domain III and extracellular domain IV, and

(2) and (2) the fusion protein derived from the protein (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in the protein (1) and retaining the activity of activated T cells.

In one or more embodiments, the fusion protein further comprises a signal peptide at the N-terminus of the anti-APRIL single chain antibody, in one or more embodiments, the amino acid sequence of the signal peptide is represented by amino acids 1-21 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the anti-APRIL single chain antibody is represented by amino acids 22-167 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the hinge region and the CD8 transmembrane region is represented by amino acids 168-236 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the intracellular region of human CD28 is represented by amino acids 237-277 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the extracellular domain of human 41BB comprises amino acids 278-325 of SEQ ID NO. 2 in one or more embodiments, the amino acid sequence of the extracellular domain of human CD 35 is represented by amino acids 819-IV, the extracellular domain of SEQ ID NO. 310, the amino acid sequence of EGFR III, the extracellular domain of EGFR III, or the EGFR III-310, EGFR III-structure consisting of the amino acids of SEQ ID NO, or the extracellular domain of SEQ ID NO: 310, the amino acid sequence of SEQ ID NO. 23-IV-III-structure of the EGFR structure or the EGFR region of the EGFR structure is represented by one or the amino acid sequence of SEQ ID-III.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, a polynucleotide sequence described herein, and optionally a selectable marker.

In a fourth aspect, the invention provides a retrovirus containing a nucleic acid construct as described herein, preferably containing the vector, more preferably containing the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein, or stably expressing a fusion protein as described herein and optionally a fragment of EGFR comprising extracellular domain III, extracellular domain IV and optionally a transmembrane region.

In a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

In a seventh aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T cell described herein, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of an APRIL-mediated disease.

In one or more embodiments, the APRIL-mediated disease is multiple myeloma.

Drawings

FIG. 1 is a schematic representation of an APRIL-CAR retroviral expression vector (APRIL-28 BBz-tEGFR).

FIG. 2 shows the efficiency of APRIL-28BBz-tEGFR CAR + expression by retrovirus-infected T cells for 72 hours using flow cytometry.

Detailed Description

The invention provides a Chimeric Antigen Receptor (CAR) targeting APRIL, the CAR comprising an anti-APRIL single chain antibody, a human CD8 α hinge region, a human CD8 transmembrane region, a human CD28 intracellular region, a human 41BB intracellular region, a human CD3 zeta intracellular region, and optionally an extracellular domain III and extracellular domain IV-containing fragment of EGFR, linked in sequence.

Optionally, the light chain variable region and the heavy chain variable region may be linked together by a linker sequence. In certain embodiments, the amino acid sequence of the anti-APRIL single chain antibody is represented by amino acid residues 22-167 of SEQ ID NO 2.

The amino acid sequences of the hinge region and CD8 transmembrane region of human CD8 α suitable for use in the present invention can be represented by amino acids 168-236 of SEQ ID NO. 2.

CD28 suitable for use in the present invention can be a variety of CD28 for CARs known in the art. As an illustrative example, the present invention uses CD28 shown in the amino acid sequence at position 237-277 of SEQ ID NO 2.

The 41BB suitable for use in the present invention can be any of the various 41 BBs known in the art for use in CARs. As an illustrative example, the present invention uses the 41BB shown in the amino acid sequences 278-.

The intracellular domain of human CD3 ζ suitable for use in the present invention may be various intracellular domains of human CD3 ζ conventionally used in CARs in the art. In certain embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in SEQ ID NO 2 amino acids 326-436.

The above-mentioned portions forming the fusion protein of the invention, such as the variable region of an anti-APRIL single chain antibody, the human CD8 α hinge region, the human CD8 transmembrane region, CD28, 41BB, and the human CD3 zeta intracellular region, and the like, may be directly linked to each other or may be linked by a linker sequence which is well known in the art and which is suitable for antibodies, such as a linker sequence comprising G and S, typically the linker comprises one or more motifs which repeat back and forth, for example, the motifs may be GGGS, ggggggs, SSSSG, gsgsgsa, and ggsgg, preferably the motifs are contiguous in the linker sequence without the insertion of amino acid residues between the repeats, the linker sequence may comprise 1, 2, 3, 4, or 5 repeating motifs, the length of the linker may be 3 to 25 amino acid residues, such as 3 to 15, 5 to 15, 10 to 20 amino acid residues, in some embodiments the linker sequence is a polyglycine linker sequence, the number of which is not particularly limited, and is 2 to 2, 2 to 10 to 20 amino acid residues, such as phenylalanine (E), arginine (R) and Q, and the like.

