CN110938608A

CN110938608A - Aldehyde ketone reductase mutant, encoding gene and application of aldehyde ketone reductase mutant in synthesis of (S) -TCPE

Info

Publication number: CN110938608A
Application number: CN201911329516.XA
Authority: CN
Inventors: 周硕; 赖敦岳; 汪钱; 何龙丹; 叶涛; 劳淑华
Original assignee: Taizhou Enzymatic Biotechnology Co Ltd
Current assignee: Taizhou Enzymatic Biotechnology Co Ltd
Priority date: 2019-12-20
Filing date: 2019-12-20
Publication date: 2020-03-31

Abstract

The invention provides an aldehyde ketone reductase mutant, a coding gene and application thereof in synthesizing (S) -TCPE, belonging to the technical field of biosynthesis, wherein the aldehyde ketone reductase mutant mutates one or more of the following sites in wild AKRED-Lk: mutation of a94 to S94; mutation of E145 to a145, L145 or C145; s96 was mutated to E96. The aldehyde ketone reductase mutant has good regioselectivity and stereoselectivity in synthesis; meanwhile, the catalytic efficiency is higher and the cost is lower. The reaction condition for synthesizing (S) -TCPE by utilizing the aldehyde ketone reductase mutant provided by the invention is mild and environment-friendly; the isopropanol is used, so that the recycling of the coenzyme is realized, and the production cost is further reduced.

Description

Aldehyde ketone reductase mutant, encoding gene and application of aldehyde ketone reductase mutant in synthesis of (S) -TCPE

Technical Field

The invention belongs to the technical field of biosynthesis, and particularly relates to an aldehyde ketone reductase mutant, an encoding gene and application thereof in synthesis of (S) -TCPE.

Background

The method is characterized in that luliconazole is a novel imidazole antifungal agent, sterol 14 α -demethylase in fungal cells is inhibited, so that the biosynthesis of ergosterol is interfered, meanwhile luliconazole shows broad-spectrum antifungal activity, (S) -TCPE is the most key intermediate of luliconazole as a chiral source, (S) -TCPE is an existing chemical synthesis route of (S) -TCPE, is low in efficiency, harsh in reaction condition, needs expensive initial chiral materials and is not beneficial to industrial production.

Disclosure of Invention

In view of the above, the present invention aims to provide an aldo-keto reductase mutant, a coding gene and an application thereof in the synthesis of (S) -TCPE; the aldehyde ketone reductase mutant has good regioselectivity and stereoselectivity in synthesis; meanwhile, the catalytic efficiency is higher and the cost is lower.

The reaction condition for synthesizing (S) -TCPE by utilizing the aldehyde ketone reductase mutant provided by the invention is mild and environment-friendly; in the aldoketolase reaction, a coenzyme is required, which is expensive; in the method for synthesizing (S) -TCPE by utilizing the aldehyde ketone reductase mutant, isopropanol is used, so that the cyclic utilization of coenzyme is realized, and the production cost is further reduced.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides an aldehyde ketone reductase mutant, which mutates one or more of the following sites in wild AKRED-Lk:

mutation of a94 to S94;

mutation of E145 to a145, L145 or C145;

s96 was mutated to E96.

Preferably, the amino acid sequence of the aldone reductase mutant is shown as SEQ ID No. 1.

The invention provides a coding gene of the aldehyde ketone reductase mutant, and the nucleotide sequence of the coding gene is shown as SEQ ID No. 2.

The invention provides a recombinant vector comprising the coding gene of the aldehyde ketone reductase mutant.

The invention provides a recombinant strain comprising the coding gene of the aldehyde ketone reductase mutant.

The invention provides application of the aldehyde ketone reductase mutant in synthesizing (S) -TCPE.

The invention provides a method for synthesizing (S) -TCPE by using the aldehyde ketone reductase mutant, which comprises the following steps:

mixing reaction raw materials to obtain a synthesis system;

placing the synthesis system at 28-32 ℃ for reacting for 8-12 h;

the synthesis system is as follows:

preferably, the synthesis system is as follows:

preferably, the temperature of the reaction is 30 ℃, and the time of the reaction is 10 h.

