CN113969268A - Glu/Leu/Phe/Val dehydrogenase mutant and application thereof in preparation of L-glufosinate-ammonium - Google Patents

Abstract

The application relates to a Glu/Leu/Phe/Val dehydrogenase mutant and application thereof in preparing L-glufosinate-ammonium. The Glu/Leu/Phe/Val dehydrogenase mutant, when aligned with the amino acid sequence of the Glu/Leu/Phe/Val dehydrogenase comprising the sequence shown in SEQ ID No.5, has an amino acid sequence comprising a substitution of the amino acid residue corresponding to position 91 and/or 168, said positions 91 and 168 being defined with reference to SEQ ID No.5, and has an amino acid sequence with at least 90% identity to the sequence shown in SEQ ID No. 5.

Description

Glu/Leu/Phe/Val dehydrogenase mutant and application thereof in preparation of L-glufosinate-ammonium

Technical Field

The present application relates to the field of biotechnology; in particular, the present application relates to a Glu/Leu/Phe/Val dehydrogenase mutant, the use of the Glu/Leu/Phe/Val dehydrogenase mutant for the preparation of L-glufosinate-ammonium, and a method for the preparation of L-glufosinate-ammonium using the Glu/Leu/Phe/Val dehydrogenase mutant.

Background

Glufosinate-ammonium (also known as bialaphos, glufosinate, trade names including baustda, bushatton, etc., known as phosphinothricin (abbreviated as PPT) and chemical name 2-amino-4- [ hydroxy (methyl) phosphono ] butanoic acid) is a low-toxicity, high-efficiency, non-selective contact-type organophosphorus herbicide developed by hester of germany (now belonging to bayer) in the 80 th 20 th century. Glutamine synthetase can be inhibited after glufosinate acts on plants, so that reversible reaction of glutamic acid in plants is interrupted, metabolic disturbance is caused, the plants are poisoned by excessive ammonia accumulation, and the plants cannot synthesize chlorophyll so that photosynthesis is inhibited, and the plants die. Glufosinate is mainly used in orchards, potato fields, non-cultivated lands and the like, and is used for preventing and treating annual and perennial grassy and dicotyledonous weeds, such as large crabgrass, green bristlegrass and wild wheat; perennial grassy weeds and sedges, such as fescue, duck sprouts, and the like.

The biocidal herbicide has a huge market. At present, three herbicides in the world are paraquat, glyphosate and glufosinate-ammonium respectively. In the aspect of market use, the glyphosate is exclusively used as a chelating agent, but due to long-term use, a large amount of weeds generate resistance, and the glyphosate also tends to lose effectiveness; due to its high toxicity, paraquat is listed in the "rotterdan convention", and is forbidden or restricted in more and more countries around the world, and the published bulletin by the ministry of agriculture in China shows that paraquat stops producing in 2014, 7 and 1, and is forbidden to use in 2016, 7 and 1; at present, the glufosinate-ammonium has excellent weeding performance and small phytotoxicity side effect although the yield is small, and therefore the glufosinate-ammonium has great market potential in a future period.

The glufosinate-ammonium has two optical isomers, namely L-glufosinate-ammonium and D-glufosinate-ammonium, but only L-type glufosinate-ammonium has herbicidal activity, is easy to decompose in soil, has low toxicity to human and animals, has a wide herbicidal spectrum, and has low damage to the environment.

Currently, glufosinate-ammonium is generally marketed as a racemic mixture. If the glufosinate-ammonium product can be used in the form of L-configuration pure optical isomer, the using amount of glufosinate-ammonium can be obviously reduced, and the method has important significance for improving atom economy, reducing use cost and relieving environmental pressure.

The main preparation method of chiral pure L-glufosinate-ammonium mainly comprises three steps: chiral resolution, chemical synthesis and biological catalysis.

Chiral resolution requires the use of an expensive chiral resolving agent (e.g., quinine), the resolution procedure is very complicated (e.g., steps of salt formation, induced crystallization, salt resolution, etc. are required), and the theoretical yield of the resolution is only 50%, which results in a low industrial value of this route.

The chemical synthesis methods include asymmetric synthesis methods and chiral source methods of natural amino acids, and the like, and have the disadvantages of requiring expensive noble metals and ligands or starting materials, requiring highly toxic substances for reaction routes, having long reaction synthesis routes, and the like.

The method for producing glufosinate-ammonium by a biological catalysis method has the advantages of strict stereoselectivity, mild reaction conditions, high yield and the like, and is an advantageous method for producing L-glufosinate-ammonium. The method mainly comprises the following two types: (1) the L-glufosinate-ammonium derivative is used as a substrate and is obtained by direct hydrolysis through an enzyme method, and the method has the main advantages that the conversion rate is high, the ee value of a product is high, and an expensive and difficultly obtained chiral raw material is used as a precursor; (2) the method takes a precursor of racemic glufosinate-ammonium as a substrate, and obtains the glufosinate-ammonium through selective resolution of enzyme, and has the main advantages that raw materials are relatively easy to obtain, the activity of a catalyst is high, but the theoretical yield can only reach 50%, and the waste of the raw materials is caused.

Besides the two traditional biocatalysis methods, the racemization-removing synthesis method taking D, L-glufosinate-ammonium as the raw material highlights huge cost advantages. Because the commercial glufosinate-ammonium is D, L-glufosinate-ammonium, the industrial production technology is mature, the racemization-removing synthesis method directly uses D, L-glufosinate-ammonium as a raw material, is simple and easy to obtain, has low cost, and can be well butted with the existing glufosinate-ammonium industrial production system.

Disclosure of Invention

The present application is based on the identification of Glu/Leu/Phe/Val dehydrogenase mutants which can be used to improve the bio-enzymatic production of L-glufosinate-ammonium.

In a first aspect, the present application relates to a Glu/Leu/Phe/Val dehydrogenase mutant having Glu/Leu/Phe/Val dehydrogenase activity, wherein the amino acid sequence of the Glu/Leu/Phe/Val dehydrogenase mutant comprises a substitution of an amino acid residue corresponding to position 91 and/or position 168 when compared to the amino acid sequence of a Glu/Leu/Phe/Val dehydrogenase comprising the sequence shown in SEQ ID No.5, said positions 91 and 168 being defined with reference to SEQ ID No.5, and the amino acid sequence of the Glu/Leu/Phe/Val dehydrogenase mutant has at least 90% identity to the sequence shown in SEQ ID No. 5.

In some embodiments, the substitution at amino acid residue 91 is V91I, i.e., the amino acid residue at position 91 is V to I. In some embodiments, the substitution of the amino acid residue at position 168 is N168G, i.e., the amino acid residue at position 168 is N to G.

In some embodiments, the Glu/Leu/Phe/Val dehydrogenase mutant comprises a V91I amino acid substitution when aligned with the amino acid sequence of a Glu/Leu/Phe/Val dehydrogenase comprising the sequence set forth in SEQ ID No.5, wherein the position of the amino acid is defined with reference to SEQ ID No. 5. In some embodiments, the Glu/Leu/Phe/Val dehydrogenase mutant comprises a N168G amino acid substitution when aligned with the amino acid sequence of a Glu/Leu/Phe/Val dehydrogenase comprising the sequence set forth in SEQ ID No.5, wherein the position of the amino acid is defined with reference to SEQ ID No. 5. In some embodiments, the Glu/Leu/Phe/Val dehydrogenase mutant comprises V91I and N168G amino acid substitutions when aligned with an amino acid sequence of a Glu/Leu/Phe/Val dehydrogenase comprising the sequence set forth in SEQ ID No.5, wherein the positions of the amino acids are defined with reference to SEQ ID No. 5.

The amino acid sequence of the Glu/Leu/Phe/Val dehydrogenase comprising the sequence indicated under SEQ ID NO.5 can be referred to in the present application as the wild-type enzyme having Glu/Leu/Phe/Val dehydrogenase activity. The nucleotide sequence of the wild-type enzyme can be the nucleotide sequence shown in SEQ ID NO. 10.

The Glu/Leu/Phe/Val dehydrogenase mutant described herein has Glu/Leu/Phe/Val dehydrogenase activity, i.e., activity of converting an α -keto acid precursor of a structurally similar amino acid such as glutamic acid/leucine/phenylalanine/valine into an L-amino acid, and particularly, the Glu/Leu/Phe/Val dehydrogenase or the mutant thereof described herein has activity of converting 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid (PPO for short) into L-glufosinate-ammonium.

"the position of the amino acid is defined with reference to SEQ ID NO. 5" means that the amino acid in the Glu/Leu/Phe/Val dehydrogenase mutant is aligned with a specific amino acid position (e.g., position 91, position 168) when aligned with the amino acid sequence of SEQ ID NO. 5.

The Glu/Leu/Phe/Val dehydrogenase mutants of the present application may have improved activity compared to the wild-type enzyme having Glu/Leu/Phe/Val dehydrogenase activity, e.g. have higher catalytic efficiency in the catalytic reaction of converting 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid to L-glufosinate, and optionally have better stability for use in the biocatalytic processes for the production of L-glufosinate, in particular the biocatalytic processes described herein, etc.