In certain embodiments, the amino acid sequence of the CAR of the invention is as set forth in amino acids 22-436 of SEQ ID No. 2 or amino acids 1-436 of SEQ ID No. 2. In certain embodiments, the CAR of the invention further comprises within its amino acid sequence extracellular domain III and extracellular domain IV-containing fragments of EGFR, as described below, signal peptides thereof, and linker sequences.

It will be appreciated that in gene cloning procedures it is often necessary to design appropriate cleavage sites which will introduce one or more irrelevant residues at the end of the expressed amino acid sequence without affecting the activity of the sequence of interest. In order to construct a fusion protein, facilitate expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside of a host cell, or facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-terminus or the carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty 1. These tags can be used to purify proteins.

The invention also includes a CAR represented by the amino acid sequence at positions 22-436 of SEQ ID NO. 2, a CAR represented by the amino acid sequence at positions 1-436 of SEQ ID NO. 2, or a mutant of the CAR represented by SEQ ID NO. 2. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity (e.g., activating T cells) of the CAR. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp from NCBI.

Mutants also include amino acid sequences having one or several mutations (insertions, deletions or substitutions) in the amino acid sequence shown in positions 22-436 of SEQ ID No. 2, the amino acid sequence shown in positions 1-436 of SEQ ID No. 2 or the amino acid sequence shown in SEQ ID No. 2, while still retaining the biological activity of the CAR, said several mutations typically referring to within 1-10, such as 1-8, 1-5 or 1-3 substitutions are preferably conservative substitutions, e.g. conservative substitutions with similarly performing or similar amino acids in the art do not typically alter the function of the protein or polypeptide "functionally similar or similar amino acids" include, for example, families of amino acid residues with similar side chains, which families include amino acids with basic side chains (e.g. lysine, arginine, histidine), amino acids with acidic side chains (e.g. aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with nonpolar side chains (e.g. alanine, phenylalanine, valine, tryptophan.

The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences which encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. For example, in certain embodiments, the polynucleotide sequence encoding the fusion protein described herein is represented by nucleotides 64 to 1308 of SEQ ID NO. 1, or by nucleotides 1 to 1308 of SEQ ID NO. 1.

In certain embodiments, the polynucleotide sequences of the invention further comprise nucleotide sequences encoding fragments of EGFR.

The EGFR suitable for use in the present invention may be an EGFR known in the art, e.g., from human. EGFR contains N-terminal extracellular domains I and II, extracellular domain III, extracellular domain IV, transmembrane, juxtamembrane domain and tyrosine kinase domain. The present invention preferably uses a truncated EGFR ("tfegfr", i.e., a fragment of EGFR as described herein), particularly a truncated EGFR that does not include its intracellular regions (membrane proximal domain and tyrosine kinase domain). In certain embodiments, EGFR that does not include an intracellular region may be further truncated to include no extracellular domains I and II. Thus, in certain embodiments, the EGFR used in the present invention contains or consists of the extracellular domain III, the extracellular domain IV and the transmembrane region of EGFR. In certain embodiments, the tEGFR comprises or consists of the amino acid sequence at positions 310 and 646 of the human EGFR, wherein the amino acid sequence at positions 310 and 480 is the extracellular domain III of the human EGFR, the amino acid sequence at positions 481 and 620 is the extracellular domain IV of the human EGFR, and the amino acid sequence at positions 621 and 646 is the transmembrane region of the human EGFR. In certain embodiments, the extracellular domains III and IV of the amino acid sequence of tEGFR are the amino acid sequences as set forth in amino acids 485-819 of SEQ ID NO 2.