Preferably, the concentration of the PB buffer solution is 0.08-0.12 mol/L, and the pH of the PB buffer solution is 7.4-7.6.

The invention has the beneficial effects that: the aldehyde-ketone reductase mutant provided by the invention is obtained by mutating one or more sites of amino acids A94, S96 and E145, and has good regioselectivity and stereoselectivity in synthesis; meanwhile, the catalytic efficiency is higher and the cost is lower.

Furthermore, the enzyme activity of the aldehyde ketone reductase mutant with three mutations is improved by about 6 times compared with that of the single mutant enzyme, and the enzyme has good industrial application prospect.

Drawings

FIG. 1 is a stable binding conformation of the ternary complex of AKRED-Lk with TCAP, NADPH;

FIG. 2 is the stable conformation of the AKRED-Lk-NADPH-TCAP ternary complex;

FIG. 3 is a diagram of double-restriction enzyme-digestion-verified electrophoresis of pET-28 a-AKRED-Lk;

FIG. 4 shows the wild-type and respective mutant protein purification profiles;

FIG. 5 shows the results of the activity of A94 site mutant of KRED-Lk on TCAP;

FIG. 6 shows the results of the activity of E145 site mutant of KRED-Lk-S on TCAP;

FIG. 7 shows the results of the activity of S96 site mutant of KRED-Lk-SA on TCAP.

Detailed Description

The invention provides an aldehyde ketone reductase mutant, which mutates one or more of the following sites in wild AKRED-Lk: mutation of a94 to S94; mutation of E145 to a145, L145 or C145; s96 was mutated to E96.

In the present invention, the wild-type AKRED-Lk is derived from Lactobacillus (Lactobacillus kefiri DSM 20587); the amino acid sequence of the wild-type AKRED-Lk is shown in SEQ ID No.1, and the nucleotide sequence of the coding gene of the wild-type AKRED-Lk is shown in SEQ ID No. 2. In the present invention, the wild-type AKRED-Lk has hardly any activity on the substrate TCAP.

In the invention, the activity of a substrate TCAP is greatly improved after A94 in wild-type AKRED-Lk is mutated into S94, namely alanine at position 94 is mutated into serine. In the invention, the amino acid sequence of the mutant with the mutation of A94 in the wild AKRED-Lk to S94 is shown as SEQ ID No.3, and the coding gene of the mutant with the mutation of A94 to S94 is shown as SEQ ID No. 4.

In the invention, the E145 site mutation in the wild-type AKRED-Lk can be selected, and the substrate activity is obviously improved when the E is mutated into alanine, leucine and cysteine, wherein the activity is the highest when the E is mutated into alanine. In the invention, the amino acid sequence of the mutant obtained by mutating E145 to A145 is shown as SEQ ID No.5, and the coding gene of the mutant obtained by mutating E145 to A145 is shown as SEQ ID No. 6.

In the invention, after S96 is mutated into E96 in wild-type AKRED-Lk, the activity of the substrate is obviously improved.

In the present invention, it is preferable to mutate A94 to S94, E145 to A145 and S96 to E96 in wild-type AKRED-Lk to obtain the optimal aldoketoreductase mutant AKRED-Lk-SAE, whose amino acid sequence is shown in SEQ ID No. 7.

The invention provides a coding gene of the aldo-keto reductase mutant AKRED-Lk-SAE, and the nucleotide sequence of the coding gene is shown in SEQ ID No. 8. The invention has no special limitation on the preparation method of the coding gene of the aldone reductase mutant AKRED-Lk-SAE, and the preparation method adopts artificial synthesis.