The term "catalytic efficiency" as used in the present application refers to the property of the Glu/Leu/Phe/Val dehydrogenase to allow its conversion of 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid to L-glufosinate. In one embodiment, the catalytic efficiency of the Glu/Leu/Phe/Val dehydrogenase mutants of the present application is enhanced compared to the wild-type or reference Glu/Leu/Phe/Val dehydrogenase. Preferably, the catalytic efficiency of the Glu/Leu/Phe/Val dehydrogenase mutant of the present application is at least 1.1, 1.2 or 1.3 times the catalytic efficiency of the wild-type or reference Glu/Leu/Phe/Val dehydrogenase.

In some embodiments, the Glu/Leu/Phe/Val dehydrogenase mutant is derived from Delftia acidovorans.

In some embodiments, the amino acid sequence of the Glu/Leu/Phe/Val dehydrogenase mutant is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID No. 5. In some embodiments, the nucleotide sequence of the Glu/Leu/Phe/Val dehydrogenase mutant is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID No. 10. In some embodiments, the Glu/Leu/Phe/Val dehydrogenase mutant comprises an amino acid sequence having one or several (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid substitutions, deletions, and/or insertions as compared to the wild-type enzyme and/or one or more truncations as compared to the wild-type enzyme.

In some embodiments, the Glu/Leu/Phe/Val dehydrogenase mutant has an amino acid substitution at amino acid residue 91 and/or 168 when aligned with the amino acid sequence of a Glu/Leu/Phe/Val dehydrogenase comprising the sequence set forth in SEQ ID No. 5.

In a second aspect, the present application provides a nucleic acid or polynucleotide sequence comprising a sequence encoding the above Glu/Leu/Phe/Val dehydrogenase mutant. The nucleic acid or polynucleotide sequence may be isolated.

The term "nucleic acid" or "polynucleotide" is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule may be single-stranded or double-stranded, but is preferably double-stranded DNA.

The features, definitions and preferences described in the first aspect apply equally to the second aspect.

In a third aspect, the present application provides an expression vector comprising the nucleic acid or polynucleotide sequence described above. The expression vector may comprise one or more control sequences operably linked to direct expression of the above-described Glu/Leu/Phe/Val dehydrogenase mutant in a suitable expression host.

The term "operably linked" refers to a linkage of polynucleotide elements (or coding sequences or nucleic acid sequences) in a functional relationship. A nucleic acid sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. In some embodiments, the control sequences may include promoters, enhancers, terminators, and the like.

The expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the polynucleotide of the Glu/Leu/Phe/Val dehydrogenase mutant. The choice of expression vector will generally depend on the compatibility of the vector with the cell into which the vector is to be introduced. The expression vector may exist as an extrachromosomal entity, a vector whose replication is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. Alternatively, the expression vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.

More than one copy (e.g., 2, 3, or 4) of the expression vector of the present application can be inserted into a host cell to increase production (over-expression) of the Glu/Leu/Phe/Val dehydrogenase mutant encoded by the nucleic acid sequence contained within the expression vector.

In some embodiments, the expression vectors of the present application may further comprise nucleic acid sequences encoding formate dehydrogenase, glucose dehydrogenase or alcohol dehydrogenase to effect expression of these dehydrogenases with mutants, preferably with L-amino acid dehydrogenase mutants.

The features, definitions and preferences described in the first and second aspect apply equally to the third aspect.

In a fourth aspect, the present application provides a recombinant host cell comprising a nucleic acid as described herein or an expression vector as described herein.

In some embodiments, the recombinant host cell may be a prokaryotic or eukaryotic cell. In some embodiments, the host cell is of the genus Saccharomyces (Saccharomyces), Aspergillus (Aspergillus), Pichia (Pichia), Kluyveromyces (Kluyveromyces), Candida (Candida), Hansenula (Hansenula), Humicola (Humicola), Issatchenkia (Issatchenkia), trichosporus (trichosporin), Brettanomyces (Brettanomyces), Pachysolen (Pachysolen), Yarrowia (Yarrowia), Actinomycetes (Actinomycetes), Streptomyces (Streptomyces), Bacillus (Bacillus), or Escherichia (Escherichia); preferably one of Saccharomyces cerevisiae (Saccharomyces cerevisiae), Yarrowia lipolytica (Yarrowia lipolytica), Candida krusei (Candida krusei), Issatchenkia orientalis, Bacillus subtilis (Bacillus subtilis) or Escherichia coli (Escherichia coli).

The expression vectors of the present application can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acids (e.g., DNA) into host cells that are well known to those of skill in the art. Suitable Methods for transforming or transfecting host cells can be found in Sambrook et al (Molecular Cloning: A Laboratory Manual, 2 nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY,1989), Davis et al, Basic Methods in Molecular Biology (1986) and other Laboratory manuals.

In some embodiments, the recombinant host cell is a host cell that co-expresses (a) an L-amino acid dehydrogenase having 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid activity and (b) a dehydrogenase selected from a formate dehydrogenase, a glucose dehydrogenase, or an alcohol dehydrogenase.

The features, definitions and preferences described in the first, second and third aspect apply equally to the fourth aspect.

In a fifth aspect, the present application provides the use of a Glu/Leu/Phe/Val dehydrogenase mutant, nucleic acid, expression vector or recombinant host cell as described herein for the preparation of L-glufosinate-ammonium.

The features, definitions and preferences described in the first, second, third and fourth aspects apply equally to the fifth aspect.

In a sixth aspect, the present application provides a method for preparing L-glufosinate, comprising converting D-glufosinate to L-glufosinate in the presence of an enzymatic catalytic system comprising a Glu/Leu/Phe/Val dehydrogenase mutant for converting 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid to L-glufosinate.

In some embodiments, the D-glufosinate is initially present in a racemic mixture of D-and L-glufosinate, or salts thereof. The racemic phosphinothricin starting material may be provided in a variety of forms. Various salts of racemic phosphinothricin, such as ammonium salts and hydrochloride salts, or zwitterions may be used.

In some embodiments, the enzymatic catalytic system further comprises a D-amino acid oxidase for converting D-glufosinate of the D, L-glufosinate to 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid. The D-amino acid oxidase may be any enzyme known in the art having D-amino acid oxidase activity or a variant thereof. For example, D-amino acid oxidases as described in CN107502647B, CN111019916B, CN 111321193B.

In some embodiments, the enzymatic catalytic system further comprises a catalase. The catalase is used to remove the by-product hydrogen peroxide, as hydrogen peroxide accumulation can have a deleterious effect on the enzyme catalyst. The catalase may be any enzyme known in the art having a catalase activity, for example, catalase available from Ningxia Severe industries group Co., Ltd under the trade designation CAT-400.

In some embodiments, the enzymatic catalytic system further comprises a coenzyme cycling system selected from at least one of:

(1) formate dehydrogenase coenzyme circulation system: including formate dehydrogenase, formate and coenzymes;

(2) glucose dehydrogenase coenzyme circulation system: including glucose dehydrogenase, glucose and coenzymes;

(3) alcohol dehydrogenase coenzyme cycling system: including alcohol dehydrogenases, isopropanol and coenzymes.

In some preferred embodiments, the coenzyme is NADH.

The Formate Dehydrogenase (FDH) described herein can be any enzyme or enzyme variant known in the art having formate dehydrogenase activity. In some embodiments, the formate dehydrogenase is derived from Lactobacillus buchneri. In some embodiments, the amino acid sequence of the formate dehydrogenase has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID No. 2. In some embodiments, the nucleotide sequence of the formate dehydrogenase has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the nucleotide sequence set forth in SEQ ID No. 7.

The Glucose Dehydrogenase (GDH) described herein can be any enzyme or enzyme variant having glucose dehydrogenase activity known in the art. In some embodiments, the glucose dehydrogenase is derived from Exiguobacterium sibiricum. In some embodiments, the amino acid sequence of the glucose dehydrogenase has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID No. 3. In some embodiments, the nucleotide sequence of the glucose dehydrogenase has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the nucleotide sequence set forth in SEQ ID No. 8.

The Alcohol Dehydrogenase (ADH) described herein can be any enzyme or enzyme variant known in the art having alcohol dehydrogenase activity. In some embodiments, the alcohol dehydrogenase is derived from Lactobacillus brevis. In some embodiments, the amino acid sequence of the alcohol dehydrogenase has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID No. 4. In some embodiments, the nucleotide sequence of the alcohol dehydrogenase has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the nucleotide sequence set forth in SEQ ID No. 9.

The enzyme described herein (e.g., Glu/Leu/Phe/Val dehydrogenase mutant, D-amino acid oxidase, catalase, formate dehydrogenase, glucose dehydrogenase, or alcohol dehydrogenase) can be in the form of a purified enzyme; a partially purified enzyme; a cell-free extract or a crude cell extract; liquid, powder or fixed form; permeabilized cells, whole cells or whole fermentation broth containing the enzyme or any other suitable form. In some embodiments, the form of each enzyme in the enzymatic catalytic system is each independently selected from: free enzymes and recombinant host cells expressing enzymes.