The invention also relates to nucleic acid constructs comprising the polynucleotide sequences described herein, and one or more control sequences operably linked to these sequences. The polynucleotide sequences of the invention can be manipulated in a variety of ways to ensure expression of the fusion proteins (CAR and/or tfegfr). The nucleic acid construct may be manipulated prior to insertion into the vector, depending on the type of expression vector or requirements. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of a polynucleotide sequence of the invention is typically achieved by operably linking the polynucleotide sequence to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

The polynucleotide sequences of the present invention can be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and Molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector that contains a replication initiation site, a 3 'LTR, a 5' LTR, polynucleotide sequences described herein, and optionally a selectable marker.

Another example of a suitable promoter is the extended growth factor-1 α (EF-1 α). however, other constitutive promoter sequences can also be used, including but not limited to the simian virus 40(SV40) early promoter, mouse breast cancer virus (MMTV), Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoLV promoter, the avian leukemia virus promoter, the EB virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as but not limited to the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter.

To assess the expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

Suitable reporter genes may include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein.

Methods for introducing and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell by any method known in the art, for example, mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating T cells, the virus comprising a retroviral vector as described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types from various sources. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30-80 ng/ml, such as 50ng/ml) of CD3 antibody prior to culturing in an appropriate amount (e.g., 30-80 IU/ml, such as 50IU/ml) of IL2 medium for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein, or prepared by a method as described herein, or stably expressing a fusion protein as described herein and optionally a tfegfr.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and sustained at high levels in the blood and bone marrow for extended amounts of time, and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate into a central memory-like state in vivo upon encountering and subsequently depleting target cells expressing a surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR and optionally a tfegfr as described herein, and the CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing tumor cells of the recipient. Unlike antibody therapy, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step, in which the CAR-T cells induce an immune response specific for the antigen-binding portion in the CAR.

Thus, the diseases that can be treated with the CARs, their coding sequences, nucleic acid constructs, expression vectors, viruses, and CAR-T cells of the invention are preferably BCMA-mediated diseases.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as relevant cytokines or cell populations. Briefly, a pharmaceutical composition of the invention may comprise CAR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "an anti-tumor effective amount", "a tumor-inhibiting effective amount", or a "therapeutic amount", the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, extent of infection or metastasis, and individual differences in the condition of the patient (subject). It can be generally pointed out that: pharmaceutical compositions comprising T cells described herein can be in the range of 10⁴To 10⁹Dosage of individual cells/kg body weight, preferably 10⁵To 10⁶Dosage of individual cells/kg body weight. The T cell composition may also be administered multiple times at these doses. Cells can be administered by using infusion techniques well known in immunotherapy (see, e.g., Rosenberg et al, New Eng.J.of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by those skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressive agents. For example, treatment may be in conjunction with radiation or chemotherapeutic agents known in the art for the treatment of BCMA mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The present invention uses the gene sequence of anti-APRIL antibody and searches the NCBI GenBank database for the information on the human CD8 α hinge region, the human CD8 transmembrane region, the human CD28 intracellular region, the human 41BB intracellular region and the human CD3 zeta intracellular region, and synthesizes the chimeric antigen receptor anti-APRIL scFv-CD8 hinge region-CD 8TM-CD28-41BB-CD3 zeta-tEGFR gene fragment into a retroviral vector.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

Example 1 determination of the Gene sequence APRILscFv-CD8 α -CD28-41BB-CD3 ζ -tEGFR

The sequence information of human CD8 α hinge region, human CD8 α transmembrane region, CD28, 41BB intracellular region and human CD3 zeta intracellular region, and truncated EGFR gene sequence are searched from NCBI website database, and the sequences are subjected to codon optimization on website http:// sg.

The sequences are connected in sequence by adopting overlapping PCR according to the sequences of anti-APRIL scFv, a human CD8 α hinge region gene, a human CD8 α transmembrane region gene, a CD28 intracellular region gene, a 41BB intracellular region gene, a human CD3 zeta intracellular region and a truncated EGFR gene, and different enzyme cutting sites are introduced at the joints of the sequences to form complete APRIL-28BBz-tEGFR gene sequence information.

The nucleotide sequence of the CAR molecule was double-digested with NotI (NEB) and EcoRI (NEB), inserted into the NotI-EcoRI site of the retrovirus MSCV (Addgene) by T4 ligase (NEB) and transformed into competent E.coli (DH5 α).