The invention provides a recombinant vector comprising the coding gene of the aldehyde ketone reductase mutant. In the invention, the recombinant vector takes a pET-28a (+) expression vector as an initial vector, and the coding gene of the aldehyde ketone reductase mutant is connected to the pET-28a (+) expression vector to obtain a recombinant vector; in the present invention, the gene encoding the aldone reductase mutant is preferably linked between Xho I and Nde I cleavage sites. The method for preparing the recombinant vector is not particularly limited in the present invention, and a conventional method for preparing a recombinant vector in the art may be used.

The invention provides a recombinant strain comprising the coding gene of the aldehyde ketone reductase mutant. In the present invention, the recombinant strain is preferably prepared by transferring the recombinant vector into an original strain. In the present invention, the original strain is preferably Escherichia coli JM109(DE 3). The preparation method of the recombinant strain has no special requirements, and the conventional preparation method in the field can be adopted.

The invention provides application of the aldehyde ketone reductase mutant in synthesizing (S) -TCPE. In the invention, the aldehyde ketone reductase mutant has remarkable activity on a substrate TCAP and can catalyze the substrate TCAP to synthesize (S) -TCPE.

The invention provides a method for synthesizing (S) -TCPE by using the aldehyde ketone reductase mutant, which comprises the following steps: mixing reaction raw materials to obtain a synthesis system; placing the synthesis system at 28-32 ℃ for reacting for 8-12 h;

in the present invention, the synthesis system is as follows:

the following are preferred:

in the present invention, the temperature of the reaction is preferably 30 ℃ and the time of the reaction is preferably 10 hours.

In the invention, the concentration of the PB buffer solution is preferably 0.08-0.12 mol/L, more preferably 0.1mol/L, and the pH of the PB buffer solution is preferably 7.4-7.6, more preferably 7.5.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

The synthesized gene AKRED-Lk needs to be replaced by an expression vector (pET-28a (+)) so that the gene can be expressed in Escherichia coli JM109(DE 3).

The experimental operating procedure was roughly as follows:

a) the target gene and the expression vector pET-28a (+) are subjected to double enzyme digestion by using the same restriction enzyme to obtain a viscous terminal fragment, the viscous terminal fragment is subjected to enzyme digestion at 37 ℃ for 100min, then the viscous terminal fragment and 10X Loading Buffer are mixed, the agarose gel is sprayed evenly, and a 20-mu L enzyme digestion system is shown in Table 1.

TABLE 1 restriction enzyme system

b) Purifying and recovering an AKRED-Lk gene fragment and a pET-28a (+) vector fragment by using a DNA gel recovery kit, wherein the specific operation steps are shown in an instruction book;

c) the recovered product was ligated into circular plasmids using Ligation high (from Toyo Boseki Biotech Co., Ltd.) at 16 ℃ for 3 hours, the Ligation system is shown in Table 2.

TABLE 2 ligation System of sticky end fragments

d) Transforming 12 μ L of the ligation product into Escherichia coli JM109(DE3), activating resistant bacteria, extracting pET-28a-AKRED-Lk plasmid, and performing double enzyme digestion verification, as shown in FIG. 3; the verified plasmid pET-28a-AKRED-Lk is transformed into JM109(DE3), after the selection of spots, activation and amplification culture, an inducer IPTG is added to induce the expression of aldehyde ketone reductase AKRED-Lk protein, and the experimental operation flow is approximately as follows:

A1) thawing the competent cell suspension stored in the ultra-low temperature refrigerator on ice, adding 2 μ L plasmid or 10 μ L ligation product, and standing on ice for 30min to allow the plasmid to be attached to the cell surface;

A2) the water bath heat shock at 42 ℃ for 55s increases the cell permeability, and promotes the plasmid to enter the cell; standing on ice for 3min immediately after heat shock;

A3) sucking 0.8mL LB culture medium (without resistance), adding, oscillating and reviving for 1h at 37 ℃;

A4) sucking 200. mu.L of resuscitating fluid to spread single colony on a plate (Kan resistance), culturing in an incubator at 37 ℃ in an inverted mode (overnight), centrifuging the resuscitating fluid at low speed (1000 Xg) for 1min if the resuscitating fluid is not available for 1h, discarding most of supernatant, and smearing the rest resuscitating fluid on the plate.