In some embodiments, wherein the recombinant host cells expressing enzymes are each independently selected from the group consisting of: saccharomyces (Saccharomyces), Aspergillus (Aspergillus), Pichia (Pichia), Kluyveromyces (Kluyveromyces), Candida (Candida), Hansenula (Hansenula), Humicola (Humicola), Issatchenkia (Issatchenkia), Trichosporon (Trichosporon), Brettanomyces (Brettanomyces), Pachysolen (Pachysolen), Yarrowia (Yarrowia), Actinomycetes (Actinomycetes), Streptomyces (Streptomyces), Bacillus (Bacillus) or Escherichia (Escherichia); for example from Saccharomyces cerevisiae (Saccharomyces cerevisiae), Yarrowia lipolytica (Yarrowia lipolytica), Candida krusei (Candida krusei), Issatchenkia orientalis, Bacillus subtilis (Bacillus subtilis) or Escherichia coli (Escherichia coli).

In some embodiments, the conversion reaction is carried out in a reaction solution. Preferably, the reaction solution has a pH of 7 to 10, preferably 8 to 9. In the reaction solution having a pH of 7 to 10, it is preferable to carry out the reaction in the reaction solution having a pH of 8 to 9, whereby more excellent reaction efficiency can be obtained.

The method described in the present application may include: a step a) in which an oxidation reaction catalyzed by the D-amino acid oxidase takes place and a step b) in which a reductive amination reaction catalyzed by the Glu/Leu/Phe/Val dehydrogenase mutant takes place.

In some embodiments, the temperature of the oxidation reaction of step a) is from 25 to 45 ℃, e.g., from 30 to 45 ℃, from 35 to 45 ℃, and the like; the time period is 6 to 24 hours, such as 6 to 12 hours, 12 to 24 hours, such as 6 hours, 12 hours, and the like.

In step b), the PPO generated in step a) is catalytically reduced into L-glufosinate-ammonium by L-amino acid dehydrogenase, so that in-situ racemization of D, L-glufosinate-ammonium is realized, and L-glufosinate-ammonium with ee value more than 99% is obtained. In some embodiments, the reaction system of step b) further comprises coenzyme NADH. In some embodiments, the molar ratio of NADH to substrate is from 1:10 to 1: 5000. In some embodiments, NADH is added in an amount of 0.1 to 2mM on a molar basis; more preferably 0.5 mM.

In some embodiments, the temperature of the reductive amination reaction of step b) is from 25 to 45 ℃, e.g., from 30 to 45 ℃, from 35 to 45 ℃, and the like; the time period is 6 to 24 hours, such as 6 to 12 hours, 12 to 24 hours, such as 6 hours, 12 hours, and the like.

In some embodiments, in step b), the molar ratio of inorganic ammonium donor to substrate at the start of the reaction is from 1:1 to 10: 1.

In some embodiments, in step b), the inorganic ammonium donor may be ammonium phosphate, ammonium chloride, ammonium sulfate, ammonium formate, ammonium acetate, aqueous ammonia; preferably, the inorganic ammonium donor can be ammonium phosphate, ammonium formate, aqueous ammonia; more preferably, the inorganic ammonium donor may be aqueous ammonia.

The processes described herein can be carried out in one or more reaction vessels. Preferably, the process described herein is carried out in one reaction vessel (i.e., "one-pot two-step process").

In some preferred embodiments, the D-amino acid oxidase used in step a) is expressed by a first recombinant microorganism. Thus, step a) may comprise: subjecting D-glufosinate-ammonium to an oxidation reaction in the presence of a first recombinant microorganism and oxygen to obtain 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid. The use of said first recombinant microorganism enables a higher catalytic efficiency to be conferred to the process of the present application. The first recombinant microorganism can be constructed using any method known in the art. For example, the first recombinant microorganism can be constructed as follows: constructing a recombinant expression vector containing the D-amino acid oxidase gene, transforming the recombinant expression vector into a microorganism, performing induction culture on the obtained recombinant microorganism, and separating a culture solution to obtain a first recombinant microorganism containing the D-amino acid oxidase gene. Preferably, the addition amount of the first recombinant microorganism is 1g/L-200g/L of reaction liquid according to the wet weight of the thallus after centrifugation for 10min at 10000 rpm; more preferably, 10g/L to 100g/L of the reaction solution; most preferably, it is 30g/L of the reaction solution.

In some preferred embodiments, the Glu/Leu/Phe/Val dehydrogenase mutant used in step b) and the enzyme for coenzyme cycle are co-expressed by a second recombinant microorganism. Thus, step b) may comprise: subjecting the 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid obtained in step a) to a reductive amination reaction in the presence of a second recombinant microorganism co-expressing a Glu/Leu/Phe/Val dehydrogenase mutant and an enzyme for coenzyme cycle (e.g. formate dehydrogenase, glucose dehydrogenase or alcohol dehydrogenase) and an inorganic ammonium salt to give L-glufosinate. The use of said second recombinant microorganism enables a higher catalytic efficiency to be conferred to the process of the present application. The second recombinant microorganism can be constructed using any method known in the art. For example, the second recombinant microorganism can be constructed as follows: constructing a recombinant expression vector containing the Glu/Leu/Phe/Val dehydrogenase mutant and a gene of an enzyme for coenzyme cycle, transforming the recombinant expression vector into a microorganism, carrying out induction culture on the obtained recombinant microorganism, and separating a culture solution to obtain a second recombinant microorganism containing the Glu/Leu/Phe/Val dehydrogenase mutant and the gene of the enzyme for coenzyme cycle. Preferably, the addition amount of the second recombinant microorganism is 1g/L-200g/L of reaction liquid according to the wet weight of the thallus after centrifugation for 10min at 10000 rpm; more preferably, 3g/L to 100g/L of the reaction solution; most preferably, it is 30g/L of the reaction solution.

The first and second recombinant microorganisms may be any engineered bacteria suitable for enzyme expression. In some embodiments, the first and second recombinant microorganisms each independently belong to one of the following genera: saccharomyces (Saccharomyces), Aspergillus (Aspergillus), Pichia (Pichia), Kluyveromyces (Kluyveromyces), Candida (Candida), Hansenula (Hansenula), Humicola (Humicola), Issatchenkia (Issatchenkia), Trichosporon (Trichosporon), Brettanomyces (Brettanomyces), Pachysolen (Pachysolen), Yarrowia (Yarrowia), Actinomycetes (Actinomycetes), Streptomyces (Streptomyces), Bacillus (Bacillus) or Escherichia (Escherichia). In some preferred embodiments, the first and second recombinant microorganisms are each independently selected from the group consisting of Saccharomyces cerevisiae (Saccharomyces cerevisiae), Yarrowia lipolytica (Yarrowia lipolytica), Candida krusei (Candida kruseii), Issatchenkia orientalis, Bacillus subtilis (Bacillus subtilis), and Escherichia coli (Escherichia coli). In some more preferred embodiments, the first and second recombinant microorganisms are both E.coli.

The yield of the methods of the present application can be measured by any method known in the art. For example, the two configuration contents of the obtained glufosinate-ammonium product can be measured by chiral HPLC. In some embodiments, the enantiomeric excess (e.e.) of the L-glufosinate product obtained is at least 99% (relative to D-glufosinate, the same below). In some embodiments, the L-glufosinate product is obtained in a yield of at least 95%, 96% or 97%.

The capital letters of the invention represent amino acids as are well known to those skilled in the art and, according to the application, represent the corresponding amino acid residues herein.

The experimental methods in the present invention are conventional methods unless otherwise specified, and the gene cloning procedures can be specifically described in molecular cloning protocols, compiled by J. Sambruka et al.

Description of the sequence listing:

SEQ ID NO.1 is the amino acid sequence annotated as D-amino acid oxidase (DAAO) derived from Microbotryum intermedium.

SEQ ID NO.2 is the amino acid sequence annotated as Formate Dehydrogenase (FDH) from Lactobacillus buchneri.

SEQ ID NO.3 is an amino acid sequence annotated as Glucose Dehydrogenase (GDH) derived from Exiguobacterium sibiricum.

SEQ ID NO.4 is the amino acid sequence from Lactobacillus brevis annotated as Alcohol Dehydrogenase (ADH).

SEQ ID NO.5 is the amino acid sequence derived from Delftia acididovarans annotated as Glu/Leu/Phe/Val dehydrogenase.

SEQ ID NO.6 is a nucleotide sequence annotated as D-amino acid oxidase (DAAO) derived from Microbotryum intermedium.

SEQ ID NO.7 is a nucleotide sequence annotated as Formate Dehydrogenase (FDH) derived from Lactobacillus buchneri.

SEQ ID NO.8 is a nucleotide sequence annotated as Glucose Dehydrogenase (GDH) derived from Exiguobacterium sibiricum.

SEQ ID NO.9 is a nucleotide sequence from Lactobacillus brevis annotated as Alcohol Dehydrogenase (ADH).

SEQ ID NO.10 is a nucleotide sequence derived from Delftia acididovarans annotated as Glu/Leu/Phe/Val dehydrogenase.

The Glu/Leu/Phe/Val dehydrogenase mutant enables a reaction system to have better catalytic efficiency, when PPO is used as a substrate to perform catalytic reaction, the conversion rate is far higher than that of a wild type, and the yield of L-glufosinate-ammonium is greatly improved.

Drawings

FIG. 1 schematically shows the reaction scheme for producing L-glufosinate by the multi-enzyme system resolution method adopted in the method of the present application.