The recombinant plasmid is sent to Shanghai Biotechnology Limited company for sequencing, and the sequencing result is compared with the synthesized APRIL-28BBz-tEGFRCAR sequence to verify whether the sequence is correct. The sequencing primer is as follows:

and (3) sense: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO: 3);

antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO: 4).

After the sequencing is correct, plasmids are extracted and purified by using a plasmid purification kit of Qiagen company, and 293T cells are transfected by a plasmid calcium phosphate method for purifying the plasmids to carry out a retrovirus packaging experiment.

The plasmid map constructed in this example is shown in FIG. 1.

Example 2: retroviral packaging

1. Day 1: 293T cells should be less than 20 passages, but not overgrown. At 0.6X 10⁶Plating cells/ml, adding 10ml of DMEM medium into a 10cm dish, fully and uniformly mixing the cells, and culturing at 37 ℃ overnight;

2. day 2: the 293T cell fusion degree reaches about 90%, and transfection is carried out (generally, the plate laying time is about 14-18 h); preparing plasmid complex, wherein the amount of each plasmid is 12.5ug of MSCV skeleton, 10ug of Gag-pol, 6.25ug of VSVg, and CaCl₂250ul，H₂O1 ml, the total volume is 1.25 ml; in another tube, an equal volume of HBS to plasmid complex was added, and the plasmid complex was vortexed for 20 seconds. The mixture was gently added to 293T dishes, incubated at 37 ℃ for 4h, medium removed, washed once with PBS, and re-added to the pre-warmed fresh medium.

3. Day 4: after transfection for 48h, the supernatant was collected, filtered through a 0.45um filter, dispensed and stored at-80 ℃, and preheated fresh DMEM medium was added continuously.

Example 3: retroviral infection of human T cells

1. Separating with Ficcol separation solution (tertiary sea of Tianjin) to obtain relatively pure CD3+ T cells, and adjusting cell density to 1 × 10 with medium containing 5% AB serum X-VIVO (LONZA)⁶and/mL. The cells were inoculated at 1 ml/well with anti-human 50ng/ml CD3 antibody (Beijing Hokkimeiyuan) and 50ng/ml CD28 antibody (Beijing Hokkimeiyuan), and 100IU/ml interleukin 2 (Beijing Erlu) was added to stimulate and culture for 48 hoursThen infected with the virus prepared in example 3;

2. every other day after T cell activation culture, the plates were plated in 24-well plates with 250. mu.l/well in Retronectin (Takara) coated non-tissue-treated plates diluted in PBS to a final concentration of 15. mu.g/ml. Protected from light and kept at 4 ℃ overnight for use.

3. After two days of T cell activation culture, 2 coated 24-well plates were removed, the coating solution was aspirated away, and HBSS containing 2% BSA was added and blocked at room temperature for 30 min. The volume of blocking solution was 500. mu.l per well, and the blocking solution was aspirated and the plate washed twice with HBSS containing 2.5% HEPES.

4. The virus solution prepared in example 3 was added to wells 2ml of virus solution per well, centrifuged at 32 ℃ and 2000g for 2 h.

5. The supernatant was discarded, and activated T cells were added to each well of a 24-well plate at 1X 10⁶The volume is 1ml, and the culture medium is T cell culture medium added with IL-2200 IU/ml. Centrifuge at 30 ℃ for 10min at 1000 g.

6. After centrifugation, the plates were placed at 37 ℃ in 5% CO₂Culturing in an incubator.

7. 24h after infection, the cell suspension was aspirated and centrifuged at 1200rpm, 4 ℃ for 7 min.

8. After the cells are infected, the density of the cells is observed every day, and a T cell culture solution containing IL-2100 IU/ml is supplemented at a proper time to maintain the density of the T cells at 5 x 10⁵Cells were expanded at around/ml.

Thus, CART cells each infected with the retrovirus shown in example 2, namely APRIL-28BBz-tEGFR CART cells (expressing APRIL-28 BBz-tEGFRCRAR of example 1), were obtained.