Dipping a single colony by using a sterilized toothpick, putting the single colony in 5mL LB culture solution, oscillating and recovering the culture overnight at the temperature of 35 ℃, preserving the bacteria liquid and 80% (w/w) sterilized glycerol according to the ratio of 8:2, and preserving the bacteria liquid and 80% (w/w) sterilized glycerol at the temperature of-20 ℃.

Selecting a single colony to 5mL of LB culture solution (containing 0.1 percent of Kan resistance), oscillating at 37 ℃ (180rpm) for resuscitation for 10h, transferring to 50mL of LB culture solution, oscillating at 37 ℃ for culture until the optical density value reaches 0.5-0.6, adding IPTG mother solution according to the proportion of 0.1 percent until the working concentration is 0.1 mu M, oscillating at 25 ℃ for culture overnight, and inducing the expression of AKRED-Lk protein. Centrifuging the fermentation liquor at high speed (5000 Xg) for 8min, collecting the precipitate, re-suspending with 5mL PB buffer solution (0.1M, pH7.5), placing the cell re-suspension in ice water, crushing by 185W ultrasonic wave for 8.8min, centrifuging at 11000 Xg for 8.8min, collecting the supernatant, wherein the supernatant contains the target protein (crude enzyme solution) expressed by the engineering bacteria, and storing in a refrigerator at-20 ℃.

Site-directed mutagenesis of aldoketoreductase AKRED-Lk

The annealing temperature was determined to be about 55 ℃ based on the Tm value of the designed PCR site-directed mutagenesis primer, the total number of cycles was 25, the extension temperature was 68 ℃ and the time was 3.5 min. The inverse PCR site-directed mutagenesis system is shown in Table 3.

TABLE 3 inverse PCR site-directed mutagenesis System

The primer sequences are as follows:

a94 site

Reverse position AATTCCGGCATTGTTGACAACCGTGGTA (SEQ ID No.9)

Forward site NNKGTCAGCAAGAGTGTTGAAGATACCA (SEQ ID No.10)

E145

Reverse direction GATAGATGACATATTGATGATTGATGCT (SEQ ID No.11)

Forward NNKGGTTTTGTTGGTGATCCAACTCTGGGTG (SEQ ID No.12)

S96

Reverse direction GACGCTAATTCCGGCATTGTTGACAACC (SEQ ID No.13)

Forward NNKAAGAGTGTTGAAGATACCACAACTG (SEQ ID No.14)

PCR product containing wild type plasmid pET-28a-AKRED-Lk, adding 1 μ L LDpnI (10U/μ L) into 50 μ L amplified system, mixing, reacting at 37 deg.C for 1.5h, digesting and decomposing template plasmid pET-28a-AKREDLk, cleaning PCR product PCRcleaning kit, adding upstream and downstream primers, decomposed template residual fragment, Mg in previous system²⁺And dNTP and the like to ensure the efficiency of PNK kinase ligation in the next step.

Escherichia coli JM109(DE3) was transformed with the plasmid ligated with the PCR product, and after plate culture, the single clone was selected and sequenced to verify the correct sequence, thereby obtaining mutant-containing Escherichia coli. The conversion step is as described above.

And (4) connecting.

The T4 ligase Buffer contains ATP, and is placed on ice when melted, and the premix is subpackaged on 7 μ L of ice, and is stored at-20 ℃. Premix systems are shown in table 4:

TABLE 4 configuration of one-step premix for site-directed mutagenesis

And slowly pumping and uniformly mixing 3 mu L of PCR product and 7 mu L of premix, standing for 1h at room temperature (25-30 ℃), sucking all 10 mu L of transformation by using a liquid-transferring gun, and enabling the transformation to be consistent with the plasmid transformation operation.