FIG. 2 schematically shows the reaction scheme (glucose dehydrogenase coenzyme cycling system) for the racemization synthesis of L-glufosinate-ammonium.

FIG. 3 schematically shows the reaction scheme for the racemization synthesis of L-glufosinate-ammonium (formate dehydrogenase coenzyme cycling system).

FIG. 4 illustrates the progress of the two-strain multi-enzyme one-pot two-step deracemization reaction for the preparation of L-glufosinate-ammonium.

Detailed Description

Examples

Materials and methods

Reagents used in upstream genetic engineering: the genome extraction kit, the plasmid extraction kit and the DNA purification and recovery kit used in the examples were purchased from Kangning Life sciences (Wujiang) Co., Ltd.; the one-step cloning kit was purchased from nuozokenza co ltd; coli BL21(DE3), plasmid pET-28a (+) and the like were purchased from Shanghai Xuan Guangzi Biotech development Co., Ltd; DNA markers, low molecular weight standard proteins, protein pre-gels were purchased from GenStar, Beijing; the Clonexpress II One Step Cloning Kit seamless Cloning Kit was purchased from Nanjing Novophilia Biotech GmbH; pfu DNA polymerase and Dpn I endonuclease were purchased from Saimer Feishell science and technology (China); primer synthesis and sequence sequencing are completed by Hangzhou Zhikexi biotechnology limited, and whole gene synthesis is completed by Biotechnology engineering (Shanghai) limited. The method of using the above reagent is referred to the commercial specification.

The reagent 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid (PPO) used in the downstream catalytic process is from Yongnong bioscience, Inc.; d, L-glufosinate-ammonium is from Yongnong bioscience, Inc.; other commonly used reagents are available from the national pharmaceutical group chemical agents, ltd.

In the examples, the progress of the reaction was detected by High Performance Liquid Chromatography (HPLC), and PPO was analyzed. The HPLC analysis method comprises the following steps: a chromatography column PBR; column temperature/30 ℃; flow rate/1 mL/min; detection wavelength/210 nm; mobile phase: 5mM (NH)₄)₂HPO₄。

Detecting the contents of two configurations of glufosinate-ammonium by a chiral HPLC analysis method, wherein the chiral HPLC analysis method comprises the following steps: column/OA-5000L; mobile phase/0.5 g/L ammonium copper sulfate pentahydrate solution, and 0.3% v/v acetonitrile; detection wavelength/254 nm; flow rate/1 mL/min; column temperature/35 ℃.

Example 1: construction of genetically engineered bacteria

After the whole gene synthesis of the gene sequence of D-amino acid oxidase (DAAO, GenBank number: FMSP01000004.1, amino acid sequence shown in SEQ ID NO.1, and nucleotide sequence shown in SEQ ID NO. 6) derived from Microbotryum intermedium, pET-28a (+) was inserted into the expression plasmid to obtain pET-28 a-DAAO. After sequencing verification, pET-28a-daao is transferred into an expression host Escherichia coli E.coli BL21(DE3) for subsequent expression of the recombinase.

After the complete gene synthesis of the sequence of formic acid dehydrogenation (FDH) derived from Lactobacillus buchneri (the amino acid sequence is shown in SEQ ID NO.2 and the nucleotide sequence is shown in SEQ ID NO. 7), the sequence is inserted into an expression plasmid pET-28a (+) to obtain pET-28 a-FDH. After sequencing verification, pET-28a-fdh is transferred into an expression host escherichia coli E.coli BL21(DE3) for subsequent expression of recombinase.

After the whole gene synthesis of a sequence (amino acid sequence is shown in SEQ ID NO.3 and nucleotide sequence is shown in SEQ ID NO. 8) of Glucose Dehydrogenase (GDH) derived from Exiguobacterium sibiricum, an expression plasmid pET-28a (+) is inserted to obtain pET-28 a-GDH. After sequencing verification, pET-28a-gdh is transferred into an expression host escherichia coli E.coli BL21(DE3) for subsequent expression of recombinase.

After the whole gene synthesis of the sequence of Alcohol Dehydrogenase (ADH) derived from Lactobacillus brevis (amino acid sequence is shown in SEQ ID NO.4 and nucleotide sequence is shown in SEQ ID NO. 9), the sequence was inserted into expression plasmid pET-28a (+), and pET-28a-ADH was obtained. After sequencing verification, pET-28a-adh is transferred into an expression host escherichia coli E.coli BL21(DE3) for subsequent expression of recombinase.

The gene sequence of Glu/Leu/Phe/Val dehydrogenase (GenBank number: WP-012202150.1, amino acid sequence shown in SEQ ID NO.5, and nucleotide sequence shown in SEQ ID NO. 10) derived from Delftia acidovans was subjected to whole gene synthesis, and inserted into expression plasmid pET-28a (+) to obtain plasmid pET-28 a-laadh. After being sequenced and verified to be correct, the recombinant DNA is transferred into an expression host Escherichia coli E.coli BL21(DE3) for subsequent expression of recombinase.

Example 2: culture of engineered bacteria

Recombinant Escherichia coli E.coli BL21(DE3)/pET-28a-DAAO, E.coli BL21(DE3)/pET-28a-LAADH, E.coli BL21(DE3)/pET-28a-FDH, E.coli BL21(DE3)/pET-28a-GDH and E.coli BL21(DE3)/pET-28a-ADH were subjected to plate streaking activation, and then single colonies were picked and inoculated into 10mL LB liquid medium containing 50. mu.g/mL kanamycin, and shake-cultured at 37 ℃ for 10 hours. The cells were inoculated at 2% into 50mL of LB liquid medium containing 50. mu.g/mL of kanamycin, shake-cultured at 37 ℃ until OD600 reached about 0.8, and then IPTG was added thereto to a final concentration of 0.1mM, and shake-cultured at 25 ℃ for 12 hours. After the culture is finished, the culture solution is centrifuged for 10min at 8000rpm, the supernatant is discarded, and the thalli are collected and stored in an ultra-low temperature refrigerator at minus 80 ℃ for later use.

Example 3: construction of D-amino acid oxidase (DAAO) mutant (62-position, 226-position)

Position 62 and/or 226 (in particular F62K, M226T) were mutated on the basis of the wild-type DAAO sequence described in example 1. The primer sequences for PCR were designed for the mutants mutated at positions 62 and 226 of the mutated D-amino acid oxidase sequence, as shown in Table 1:

TABLE 1

Serial number	Name of the lead	Primer sequences
			1	F62KF	gattcttgcgggtccaccttggggcaccagttcgctc
2	F62KR	gagcgaactggtgccccaaggtggacccgcaagaatc
			3	M226TF	ggggtctgacgcatcggtagtgcacagcttgac
4	M226TR	gtcaagctgtgcactaccgatgcgtcagacccc

The PCR (25. mu.L) amplification system was as follows:

pfu buffer 12.5. mu.L, primer 2. mu.L, template plasmid 1. mu.L, dNTP 0.5. mu.L, Pfu 1. mu.L, ddH was added₂Make up to 25. mu.L of O.

PCR amplification conditions:

(1) pre-denaturation at 95 ℃ for 3min, (2) denaturation at 95 ℃ for 30 sec, (3) annealing at 65 ℃ for 30 sec, (4) extension at 72 ℃ for 5min for 20 cycles, (5) extension at 72 ℃ for 10min, and (6) storage at 4 ℃.

And after PCR, taking 5 mu L of the amplified product to carry out nucleic acid gel electrophoresis analysis, obtaining a clear target band, adding 0.5 mu L of Dpn I endonuclease into the residual product, and digesting the template DNA at 37 ℃ for 3 h.

After completion of the reaction, the cells were transformed into BL21 competent cells, plated on LB solid medium containing 50. mu.g/mL of kanamycin, and cultured overnight at 37 ℃. And selecting a single colony to obtain a mutant transformant. Bacterial cells were obtained as described in example 2.

Example 4: construction of Glu/Leu/Phe/Val dehydrogenase mutants (positions 91 and 168)

Positions 91 and 168 (in particular V91I, N168G) were mutated on the basis of the wild-type LAADH sequence described in example 1. Primer sequences were designed for mutant PCR with mutations at positions 91 and 168 of the mutated LAADH sequence, as shown in table 2:

TABLE 2

Serial number	Name of the lead	Primer sequences
			1	V91IF	cctggtggaaacggatgccgcccttgccg
2	V91IR	cggcaagggcggcatccgtttccaccagg
			3	N168GF	gggtccgaagaatcggtcgtgcagcgcttgc
4	N168GR	gcaagcgctgcacgaccgattcttcggaccc

The PCR amplification system and conditions were the same as those described in example 3.

After completion of the reaction, the cells were transformed into BL21 competent cells, plated on LB solid medium containing 50. mu.g/mL of kanamycin, and cultured overnight at 37 ℃. And selecting a single colony to obtain a mutant transformant. Bacterial cells were obtained as described in example 2.