Example 4: flow cytometry for detecting proportion of infected T lymphocytes and expression of surface CAR protein

The CAR-T cells and NT cells (control) prepared in example 4 were collected by centrifugation 72 hours after infection, washed 1 time with PBS, the supernatant was discarded, the corresponding antibody was added and washed with PBS 30min in the dark, resuspended, and finally detected by flow cytometry. CAR + was detected by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch).

FIG. 2 shows that the expression efficiency of APRIL-28BBz-tEGFR CAR + reaches 37.2% 72 hours after T cells are infected with the retrovirus prepared in example 3.

Sequence listing

<110> Shanghai Hengrunheng Dasheng Biotech Co., Ltd

<120> APRIL-targeted chimeric antigen receptor and use thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>2628

<212>DNA

<213> Artificial sequence (Homo sapiens)

<400>1

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctgacatcg ttttgacaca atctcctgcg tcattggcca tgagtctcgg gaagcgcgca 120

acaatatcct gtcgcgccag tgaatctgtg tctgtgatag gagcgcactt gatccattgg 180

tatcagcaga aacctggaca acctcccaag ctgctcatct acctcgccag taaccttgaa 240

acaggagtac ctgctcggtt ttcaggttcc gggtcaggga cggatttcac tttgactatc 300

gacccagttg aggaagacga cgtagccata tatagctgcc tgcagtctcg gatcttcccg 360

cgcacgttcg ggggaggaac taagctggag attaagggcg gcgggggttc tggtggcggc 420

ggcagcggcg gtggaggatc acaaatccaa ctggttcagt ccggtccaga actgaaaaag 480

ccgggggaga cggtgaaaat ctcctgtaag gcctcaggtt ataccttcac cgattacagc 540

atcaattggg taaagcgggc tccagggaaa ggtctgaaat ggatgggttg gatcaacaca 600

gaaacccgag aaccagccta tgcttacgac tttcgaggtc gattcgcttt ttccttggaa 660

acttccgcaa gcacagccta tctgcaaatc aacaatctca agtacgaaga tacggccacg 720

tatttttgtg ccctggatta cagctatgca atggattact ggggtcaggg gacgtctgtt 780

acagtttcta gtactacaac tccagcaccc agacccccta cacctgctcc aactatcgca 840

agtcagcccc tgtcactgcg ccctgaagcc tgtcgccctg ctgccggggg agctgtgcat 900

actcggggac tggactttgc ctgtgatatc tacatctggg cgcccttggc cgggacttgt 960

ggggtccttc tcctgtcact ggttatcacc ctttactgca ggttcagtgt cgtgaagaga 1020

ggccggaaga agctgctgta catcttcaag cagcctttca tgaggcccgt gcagactacc 1080

caggaggaag atggatgcag ctgtagattc cctgaagagg aggaaggagg ctgtgagctg 1140

agagtgaagt tctcccgaag cgcagatgcc ccagcctatc agcagggaca gaatcagctg 1200

tacaacgagc tgaacctggg aagacgggag gaatacgatg tgctggacaa aaggcggggc 1260

agagatcctg agatgggcgg caaaccaaga cggaagaacc cccaggaagg tctgtataat 1320

gagctgcaga aagacaagat ggctgaggcc tactcagaaa tcgggatgaa gggcgaaaga 1380

aggagaggaa aaggccacga cggactgtac caggggctga gtacagcaac aaaagacacc 1440

tatgacgctc tgcacatgca ggctctgcca ccaagacgag ctaaacgagg ctcaggcgcg 1500

acgaacttta gtttgctgaa gcaagctggg gatgtagagg aaaatccggg tcccatgttg 1560

ctccttgtga cgagcctcct gctctgcgag ctgccccatc cagccttcct cctcatcccg 1620

cggaaggtgt gcaatggcat aggcattggc gagtttaaag attctctgag cataaatgct 1680

acgaatatta agcatttcaa gaattgtact tctattagtg gcgacctcca tattcttccg 1740

gttgccttca ggggtgactc tttcacccac acacctccat tggatccaca agaacttgac 1800

atcctgaaga cggttaaaga gattacaggc ttcctcctta tccaagcgtg gcccgagaac 1860

agaacggact tgcacgcctt tgagaacctc gaaataatac ggggtcggac gaagcaacac 1920

ggccaattta gccttgcggt tgttagtctg aacattactt ctctcggcct tcgctctttg 1980

aaagaaatca gcgacggaga tgtcatcatt agtggaaaca agaacctgtg ctacgcgaac 2040

acaatcaact ggaagaagct cttcggtact tcaggccaaa agacaaagat tattagtaac 2100

agaggagaga atagctgtaa ggctaccgga caagtttgtc acgccttgtg tagtccagag 2160

ggttgctggg gaccggaacc aagggattgc gtcagttgcc ggaacgtgag tcgcggacgc 2220

gagtgtgtgg ataagtgcaa tcttctggaa ggggaaccgc gagagtttgt agaaaattcc 2280

gaatgtatac agtgtcatcc cgagtgtctt ccacaagcaa tgaatatcac atgtacaggg 2340

aggggtcctg ataactgtat ccaatgtgca cactacatag atggtcctca ctgtgtaaag 2400

acgtgccccg ccggagtaat gggtgaaaac aacaccctcg tgtggaagta cgccgatgcc 2460

gggcatgtct gtcatttgtg tcatcccaac tgcacatatg gctgtaccgg tcctggattg 2520

gagggctgtc caacaaacgg gccgaaaata ccgagtatcg caacaggcat ggtgggagca 2580

cttttgcttc tcctcgttgt cgccctgggc atcggcttgt tcatgtga 2628

<210>2

<211>819

<212>PRT

<213> Artificial sequence (Homo sapiens)

<400>2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Ala Pro Ala Val Leu Thr Gly Leu Gly Leu Leu Gly His

