CN1714146A - Alanine 2,3,aminomutase - Google Patents

Abstract

Alanine 2,3-aminomutase sequences are disclosed, as are cells having alanine 2,3-aminomutase activity and methods of selecting for such cells. Methods for producing beta-alanine, pantothenate, 3-hydroxypropionic acid, as well as other organic compounds, are disclosed.

Description

L-Ala 2, the 3-aminomutase

The cross reference of related application

The application requires 60/375,785 right of priority of the U.S. Patent application 60/350,727 of on January 18th, 2002 application and application on April 25th, 2002.

Invention field

The present invention relates to L-Ala 2,3-aminomutase nucleic acid and aminoacid sequence, has the L-Ala 2 that α-Bing Ansuan can be converted into Beta-alanine, the active cell of 3-aminomutase, and the method for utilizing these cells produce Beta-alanines, pantothenic acid, 3-hydroxypropionate and other organic compound.

Background of invention

Organic chemistry goods such as organic acid, ester and polyvalent alcohol can be used for synthetic plastics material and other product.In order to satisfy to the ever-increasing demand of organic chemistry goods, people developing more effective and the utilization of saving cost based on carbohydrate and the raw-material production method of nonhydrocarbon.For example, some bacterium has been used to prepare a large amount of lactic acid that poly(lactic acid) is produced that is used for.

3-hydroxypropionate (3-HP) is an organic acid.People have described several chemosynthesis approach producing 3-HP, and also disclose biocatalysis approach people such as (WO 01/16346) Suthers.3-HP has and is used for specific synthetic purposes and can is commercially important intermediate product by the known technical transform of chemical industry, for example the vinylformic acid that forms through dehydration, the propanedioic acid through oxidation formation, warp carry out the ester that esterification forms with alcohol, and through 1 of reductive action formation, ammediol.

Summary of the invention

Can come biocatalysis to produce (Fig. 1) compound 3-hydroxypropionate (3-HP) from PEP or the pyruvic acid Beta-alanine intermediate product by key.Beta-alanine can be by 5 in cell; 6-dihydrouracil and N-carbamyl Beta-alanine, N-acetyl-Beta-alanine, anserine or aspartic acid synthesize (Fig. 1 and 2) from carnosine, β-alanyl arginine, β-alanyl Methionin, uridylic.Yet the poor efficiency that these approach are relative because they need rare precursor or the initial compounds more expensive than 3-HP.

Therefore, if α-Bing Ansuan can be converted into Beta-alanine, then utilizing the biocatalysis approach to produce 3-HP is more effective (Fig. 1).Regrettably, the enzyme that transforms α-Bing Ansuan and Beta-alanine is not mutually also identified.If identifying and transforming α-Bing Ansuan is for example L-Ala 2 of Beta-alanine, the enzymic activity of 3-aminomutase will be favourable.

Disclose 2 at this, 3-aminomutase nucleotide sequence (for example SEQ ID NOS:20 and 29), aminoacid sequence (for example SEQ ID NOS:21 and 30), and keep L-Ala 2, the active variant of 3-aminomutase, fragment, syzygy and multiformity.In an example, polypeptide is to comprise SEQ ID NO:21 or 30, or it keeps the sequence of the active variant of L- Ala 2,3 aminomutases, fragment or syzygy.In an example, this polypeptide is the Methionin 2 of sudden change, 3-aminomutase and/or Methionin 5, the aminoacid sequence of 6-aminomutase.Disclosed sequence can be used for transformant, so that this transformant has L-Ala 2, and 3-aminomutase activity, thus allow this cell to produce Beta-alanine by α-Bing Ansuan.The invention discloses specificity in conjunction with L-Ala 2, the wedding agent of 3-aminomutase.

The invention discloses and have L-Ala 2,3-aminomutase activity allows α-Bing Ansuan is converted into the cell of Beta-alanine.This cell can be eucaryon or prokaryotic cell prokaryocyte, for example yeast cell, vegetable cell, Bacterium lacticum (Lactobacillus), galactococcus (Lactococcus), bacillus (Bacillus) or escherich's bacillus (Escherichia) cell.In an example, this cell is with giving L-Ala 2, the active sudden change Methionin 2 of 3-aminomutase, and the Methionin 5 of 3-aminomutase and/or sudden change, the 6-aminomutase carries out cell transformed.In another example, cell transformed comprises the L-Ala 2 of SEQ ID NO:21 for example or 30,3-aminomutase.Cell disclosed in this invention can be used for producing nucleic acid molecule, polypeptide and organic compound.This polypeptide can be used for the formation of catalysis organic compound or can be used as antigen producing specific wedding agent.