Example 5: comparison of enzyme activities of Glu/Leu/Phe/Val dehydrogenase mutants

The catalytic efficiency of L-amino acid dehydrogenase was compared with that of its mutant by measuring the consumption of PPO. When only L-amino acid dehydrogenase and the mutant exist, the reaction system is as follows: 250mM PPO, 100mM phosphate buffer solution with pH8.0, 300mM glucose, 10g/L L-amino acid dehydrogenase or mutant freeze-dried cells thereof and 10g/L glucose dehydrogenase freeze-dried cells. After 24h of reaction, a sample of the reaction solution was taken for work-up, the concentration of L-PPT was determined by HPLC and the conversion (concentration of product L-PPT/concentration of initial substrate PPO. times.100%) was calculated.

TABLE 3

As can be seen from Table 3, the resulting mutants all had higher conversion than the wild-type LAADH. The LAADH mutant 4 with the highest conversion rate is the LAADH mutant 4, the 91 th V mutation of the mutation site is I, and the 168 th N mutation is G.

Example 6: construction of LAADH-expressing Strain

Construction of expression strain containing glucose dehydrogenase coenzyme circulating system

The plasmid pET-28a-LAADH V91I-N168G-GDH was constructed by ligating a glucose dehydrogenase gene fragment to a multiple cloning site with Hind III by a seamless cloning kit in the pET-28a-LAADH V91I-N168G, and the expression strain E.coli BL21(DE3)/pET-28a-LAADH V91I-N168G-GDH was constructed.

Secondly, construction of expression strain containing formate dehydrogenase coenzyme circulating system

A formate dehydrogenase gene fragment is connected to a multiple cloning site on a vector pET-28a-LAADH V91I-N168G through a seamless cloning kit, the enzyme cutting site is Hind III, a plasmid pET-28a-LAADH V91I-N168G-FDH is constructed, and an expression strain E.coli BL21(DE3)/pET-28a-LAADH V91I-N168G-FDH is constructed.

Construction of expression strain for alcohol dehydrogenase coenzyme circulation system

On a vector pET-28a-LAADH V91I-N168G, an alcohol dehydrogenase gene fragment is connected to a multiple cloning site through a seamless cloning kit, the enzyme cutting site is Hind III, a plasmid pET-28a-LAADH V91I-N168G-ADH is constructed, and an expression strain E.coli BL21(DE3)/pET-28a-LAADH V91I-N168G-ADH is constructed.

Example 7: preparation of L-glufosinate-ammonium (coenzyme circulation system containing glucose dehydrogenase GDH) by dual-bacterium multi-enzyme racemization removal

A strain capable of expressing D-amino acid oxidase E.coli BL21(DE3)/pET-28a-DAAO F62K-M226 and an expression strain capable of expressing L-amino acid dehydrogenase and glucose dehydrogenase E.coli BL21(DE3)/pET-28a-LAADH V91I-N168G-GDH were cultured in accordance with the procedure of example 2, and the cells were collected by centrifugation and lyophilized.

600mL of ammonium phosphate buffer (pH8.0, 100mM) containing 400mM D, L-PPT, 8000U/L catalase, 5% (V/V) antifoaming agent, 20g/L E.coli BL21(DE3)/pET-28a-DAAO F62K-M226 cells, 20g/L E.coli BL21(DE3)/pET-28a-LAADH V91I-N168G-GDH cells, 0.5mM NADH and 250mM glucose was charged into a 1L reactor, and air was passed through the reactor at an aeration rate of 2L/min, followed by addition of ammonia water to control pH8 and a temperature of 30 ℃ for 24 hours. After the reaction is finished, the liquid phase detection shows that the L-PPT is 388mM, the e.e. value of the product L-glufosinate-ammonium is more than 99%, and the conversion yield of the L-PPT is 97%.

Example 8: preparation of L-glufosinate-ammonium (containing formate dehydrogenase FDH coenzyme circulating system) by double-bacterium multienzyme racemization removal

A strain capable of expressing D-amino acid oxidase E.coli BL21(DE3)/pET-28a-DAAO F62K-M226 and an expression strain capable of expressing L-amino acid dehydrogenase and formate dehydrogenase E.coli BL21(DE3)/pET-28a-LAADH V91I-N168G-FDH were cultured in the same manner as in example 2, and the cells were collected by centrifugation and lyophilized.

600mL of ammonium phosphate buffer (pH8.0, 100mM) containing 400mM D, L-PPT, 8000U/L catalase, 5% (V/V) antifoaming agent, 20g/L E.coli BL21(DE3)/pET-28a-DAAO F62K-M226 lyophilized cells, 20g/L E.coli BL21(DE3)/pET-28a-ADH V91I-N168G-FDH lyophilized cells, 0.5mM NADH and 250mM were charged into a 1L reactor, and air was passed through the reactor with a 2L ammonium formate/min aeration rate, and ammonia water was controlled to have a pH of 8 at 30 ℃ for 24 hours. After the reaction is finished, the liquid phase detection shows that the L-PPT content is 382mM, the e.e. value of the product L-glufosinate-ammonium is more than 99%, and the conversion yield of the L-PPT is 95.5%.

Example 9: preparation of L-glufosinate-ammonium (alcohol dehydrogenase ADH coenzyme circulation system) by double-bacterium multienzyme racemization removal

A strain capable of expressing D-amino acid oxidase E.coli BL21(DE3)/pET-28a-DAAO F62K-M226 and an expression strain capable of expressing L-amino acid dehydrogenase and alcohol dehydrogenase E.coli BL21(DE3)/pET-28a-LAADH V91I-N168G-ADH were cultured in accordance with the method of example 2, and the cells were collected by centrifugation and lyophilized.

A1L reactor was charged with 600mL of a reaction solution (pH8.0 adjusted with aqueous ammonia) containing 400mM D, L-PPT, 8000U/L catalase, 0.5% (V/V) antifoaming agent, 20g/L E.coli BL21(DE3)/pET-28a-DAAO F62K-M226 lyophilized cells, 20g/L E.coli BL21(DE3)/pET-28a-LAADH V91I-N168G-ADH lyophilized cells, 0.5mM NADH and 250mM isopropanol, and air was blown into the reactor to have an air flow of 2L/min, and the aqueous ammonia was controlled to have a pH of 8 and a temperature of 30 ℃ for 24 hours. The liquid phase detection method shown in the examples was used to detect the consumption of D-glufosinate-ammonium and the production of L-glufosinate-ammonium during the reaction, and the reaction progress curve is shown in FIG. 4. The graph shows that the concentration of D-glufosinate gradually decreases and the concentration of L-glufosinate gradually increases over time. After the reaction is finished, the liquid phase detection shows that the L-PPT content is 380mM, the e.e. value of the product L-glufosinate-ammonium is more than 99%, and the conversion yield of the L-PPT is 95%.

It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.

Sequence listing

<110> Wingnong bioscience, Ltd

East China University of Technology

Ningxia Yongnong Biological Science Co., Ltd.

<120> Glu/Leu/Phe/Val dehydrogenase mutant and application thereof in preparation of L-glufosinate-ammonium