20 25 30

Ser Val Leu His Leu Val Pro Ile Ala Ala Thr Ser Leu Ala Ala Ser

35 40 45

Ala Val Thr Gly Val Met Thr Gly Pro Ala Leu Ala Ala Gly Ala Gly

50 55 60

Leu Gly Ala Gly Gly Thr Gly Val Ala Ile Gly Ala Ala Gly Val Thr

65 70 75 80

Leu Leu Thr Ser Gly Val Leu Pro Gly Ala Val Thr Pro Thr Met Gly

85 90 95

Gly Val Val Ser Ala Gly Gly Gly Gly Ala Gly Gly Thr Leu Pro Ala

100 105 110

Cys Ile Ala Ser Met Pro Ser His Pro Ala Ala Ala Thr Ala Ser Cys

115 120 125

Thr Ser Ala Gly Val Pro His Leu His Gly Gly Ala Ile Leu Ser Val

130 135 140

Ile Ile Pro Ala Ala Ala Ala Leu Leu Ala Leu Ser Pro His Gly Thr

145 150 155 160

Pro Leu Gly Pro Val Leu Leu Thr Thr Thr Pro Ala Pro Ala Pro Pro

165 170 175

Thr Pro Ala Pro Thr Ile Ala Ser Gly Pro Leu Ser Leu Ala Pro Gly

180 185 190

Ala Cys Ala Pro Ala Ala Gly Gly Ala Val His Thr Ala Gly Leu Ala

195 200 205

Pro Ala Cys Ala Ile Thr Ile Thr Ala Pro Leu Ala Gly Thr Cys Gly

210 215 220

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Thr Cys Ala Ser Leu Ala

225 230 235 240

Ser Ala Leu Leu His Ser Ala Thr Met Ala Met Thr Pro Ala Ala Pro

245 250 255

Gly Pro Thr Ala Leu His Thr Gly Pro Thr Ala Pro Pro Ala Ala Pro

260 265 270

Ala Ala Thr Ala Ser Leu Pro Ser Val Val Leu Ala Gly Ala Leu Leu

275 280 285

Leu Leu Thr Ile Pro Leu Gly Pro Pro Met Ala Pro Val Gly Thr Thr

290 295 300

Gly Gly Gly Ala Gly Cys Ser Cys Ala Pro Pro Gly Gly Gly Gly Gly

305 310 315 320

Gly Cys Gly Leu Ala Val Leu Pro Ser Ala Ser Ala Ala Ala Pro Ala

325 330 335

Thr Gly Gly Gly Gly Ala Gly Leu Thr Ala Gly Leu Ala Leu Gly Ala

340 345 350

Ala Gly Gly Thr Ala Val Leu Ala Leu Ala Ala Gly Ala Ala Pro Gly

355 360 365

Met Gly Gly Leu Pro Ala Ala Leu Ala Pro Gly Gly Gly Leu Thr Ala

370 375 380

Gly Leu Gly Leu Ala Leu Met Ala Gly Ala Thr Ser Gly Ile Gly Met

385 390 395 400

Leu Gly Gly Ala Ala Ala Gly Leu Gly His Ala Gly Leu Thr Gly Gly

405 410 415

Leu Ser Thr Ala Thr Leu Ala Thr Thr Ala Ala Leu His Met Gly Ala

420 425 430

Leu Pro Pro Ala Ala Ala Leu Ala Gly Ser Gly Ala Thr Ala Pro Ser

435 440 445

Leu Leu Leu Gly Ala Gly Ala Val Gly Gly Ala Pro Gly Pro Met Leu