Self-induced expression and screening of aldo-keto reductase AKRED-Lk mutant

The mutant is firstly selected to be cultivated at 37 ℃ for overnight activation, one strain is preserved by 80% glycerol while the enlarged cultivation is carried out, and three single plates are selected from each mutant plate for screening so as to ensure the interference of false positive. According to the proportion, a self-induction culture medium is prepared in a super clean bench, seed liquid and antibiotic mother liquid for expressing mutant recombinant bacteria are added according to the amount of 1% and 0.1%, and the mixture is shaken (180rpm) in a shaking table at 28 ℃ for 48 hours. And centrifuging the fermentation liquor at a high speed (5000 Xg) for 8min, collecting precipitates, re-suspending the cells by using a PB buffer solution (0.1mol/L, pH7.5), then placing the cell re-suspension in ice water, carrying out 185W ultrasonic disruption for 8min, then centrifuging at a high speed (12000rpm) and collecting supernatant, wherein the supernatant contains the mutant protein (crude enzyme liquid) expressed by the engineering bacteria, and placing the supernatant in a refrigerator at the temperature of-20 ℃ for preservation. The system for catalyzing TCAP screening reaction by AKRED-Lk mutant is shown in Table 5:

TABLE 5 System for the catalysis of TCAP screening reactions by AKRED-Lk mutants

The reaction without aldehyde ketone reductase AKRED-Lk was used as a blank control, and the reaction without substrate TCAP was used as a background control. After reaction at 30 ℃ for 10 hours at 180rpm, 50. mu.L of the reaction solution was extracted with 1mL of n-hexane, centrifuged at high speed (12000 Xg) by shaking, and the supernatant was detected by HPLC. And extracting plasmids from the optimal mutants screened by the liquid phase, and sending the plasmids to a gene sequencing service company to detect whether the mutation of the corresponding sites is successful.

Protein purification

After balancing a protein Ni + column by using a buffer solution A, adding the crude enzyme solution prepared in the step 7, fully shaking for 30min, discharging waste liquid, washing for three times by using the buffer solution A, adding a buffer solution B, fully and uniformly shaking for 20min, collecting effluent liquid, adding excessive ammonium sulfate into the effluent liquid until the ammonium sulfate cannot be dissolved, centrifuging at 3000rpm for 10min, collecting precipitate, adding a glycerol aqueous solution with the mass concentration of 15% into the precipitate, and dissolving to obtain a protein solution; desalting the protein solution with chromatography column using g25 as filler, detecting A280 absorption value of effluent, and collecting the part with A280 absorption value greater than 0.1 to obtain pure enzyme; and (3) buffer solution A: NaCl 140mmol/L, KCl 2.7mmol/L, Na2HPO 410 mmol/L, KH2PO41.8mmol/L, adjusting pH to 8.0 with 5M NaOH, and using water as solvent; and (3) buffer solution B: NaH2PO 4& 2H2O 50mM, NaCl 300mM, imidazole 500mM, pH adjusted to 8.0 with 5M hydrochloric acid solution, solvent water, protein purification results as shown in FIG. 3.

Example 2

HPLC analysis method of enzyme-catalyzed reaction system of substrate TCAP and product (S) -TCPE: detecting the analytical column: a xylonite chiral chromatography AD-H column (250mm multiplied by 4.6 mm); the eluent ratio is as follows: n-hexane/isopropanol 90%/10% (v/v), containing 0.1% trifluoroacetic acid; elution speed: 0.8 mL/min; chiral column temperature: 35 ℃; ultraviolet measurement wavelength: λ 205 nm. The reaction system of the aldoketoreductase catalyzed TCAP is shown in Table 6.

TABLE 6 reaction System for the AKRED-Lk catalytic substrate TCAP

The reaction without aldehyde ketone reductase AKRED-Lk was used as a blank control, and the reaction without substrate TCAP was used as a background control. After reacting for 10h at 30 ℃ by shaking table at 180rpm, 50 mu L of reaction solution is extracted by 1mL of n-hexane, evenly mixed by shaking and centrifuged at high speed, and supernatant is absorbed and detected by HPLC. Each unit of enzyme activity (U) of AKRED-Lk to TCAP refers to the amount of enzyme (enzyme solution volume or protein mass) that catalyzes the production of 1. mu. moL of product per unit time (1 min).