<130> PD210084N

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 384

<212> PRT

<213> Microbotryum intermedium

<400> 1

Met Ser Ser Ser Thr Ser Ser Asp Lys Gln Val Val Val Ile Gly Ala

1 5 10 15

Gly Val Ile Gly Leu Thr Ser Ala Leu Val Leu Ala Gln Ser Asn His

20 25 30

Asn Val Thr Leu Val Ala Arg Asp Leu Pro Ser Asp Val Ser Ser Gln

35 40 45

Ala Phe Ala Ser Pro Trp Ala Gly Ala Asn Trp Cys Pro Phe Val Asp

50 55 60

Pro Gln Glu Ser Val Lys Asn Lys Arg Ile Cys Asp Trp Glu Thr Gln

65 70 75 80

Ser Phe Ala Asn Phe Gln Gln Leu Ile Arg Glu His Gly Asp Gly Lys

85 90 95

Leu Val Met Arg Leu Pro Ala Arg Arg Tyr Ala Glu Asn Glu Lys Ala

100 105 110

Leu Leu Gly His Trp Tyr Lys Ser Val Val Pro Arg Tyr Ser Thr Leu

115 120 125

Pro Ser Ser Glu Val Pro Asn Asn Gly Val Gly Val Glu Phe Glu Thr

130 135 140

Ile Ser Val Asn Ala Pro Leu Tyr Cys Gln Trp Leu Glu Ala Gln Leu

145 150 155 160

Leu Ser His Asn Ala Thr Ile Ile Arg Arg Ser Leu Asn Ser Leu Asp

165 170 175

Glu Ala Leu Ser Leu Ala Pro Ser Cys Ser Val Ile Val Asn Ala Thr

180 185 190

Gly Leu Gly Ala Lys Ser Leu Gly Gly Val Glu Asp Gln Thr Val Thr

195 200 205

Pro Ile Arg Gly Gln Thr Val Leu Ile Lys Thr Asp Val Lys Leu Cys

210 215 220

Thr Met Asp Ala Ser Asp Pro Thr Lys Pro Ser Tyr Ile Ile Pro Arg

225 230 235 240

Pro Gly Gly Glu Ala Val Cys Gly Gly Cys Tyr Gly Leu Gly Glu Trp

245 250 255

Asn Leu Ser Thr Asp Thr Glu Leu Ala Lys Leu Ile Leu Glu Arg Cys

260 265 270

Leu Val Leu Asp Pro Arg Ile Ser Ser Asn Gly Ala Leu Asp Gly Ile

275 280 285

Glu Val Leu Arg His Asn Val Gly Leu Arg Pro Ser Arg Gly Thr Asn

290 295 300

Glu Pro Arg Leu Glu Ala Glu Arg Val Val Leu Pro Ser Tyr Ser Leu

305 310 315 320

Asn Pro His Arg Arg His Ala Leu Gly Ala Glu Gly Asn Ala Ala Thr

325 330 335

Val Ile His Ala Tyr Gly Val Gly Pro Ala Gly Tyr Gln Val Ser Trp

340 345 350

Gly Val Ala Asn Glu Val Lys Ala Leu Val Asp Glu His Phe Ala Lys

355 360 365

Phe Asp Thr Arg Thr Thr Gln Asp Gly Val His Arg Asp Ile Lys Leu

370 375 380

<210> 2

<211> 398

<212> PRT

<213> Lactobacillus buchneri

<400> 2

Met Thr Leu Val Leu Ala Val Leu Thr Pro Ala Pro Val Ala Gly Pro

1 5 10 15

Pro Pro Leu Thr Val Ala Ala Ala Ile Pro Leu Ile Thr His Thr Pro

20 25 30

Ala Gly Ser Thr Val Pro Thr Pro Gly Gly Ile Ala Pro Leu Pro Gly

35 40 45

Gly Leu Leu Gly Ser Val Ser Gly Gly Leu Gly Leu Leu Leu Thr Leu

50 55 60

Gly Ser Leu Gly Val Gly Pro Val Val Thr Ser Ala Leu Gly Gly Pro

65 70 75 80

Ala Ser Val Pro Gly Leu Gly Leu Pro Thr Ala Ala Val Val Ile Ser

85 90 95

Gly Pro Pro Thr Pro Ala Thr Leu Thr Ala Ala Leu Ile Ala Leu Ala

100 105 110

Leu Leu Leu Leu Leu Ala Ile Thr Ala Gly Ile Gly Ser Ala His Val

115 120 125

Ala Leu Ala Ala Ala Ala Gly His Ala Ile Thr Val Ala Gly Val Thr

130 135 140

Thr Ser Ala Ser Val Ser Val Ala Gly Ala Gly Val Met Gly Leu Leu

145 150 155 160

Ala Leu Val Ala Ala Pro Ile Pro Ala His Ala Ile Val Leu Ala Gly

165 170 175

Gly Thr Ala Ile Ala Ala Ala Val Ser Ala Ala Thr Ala Leu Gly Gly

180 185 190

Met Thr Val Gly Val Ile Gly Ala Gly Ala Ile Gly Ala Ala Val Leu

195 200 205

Gly Ala Leu Leu Pro Pro Gly Val Leu Leu Val Thr Ala Gly Ala His

210 215 220

Gly Leu Pro Ala Gly Val Gly Ala Gly Leu Gly Leu Thr Thr Pro Pro

225 230 235 240

Ala Val His Gly Met Val Leu Val Val Ala Ala Val Val Leu Ala Ala

245 250 255

Pro Leu His Ala Gly Thr Thr His Leu Pro Ala Ala Gly Val Leu Ala

260 265 270

Thr Met Leu Ala Gly Ala Thr Ile Val Ala Ala Ser Ala Gly Gly Gly

275 280 285

Val Ala Ala Ala Ala Ile Val Ala Ala Leu Ala Ser Gly Gly Ile Gly

290 295 300

Gly Thr Ser Gly Ala Val Thr Thr Pro Gly Pro Ala Pro Leu Ala His

305 310 315 320

Pro Thr Ala Thr Met Pro Ala Gly Ala Met Thr Pro His Met Ser Gly

325 330 335

Thr Thr Leu Ser Ala Gly Ala Ala Thr Ala Ala Gly Ala Ala Gly Ile

340 345 350

Leu Gly Ala Pro Leu Gly Ala Leu Pro Ile Ala Pro Gly Thr Leu Ile

355 360 365

Ala Gly Gly Gly Ser Leu Ala Gly Thr Gly Ala Leu Ser Thr Thr Val

370 375 380

Leu Leu Gly Gly Gly Thr Pro Gly Ser Gly Gly Ala Gly Leu

385 390 395

<210> 3

<211> 262

<212> PRT

<213> Exiguobacterium sibiricum

<400> 3

Met Gly Thr Ala Ser Leu Leu Gly Leu Val Ala Ile Val Thr Gly Gly

1 5 10 15

Ser Met Gly Ile Gly Gly Ala Ile Ile Ala Ala Thr Ala Gly Gly Gly

20 25 30

Met Ala Val Val Ile Ala Thr Ala Ser His Pro Gly Gly Ala Leu Leu

35 40 45

Ile Ala Gly Ala Ile Leu Gly Ala Gly Gly Gly Ala Leu Thr Val Gly

50 55 60

Gly Ala Val Ser Leu Gly Gly Ala Met Ile Ala Leu Val Leu Gly Thr

65 70 75 80

Val Ala His Pro Gly Gly Leu Ala Val Pro Val Ala Ala Ala Gly Val

85 90 95

Gly Met Pro Ser Pro Ser His Gly Met Ser Leu Gly Ala Thr Gly Leu

100 105 110

Val Ile Ala Val Ala Leu Thr Gly Ala Pro Leu Gly Ala Ala Gly Ala

115 120 125

Leu Leu Thr Pro Val Gly His Ala Val Leu Gly Ala Ile Ile Ala Met

130 135 140

Ser Ser Val His Gly Ile Ile Pro Thr Pro Thr Pro Val His Thr Ala

145 150 155 160

Ala Ser Leu Gly Gly Val Leu Leu Met Thr Gly Thr Leu Ala Met Gly

165 170 175

Thr Ala Pro Leu Gly Ile Ala Ile Ala Ala Ile Gly Pro Gly Ala Ile

180 185 190

Ala Thr Pro Ile Ala Ala Gly Leu Pro Gly Ala Pro Leu Gly Ala Ala

195 200 205

Ala Val Gly Ser Met Ile Pro Met Gly Ala Ile Gly Leu Pro Gly Gly

210 215 220

Ile Ser Ala Val Ala Ala Thr Leu Ala Ser Ala Gly Ala Ser Thr Val

225 230 235 240

Thr Gly Ile Thr Leu Pro Ala Ala Gly Gly Met Thr Leu Thr Pro Ser

245 250 255

Pro Gly Ala Gly Ala Gly

260

<210> 4

<211> 252

<212> PRT

<213> Lactobacillus brevis

<400> 4

Met Ser Ala Ala Leu Ala Gly Leu Val Ala Ile Ile Thr Gly Gly Thr

1 5 10 15

Leu Gly Ile Gly Leu Ala Ile Ala Thr Leu Pro Val Gly Gly Gly Ala

20 25 30

Leu Val Met Ile Thr Gly Ala His Ser Ala Val Gly Gly Leu Ala Ala

35 40 45

Leu Ser Val Gly Thr Pro Ala Gly Ile Gly Pro Pro Gly His Ala Ser

50 55 60

Ser Ala Gly Ala Gly Thr Thr Leu Leu Pro Ala Ala Thr Gly Leu Ala

65 70 75 80

Pro Gly Pro Val Ser Thr Leu Val Ala Ala Ala Gly Ile Ala Val Ala

85 90 95

Leu Ser Val Gly Gly Thr Thr Thr Ala Gly Thr Ala Leu Leu Leu Ala

100 105 110

Val Ala Leu Ala Gly Val Pro Pro Gly Thr Ala Leu Gly Ile Gly Ala

115 120 125

Met Leu Ala Leu Gly Leu Gly Ala Ser Ile Ile Ala Met Ser Ser Ile

130 135 140

Gly Gly Pro Val Gly Ala Pro Ser Leu Gly Ala Thr Ala Ala Ser Leu

145 150 155 160

Gly Ala Val Ala Ile Met Ser Leu Ser Ala Ala Leu Ala Cys Ala Leu

165 170 175

Leu Ala Thr Ala Val Ala Val Ala Thr Val His Pro Gly Thr Ile Leu

180 185 190

Thr Pro Leu Val Ala Ala Leu Pro Gly Ala Gly Gly Ala Met Ser Gly

195 200 205

Ala Thr Leu Thr Pro Met Gly His Ile Gly Gly Pro Ala Ala Ile Ala

210 215 220

Thr Ile Cys Val Thr Leu Ala Ser Ala Gly Ser Leu Pro Ala Thr Gly

225 230 235 240

Ser Gly Pro Val Val Ala Gly Gly Thr Thr Ala Gly

245 250

<210> 5

<211> 434

<212> PRT

<213> Delftia acidovorans

<400> 5

Met Gln Gln Pro Ala Ser Ala Gly Val Thr Asn His Ala Ile Pro Ser