450 455 460

Leu Leu Val Thr Ser Leu Leu Leu Cys Gly Leu Pro His Pro Ala Pro

465 470 475 480

Leu Leu Ile Pro Ala Leu Val Cys Ala Gly Ile Gly Ile Gly Gly Pro

485 490 495

Leu Ala Ser Leu Ser Ile Ala Ala Thr Ala Ile Leu His Pro Leu Ala

500 505 510

Cys Thr Ser Ile Ser Gly Ala Leu His Ile Leu Pro Val Ala Pro Ala

515 520 525

Gly Ala Ser Pro Thr His Thr Pro Pro Leu Ala Pro Gly Gly Leu Ala

530 535 540

Ile Leu Leu Thr Val Leu Gly Ile Thr Gly Pro Leu Leu Ile Gly Ala

545 550 555 560

Thr Pro Gly Ala Ala Thr Ala Leu His Ala Pro Gly Ala Leu Gly Ile

565 570 575

Ile Ala Gly Ala Thr Leu Gly His Gly Gly Pro Ser Leu Ala Val Val

580 585 590

Ser Leu Ala Ile Thr Ser Leu Gly Leu Ala Ser Leu Leu Gly Ile Ser

595 600 605

Ala Gly Ala Val Ile Ile Ser Gly Ala Leu Ala Leu Cys Thr Ala Ala

610 615 620

Thr Ile Ala Thr Leu Leu Leu Pro Gly Thr Ser Gly Gly Leu Thr Leu

625 630 635 640

Ile Ile Ser Ala Ala Gly Gly Ala Ser Cys Leu Ala Thr Gly Gly Val

645 650 655

Cys His Ala Leu Cys Ser Pro Gly Gly Cys Thr Gly Pro Gly Pro Ala

660 665 670

Ala Cys Val Ser Cys Ala Ala Val Ser Ala Gly Ala Gly Cys Val Ala

675 680 685

Leu Cys Ala Leu Leu Gly Gly Gly Pro Ala Gly Pro Val Gly Ala Ser

690 695 700

Gly Cys Ile Gly Cys His Pro Gly Cys Leu Pro Gly Ala Met Ala Ile

705 710 715 720

Thr Cys Thr Gly Ala Gly Pro Ala Ala Cys Ile Gly Cys Ala His Thr

725 730 735

Ile Ala Gly Pro His Cys Val Leu Thr Cys Pro Ala Gly Val Met Gly

740 745 750

Gly Ala Ala Thr Leu Val Thr Leu Thr Ala Ala Ala Gly His Val Cys

755 760 765

His Leu Cys His Pro Ala Cys Thr Thr Gly Cys Thr Gly Pro Gly Leu

770 775 780

Gly Gly Cys Pro Thr Ala Gly Pro Leu Ile Pro Ser Ile Ala Thr Gly

785 790 795 800

Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu Gly Ile Gly

805 810 815

Leu Pro Met

<210>3

<211>21

<212>DNA

<213> Artificial sequence (Homo sapiens)

<400>3

agcatcgttc tgtgttgtct c 21

<210>4

<211>22

<212>DNA

<213> Artificial sequence (Homo sapiens)

<400>4

tgtttgtctt gtggcaatac ac 22

Claims

1. A polynucleotide sequence selected from the group consisting of:

(2) (1) the complement of the polynucleotide sequence.