Wild-type aldoketoreductase from Lactobacillus kefir (Genbank access No.: AAP94029) was essentially not viable when tested spectrophotometrically for substrate viability, but very low relative viability was seen with HPLC screening, with essentially negligible viability compared to A94S. The activity of A94S is higher than that of wild aldehyde ketone reductase, but the specific activity still can not meet the requirement of industrial application well.

In the sites A94, E145 and S96 screened by the computer simulation result, the saturation mutation of A94 is firstly found, the activity of AKRED-Lk-S on TCAP is improved, but the specific activity of single mutation can not meet the requirement of industrial production, and further, the saturation mutation of E145 is carried out on the basis of the single mutation, the result is shown in figure 6, wherein when glutamic acid is mutated into alanine, leucine and cysteine, the activity on TCAP is obviously improved, and the mutation is the highest activity on alanine.

On the basis of the optimal results of the two previous rounds of mutation, saturation mutation is carried out on the screened S96 locus again, the results are shown in figure 7, and most of the mutated amino acids are found to have improved activity on the substrate, but when serine is mutated into glutamic acid, the relative activity on the substrate is the highest, and the specific activity is also the highest through enzyme activity detection, is improved by about 6 times compared with the wild type, and has the potential of industrial production.

Example 3

Each enzyme activity unit (U) of AKRED-Lk to TCAP means the amount of enzyme (enzyme solution volume or protein mass) that catalyzes the reduction of 1. mu. moL of TCAP per unit time (1 min).

The enzyme activity calculation formula is as follows: enzyme activity (U) ═ Ew V/(epsilon L);

ew: the measured absorbance value varied within 1 min;

v: volume of reaction solution (mL);

epsilon: molar extinction coefficient 6.2 (L.mmoL-1. cm-1);

l: optical path distance (cm)

And (4) carrying out enzyme activity determination on the three mutant proteins purified in the step (8). Reaction system: 10 μ L of purified enzyme solution, 2890 μ L of LPB (0.1M, pH7.5), 50 μ L of substrate dissolved in DMSO, and 50 μ L of NADH (10 mg/ml). All experiments were repeated three times. The enzyme activities are shown in Table 7.

TABLE 7 enzymatic Activity of different mutants

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Claims

1. An aldoketoreductase mutant, wherein one or more of the following sites in the amino acid sequence of wild-type AKRED-Lk are mutated:

mutation of a94 to S94;

mutation of E145 to a145, L145 or C145;

s96 was mutated to E96.

2. The aldehyde-ketone reductase mutant according to claim 1, wherein the amino acid sequence of the aldehyde-ketone reductase mutant is shown as SEQ ID No. 1.

3. The gene encoding an aldoketoreductase mutant as claimed in claim 2, wherein the nucleotide sequence of the gene is shown in SEQ ID No. 2.

4. A recombinant vector comprising a gene encoding the aldoketoreductase mutant of claim 3.

5. A recombinant strain comprising a gene encoding the aldoketoreductase mutant of claim 3.

6. Use of the aldoketoreductase mutant of claim 1 or 2 for the synthesis of (S) -TCPE.

7. A method for synthesizing (S) -TCPE using the aldo-ketoreductase mutant of claim 1 or 2, comprising the steps of:

mixing reaction raw materials to obtain a synthesis system;

placing the synthesis system at 28-32 ℃ for reacting for 8-12 h;

the synthesis system is as follows:

8. the method of claim 7, wherein the synthesis system is as follows:

9. the process according to claim 7, wherein the reaction temperature is 30 ℃ and the reaction time is 10 hours.

10. The method of claim 7, wherein the concentration of the PB buffer is 0.08-0.12 mol/L, and the pH of the PB buffer is 7.4-7.6.