1 5 10 15

Tyr Leu Gln Ala Asp His Leu Gly Pro Trp Gly Asn Tyr Leu Gln Gln

20 25 30

Val Asp Arg Val Thr Pro Tyr Leu Gly His Leu Ala Arg Trp Val Glu

35 40 45

Thr Leu Lys Arg Pro Lys Arg Ile Leu Ile Val Asp Val Pro Ile Glu

50 55 60

Leu Asp Asn Gly Thr Ile Ala His Tyr Glu Gly Tyr Arg Val Gln His

65 70 75 80

Asn Leu Ser Arg Gly Pro Gly Lys Gly Gly Val Arg Phe His Gln Asp

85 90 95

Val Thr Leu Ser Glu Val Met Ala Leu Ser Ala Trp Met Ser Val Lys

100 105 110

Asn Ala Ala Val Asn Val Pro Tyr Gly Gly Ala Lys Gly Gly Ile Arg

115 120 125

Val Asp Pro Lys Thr Leu Ser Arg Gly Glu Leu Glu Arg Leu Thr Arg

130 135 140

Arg Tyr Thr Ser Glu Ile Gly Leu Leu Ile Gly Pro Ser Lys Asp Ile

145 150 155 160

Pro Ala Pro Asp Val Asn Thr Asn Gly Gln Ile Met Ala Trp Met Met

165 170 175

Asp Thr Tyr Ser Met Asn Thr Gly Ala Thr Ala Thr Gly Val Val Thr

180 185 190

Gly Lys Pro Val Asp Leu Gly Gly Ser Leu Gly Arg Val Glu Ala Thr

195 200 205

Gly Arg Gly Val Phe Thr Val Gly Val Glu Ala Ala Lys Leu Thr Gly

210 215 220

Leu Ser Val Gln Gly Ala Arg Ile Ala Val Gln Gly Phe Gly Asn Val

225 230 235 240

Gly Gly Thr Ala Gly Lys Leu Phe Ala Asp Val Gly Ala Lys Val Val

245 250 255

Ala Val Gln Asp His Thr Gly Thr Ile His Asn Ala Asn Gly Leu Asp

260 265 270

Val Pro Ala Leu Leu Ala His Val Ala Ala Lys Gly Gly Val Gly Gly

275 280 285

Phe Asp Gly Ala Glu Ala Met Asp Ala Ala Asp Phe Trp Ser Val Asp

290 295 300

Cys Asp Ile Leu Ile Pro Ala Ala Leu Glu Gly Gln Ile Thr Lys Glu

305 310 315 320

Asn Ala Gly Lys Ile Lys Ala Lys Met Val Ile Glu Gly Ala Asn Gly

325 330 335

Pro Thr Thr Thr Glu Ala Asp Asp Ile Leu Thr Glu Lys Gly Val Leu

340 345 350

Val Leu Pro Asp Val Leu Ala Asn Ala Gly Gly Val Thr Val Ser Tyr

355 360 365

Phe Glu Trp Val Gln Asp Phe Ser Ser Phe Phe Trp Ser Glu Asp Glu

370 375 380

Ile Asn Ala Arg Leu Val Arg Ile Met Gln Asp Ala Phe Ala Ala Ile

385 390 395 400

Trp Gln Val Ala Gln Gln His Gly Val Thr Leu Arg Thr Ala Thr Phe

405 410 415

Ile Val Ala Cys Gln Arg Ile Leu His Ala Arg Glu Met Arg Gly Leu

420 425 430

Tyr Pro

<210> 6

<211> 1155

<212> DNA

<213> Microbotryum intermedium

<400> 6

atgtcgtcaa gcacttcatc cgacaagcaa gtcgtcgtca ttggtgctgg tgttattggc 60

ctcacgtcgg cgctcgttct cgcgcagtcg aaccacaacg tcaccctcgt cgctcgggat 120

ctcccctcgg atgtatcgtc ccaagcgttt gcctcacctt gggccggagc gaactggtgc 180

ccctttgtgg acccgcaaga atcggtcaag aacaagagga tctgcgactg ggagacgcag 240

tcgttcgcaa acttccagca actcataaga gaacacggcg atggcaaact cgtcatgagg 300

cttccggcga ggagatacgc cgagaacgaa aaagccctcc tggggcattg gtacaaatca 360

gtcgtgccta gatactcgac cttgccctcg tccgaggtcc ccaacaacgg cgtcggcgtc 420

gaattcgaga ccatctcggt taacgcgccg ctctactgcc aatggctcga ggctcaactc 480

ttgtctcaca acgccaccat catccgccgc tcgctcaact ccctcgacga ggccttgtcg 540

ctcgcacctt cttgctcggt catcgtcaac gccaccgggc tcggcgccaa atcactcgga 600

ggagtcgagg atcagacggt cacccccatc cgagggcaga ccgtcttgat caagaccgac 660

gtcaagctgt gcactatgga tgcgtcagac cccaccaaac cgtcctatat cattccgagg 720

ccagggggcg aggccgtttg tggtggttgc tacggcctcg gggaatggaa tctctccacc 780

gatacggaac tggccaagct gattctcgaa cgatgcctgg tgctcgaccc ccgcatctca 840

tccaatggtg cgcttgacgg catcgaagtg cttcgacaca atgtcgggct gcggccatca 900

cgaggcacga atgaacccag gctagaggcc gaacgagtcg tccttccttc ctattctttg 960

aaccctcatc gaaggcatgc gctcggtgca gagggcaacg ccgcgacggt cattcacgcc 1020

tacggggtcg ggccggcagg atatcaagtc agctgggggg tcgcgaacga ggtgaaagcg 1080

ctagtcgacg aacacttcgc caagtttgac actcgaacga cccaagacgg cgtccaccgg 1140

gacattaaac tctag 1155

<210> 7

<211> 1197

<212> DNA

<213> Lactobacillus buchneri

<400> 7

atgaccaaag ttctggccgt gctgtatccg gatccggtgg atggttttcc gccgaaatat 60

gttcgtgatg atattccgaa aatcacccat tatccggatg gcagtaccgt tccgaccccg 120

gaaggcattg attttaaacc gggtgaactg ctgggtagcg ttagtggcgg tctgggcctg 180

aaaaaatatc tggaaagtaa aggtgtggaa tttgttgtta ccagtgataa agaaggcccg 240

gatagtgtgt ttgaaaaaga actgccgacc gccgatgtgg ttattagtca gccgttttgg 300

ccggcctatc tgaccgcaga tctgattgat aaagcaaaaa agctgaaact ggcaattacc 360

gccggtattg gcagcgatca tgtggatctg aatgccgcca atgaacataa tattaccgtt 420

gcagaagtga cctatagcaa tagtgttagt gttgcagaag cagaagtgat gcagctgctg 480

gccctggtgc gtaattttat tccggcacat gatattgtga aagccggtgg ctggaatatt 540

gcagatgcag ttagccgtgc ctatgatctg gaaggtatga ccgttggtgt gattggtgca 600

ggccgcattg gtcgtgccgt tctggaacgt ctgaaaccgt ttggcgttaa actggtgtat 660

aatcagcgcc atcagctgcc ggatgaagtt gaaaatgaac tgggcctgac ctattttccg 720

gatgttcatg aaatggtgaa agttgtggat gccgttgttc tggcagcacc gctgcatgca 780

cagacctatc atctgtttaa tgatgaagtt ctggccacca tgaaacgtgg cgcctatatt 840

gtgaataata gccgcggcga agaagttgat cgcgatgcaa ttgttcgcgc actgaatagc 900

ggtcagattg gcggttatag tggcgatgtt tggtatccgc agccggcacc gaaagatcat 960

ccgtggcgta ccatgccgaa tgaagcaatg accccgcata tgagtggcac caccctgagt 1020

gcccaggcac gctatgccgc aggtgcacgt gaaattctgg aagattttct ggaagataaa 1080

ccgattcgtc cggaatatct gattgcccag ggtggtagtc tggccggtac cggtgccaaa 1140

agttataccg tgaaaaaagg cgaagaaacc ccgggtagcg gcgaagcaga aaaataa 1197

<210> 8

<211> 789

<212> DNA

<213> Exiguobacterium sibiricum

<400> 8

atgggttata attctctgaa aggcaaagtc gcgattgtta ctggtggtag catgggcatt 60

ggcgaagcga tcatccgtcg ctatgcagaa gaaggcatgc gcgttgttat caactatcgt 120

agccatccgg aggaagccaa aaagatcgcc gaagatatta aacaggcagg tggtgaagcc 180

ctgaccgtcc agggtgacgt ttctaaagag gaagacatga tcaacctggt gaaacagact 240

gttgatcact tcggtcagct ggacgtcttt gtgaacaacg ctggcgttga gatgccttct 300

ccgtcccacg aaatgtccct ggaagactgg cagaaagtga tcgatgttaa tctgacgggt 360

gcgttcctgg gcgctcgtga agctctgaaa tacttcgttg aacataacgt gaaaggcaac 420

attatcaata tgtctagcgt ccacgaaatc atcccgtggc ctactttcgt acattacgct 480

gcttctaagg gtggcgttaa actgatgacc cagactctgg ctatggaata tgcaccgaaa 540

ggtatccgca ttaacgctat cggtccaggc gcgatcaaca ctccaattaa tgcagaaaaa 600

ttcgaggatc cgaaacagcg tgcagacgtg gaaagcatga tcccgatggg caacatcggc 660

aagccagagg agatttccgc tgtcgcggca tggctggctt ctgacgaagc gtcttacgtt 720

accggcatca ccctgttcgc agatggtggc atgaccctgt acccgagctt tcaggctggc 780

cgtggttga 789

<210> 9

<211> 759

<212> DNA

<213> Lactobacillus brevis

<400> 9

atgagcaacc gtctggacgg caaggtggcg atcattaccg gtggcaccct gggtattggt 60

ctggcgattg cgaccaagtt cgtggaggaa ggtgcgaaag ttatgatcac cggccgtcac 120

agcgacgtgg gcgagaaggc ggcgaaaagc gttggcaccc cggaccagat tcaattcttt 180

cagcacgata gcagcgacga ggatggttgg accaagctgt tcgatgcgac cgaaaaagcg 240

tttggcccgg ttagcaccct ggttaacaac gcgggtattg cggtgaacaa gagcgttgag 300

gaaaccacca ccgcggagtg gcgtaaactg ctggcggtga acctggatgg tgttttcttt 360

ggcacccgtc tgggtatcca acgtatgaag aacaaaggtc tgggcgcgag catcattaac 420

atgagcagca ttgaaggttt cgttggtgac ccgagcctgg gtgcgtacaa cgcgagcaag 480

ggtgcggttc gtatcatgag caaaagcgcg gcgctggatt gcgcgctgaa ggactacgat 540

gtgcgtgtta acaccgtgca cccgggctat attaaaaccc cgctggttga cgatctgccg 600