2. The polynucleotide sequence of claim 1,

the coding sequence of the signal peptide before the coding sequence of the anti-APRIL single-chain antibody is shown as the 1 st to 63 rd nucleotide sequences of SEQ ID NO 1; and/or

The coding sequence of the anti-APRIL single-chain antibody is shown as the 64 th-501 th nucleotide sequence of SEQ ID NO 1; and/or

The coding sequences of the hinge region and the CD8 transmembrane region of the human CD8 α are shown as the nucleotide sequence at the 502-708 th site of SEQ ID NO. 1, and/or

The coding sequence of the human CD28 intracellular region is shown as the nucleotide sequence at 709-831 of SEQ ID NO. 1; and/or

The coding sequence of the human 41BB intracellular region is shown as the nucleotide sequence of the 832-position 975 of SEQ ID NO 1; and/or

The coding sequence of the intracellular region of human CD3 zeta is shown as the nucleotide sequence at position 976-1308 of SEQ ID NO. 1; and/or

The coding sequence of the EGFR fragment is shown as the nucleotide sequence of 1453-2457 of SEQ ID NO. 1.

3. A fusion protein selected from the group consisting of:

4. The fusion protein of claim 3, wherein the fusion protein has one or more of the following characteristics:

the fusion protein sequence also comprises a coding sequence of a signal peptide in front of the coding sequence of the anti-APRIL single-chain antibody, preferably, the amino acid sequence of the signal peptide is shown as amino acids 1-21 of SEQ ID NO. 2; and/or

The amino acid sequence of the anti-APRIL single-chain antibody is shown as amino acids 22-167 of SEQ ID NO 2; and/or

The amino acid sequences of the hinge region and the transmembrane region of the human CD8 α are shown as the amino acid at the 168-th and 236-th positions of SEQ ID NO. 2, and/or

The amino acid sequence of the intracellular region of the human CD28 is shown as the 237-277 amino acid of SEQ ID NO. 2; and/or

The amino acid sequence of the intracellular region of the human 41BB is shown as 278,325 amino acid of SEQ ID NO. 2; and/or

The amino acid sequence of the intracellular region of the human CD3 zeta is shown as the amino acid at the 326-position 436 of SEQ ID NO. 2; and/or

The EGFR fragment contains or consists of the extracellular domain III, the extracellular domain IV and the transmembrane region of the EGFR; preferably, the fragment comprises or consists of the amino acid sequence at positions 310-646 of human EGFR; preferably, the amino acid sequence of the fragment is as shown in amino acid 485-819 of SEQ ID NO 2.

5. A nucleic acid construct comprising the polynucleotide sequence of any one of claims 1-3;

preferably, the nucleic acid construct is a vector;

more preferably, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, and a polynucleotide sequence according to any one of claims 1-2.

6. A retrovirus containing the nucleic acid construct of claim 5, preferably containing the vector, more preferably containing the retroviral vector.

7. A genetically modified T-cell or a pharmaceutical composition comprising a genetically modified T-cell, wherein the cell comprises a polynucleotide sequence according to any one of claims 1 to 2, or comprises a nucleic acid construct according to claim 5, or is infected with a retrovirus according to claim 6, or stably expresses a fusion protein according to any one of claims 3 to 4 and optionally a fragment comprising extracellular domain III, extracellular domain IV and optionally a transmembrane region of EGFR.

8. Use of a polynucleotide sequence according to any one of claims 1 to 2, a fusion protein according to any one of claims 3 to 4, a nucleic acid construct according to claim 5 or a retrovirus according to claim 6 in the preparation of an activated T cell.

9. Use of the polynucleotide sequence of any one of claims 1-2, the fusion protein of any one of claims 3-4, the nucleic acid construct of claim 5, the retrovirus of claim 6, or the genetically modified T-cell of claim 7, or a pharmaceutical composition thereof, in the preparation of a medicament for treating an APRIL-mediated disease;

preferably, the APRIL-mediated disease is multiple myeloma.