ggtgcggagg aagcgatgag ccagcgtacc aagaccccga tgggtcacat cggcgaaccg 660

aacgacatcg cgtacatttg cgtttatctg gcgagcaacg agagcaaatt cgcgaccggt 720

agcgaatttg tggttgatgg tggctatacc gcgcaataa 759

<210> 10

<211> 1305

<212> DNA

<213> Delftia acidovorans

<400> 10

atgcagcaac ccgcttcggc cggcgttacc aaccacgcca tcccttccta cctgcaggcc 60

gatcacctcg gcccctgggg caactacctg cagcaggtcg atcgcgtcac gccctacctg 120

ggccatctcg cccgctgggt cgaaaccctc aagcgcccca agcgcatcct gatcgtcgat 180

gtgccgatcg agctggacaa cggcaccatc gcccactacg aaggctaccg cgtgcagcac 240

aacctgagcc gcggtcccgg caagggcggc gtgcgtttcc accaggacgt gaccctgtcc 300

gaagtcatgg ccctgtcggc ctggatgtcg gtcaagaacg cggccgtcaa cgtgccctat 360

ggtggcgcca agggcggcat ccgtgtcgat cccaagacgc tgtcgcgcgg tgagctggag 420

cgcctgacgc gccgctacac cagcgagatc ggcctgctga tcggcccctc caaggacatc 480

cccgcgcctg acgtcaacac caatggccag atcatggcct ggatgatgga cacgtactcc 540

atgaacaccg gcgccaccgc caccggcgtg gtcacgggca agcccgtgga cctgggcggc 600

tcgctgggcc gcgtcgaggc caccggccgc ggcgtgttca ccgtgggcgt ggaagcggcc 660

aagctgaccg gcctgtcggt ccagggcgcg cgcatcgccg tgcagggctt cggcaacgtg 720

ggcggcacgg cgggcaagct gttcgccgac gtgggcgcca aggtcgtggc cgtgcaggac 780

cacaccggca ccatccacaa cgccaatggc ctggacgtgc cggccctgct ggcccacgtg 840

gctgccaagg gcggcgtggg cggctttgac ggcgccgagg ccatggacgc tgccgacttc 900

tggagcgtgg actgcgacat cctgatcccc gccgcactgg aaggccagat caccaaggaa 960

aacgccggca agatcaaggc caagatggtg atcgagggcg ccaacggccc caccaccacc 1020

gaggccgacg acatcctgac cgaaaagggc gtgctggtgc tgcccgatgt gctggccaat 1080

gccggcggcg tgacggtgag ctacttcgaa tgggtgcagg acttctccag cttcttctgg 1140

agcgaggacg agatcaacgc ccgcctggtg cgcatcatgc aggacgcctt cgcggccatc 1200

tggcaggtcg cccagcagca cggcgtgacg ctgcgcaccg ccaccttcat cgtggcctgc 1260

cagcgcatcc tgcatgcgcg cgagatgcgg ggactgtatc cctga 1305

Claims (20)

1. A Glu/Leu/Phe/Val dehydrogenase mutant, wherein the amino acid sequence of the Glu/Leu/Phe/Val dehydrogenase mutant comprises a substitution of an amino acid residue corresponding to position 91 and/or 168 when aligned with the amino acid sequence of a Glu/Leu/Phe/Val dehydrogenase comprising the sequence shown in SEQ ID No.5, said positions 91 and 168 being defined with reference to SEQ ID No.5, and the amino acid sequence of the Glu/Leu/Phe/Val dehydrogenase mutant has at least 90% identity with the sequence shown in SEQ ID No. 5.

2. The Glu/Leu/Phe/Val dehydrogenase mutant according to claim 1, wherein the substitution of the amino acid residue at position 91 is V91I and the substitution of the amino acid residue at position 168 is N168G.

3. Glu/Leu/Phe/Val dehydrogenase mutant according to claim 1 or 2, which is derived from Delftia acidiovarans.

4. The Glu/Leu/Phe/Val dehydrogenase mutant according to any one of claims 1 to 3, which has an amino acid sequence which is at least 99% identical to the sequence shown in SEQ ID No. 5.

5. A nucleic acid comprising a sequence encoding a Glu/Leu/Phe/Val dehydrogenase mutant of any one of claims 1 to 4.

6. An expression vector comprising the nucleic acid of claim 5.

7. A recombinant host cell comprising the nucleic acid of claim 5 or the expression vector of claim 6.

8. The recombinant host cell of claim 7, wherein the host cell belongs to one of Saccharomyces cerevisiae (Saccharomyces cerevisiae), Yarrowia lipolytica (Yarrowia lipolytica), Candida krusei (Candida krusei), Issatchenkia orientalis (Issatchenkia orientalis), Actinomycetes (Actinomycetes), Streptomyces (Streptomyces), Bacillus subtilis (Bacillus subtilis), or Escherichia coli (Escherichia coli).

9. Use of the Glu/Leu/Phe/Val dehydrogenase mutant of any one of claims 1 to 4, the nucleic acid of claim 5, the expression vector of claim 6, or the recombinant host cell of any one of claims 7-8 for the production of L-glufosinate.

10. A method for the preparation of L-glufosinate, comprising converting 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid to L-glufosinate in the presence of an enzymatic catalytic system comprising the Glu/Leu/Phe/Val dehydrogenase mutant of any one of claims 1 to 4 for converting 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid to L-glufosinate.

11. The method of claim 10, wherein the enzymatic catalytic system further comprises a D-amino acid oxidase that converts D-glufosinate to 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid.

12. The method of claim 10 or 11, wherein the enzyme catalytic system further comprises a catalase.

13. The method of any one of claims 10 to 12, wherein the enzyme catalysis system further comprises a coenzyme circulation system selected from at least one of:

(1) formate dehydrogenase coenzyme circulation system: including formate dehydrogenase, formate and coenzymes;

(2) glucose dehydrogenase coenzyme circulation system: including glucose dehydrogenase, glucose and coenzymes;

(3) alcohol dehydrogenase coenzyme cycling system: including alcohol dehydrogenases, isopropanol and coenzymes.

14. The method of any one of claims 10 to 13, wherein the form of each enzyme in the enzymatic catalysis system is each independently selected from the group consisting of: free enzymes and recombinant host cells expressing enzymes.

15. The method of claim 14, wherein the recombinant host cells expressing enzymes are each independently selected from the group consisting of: saccharomyces cerevisiae (Saccharomyces cerevisiae), Yarrowia lipolytica (Yarrowia lipolytica), Candida drusei (Candida krusei), Issatchenkia orientalis, Actinomycetes (Actinomycetes), Streptomyces (Streptomyces), Bacillus subtilis (Bacillus subtilis), or Escherichia coli (Escherichia coli).

16. The method according to claim 14 or 15, wherein the total amount of the recombinant host cells added is 1 to 200g/L of the reaction solution, based on the wet cell weight.

17. The process according to any one of claims 10 to 16, wherein the conversion reaction is carried out in a reaction solution having a pH of 7-10, preferably the reaction solution is a reaction solution having a pH of 8-9.

18. The method according to any one of claims 10 to 17, wherein in the reductive amination reaction catalysed by the Glu/Leu/Phe/Val dehydrogenase mutant, the molar ratio of inorganic ammonium donor to substrate at the start of the reaction is from 1:1 to 10: 1.

19. The method according to any one of claims 10 to 18, wherein the Glu/Leu/Phe/Val dehydrogenase mutant catalyzes the oxidation reaction at a temperature of 25-45 ℃ for a period of 6-24 h.

20. The method according to any one of claims 10 to 19, wherein the reductive amination reaction catalysed by the Glu/Leu/Phe/Val dehydrogenase mutant is carried out in the presence of the coenzyme NADH, preferably at a molar ratio of NADH to substrate of 1:10 to 1: 5000.

Images