The invention discloses and have at least a exogenous nucleic acid, the L-Ala 2 of for example encoding, the production cell of the nucleic acid of 3-aminomutase.In an example, this nucleotide sequence comprises SEQ ID NOS:20 or 29 (or it keeps L-Ala 2, the active fragment of 3-aminomutase, variant or syzygy).In another example, the aminoacid sequence shown in this nucleic acid sequence encoding SEQ ID NO:21 or 30 (or it keeps L-Ala 2, the active fragment of 3-aminomutase, variant or fusion rotein).The production cell can be used for expression and has enzymic activity; for example CoA transferase active, Beta-alanine ammonia lyase activity, 3-hydroxy propionyl group-CoA (3-HP-CoA) dehydratase activity, glutamate dehydrogenase, 3-hydroxy propionyl group-CoA lytic enzyme, alanine dehydrogenase, pyruvic acid-glutamate transaminase, and/or the polypeptide of 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities.In another example, produce cell and be used to express the polypeptide that has such as the enzymic activity of Beta-alanine-2-oxoglutarate transaminase and 3-HP desaturase and/or 3-hydroxy-isobutyrate dehydrogenase.The present invention also discloses the method for the polypeptide of producing above-mentioned nucleic acid sequence encoding.

The invention discloses a kind of evaluation and have L-Ala 2, the method for the active cell of 3-aminomutase.This method is included in the substratum that does not contain Beta-alanine or pantothenic acid, cultivates the cell of functional deficiency panD.For example, this cell can be produced α-Bing Ansuan by carbon, oxygen, hydrogen and the nitrogen in substratum source, but does not comprise Beta-alanine.The cell that evaluation can be grown in this substratum, wherein the cell growth shows that this cell produces Beta-alanine by α-Bing Ansuan, this shows that this cell has L-Ala 2,3-aminomutase activity.On the contrary, lack the cell growth and show that this cell can not produce Beta-alanine by α-Bing Ansuan, this shows that this cell does not have L-Ala 2,3-aminomutase activity.In an example, before the cell that cultivation is used to screen, with the Methionin 2 of one or more sudden change, 3-aminomutase and/or Methionin 5,6-aminomutase transformant.

The invention discloses to produce and have L-Ala 2, the method for the active polypeptide of 3-aminomutase.In an example, this method comprises cultivating to have at least a coding L-Ala 2, and the exogenous nucleic acid molecule of 3-aminomutase (for example SEQ ID NOS:20 and 29) can be produced the cell of Beta-alanine by α-Bing Ansuan.

The invention discloses several disclosed L-Ala 2 that have that utilize, the active cell of 3-aminomutase is produced the method for 3-HP by Beta-alanine.In an example, be converted into necessary one or more this cell of enzyme transfection of 3-HP with one or more by Beta-alanine.In another example, this method comprises from the cell purification Beta-alanine, then with Beta-alanine be converted into the necessary polypeptide of 3-HP by Beta-alanine and contact.

At this disclosed cell, L-Ala 2,3-aminomutase nucleic acid and aminoacid sequence (SEQ ID NOS:20 for example, 21,29 and 30) and method can be used for producing pantothenic acid, 3-HP and derivative thereof, for example coenzyme A (CoA) and other organic compound, for example 1, the co-polymer of ammediol, vinylformic acid, polymeric vinylformic acid, acrylic acid ester, polymeric 3-HP, 3-HP and other compound, for example butyric acid, valeric acid and other compound, the ester of 3-HP and propanedioic acid and ester thereof.3-HP biology and commercial all be important.For example, in the time can producing above-mentioned derivative, in nutraceutical industry, can use 3-HP as food, fodder additives or sanitas by 3-HP.

The nucleic acid molecule (for example SEQ ID NOS:20 and 29) of L- Ala 2,3 aminomutases of being used to encode can be used for engineered have produce 3-HP and such as the host cell of above-mentioned other organic compound.L-Ala 2, the peptide of 3-aminomutase (for example SEQ ID NOS:21 and 30) can be used for cell-free system with generation 3-HP and such as other above-mentioned organic compound.Cell described here can be used for culture system to produce a large amount of 3-HP and such as other above-mentioned organic compound.

One aspect of the present invention provides and has removed L-Ala 2, outside the 3-aminomutase activity, comprises other enzymic activity, such as CoA transferase active, β-alanyl-CoA ammonia lyase activity and 3-hydroxy propionyl group-active cell of CoA dehydratase.In addition, the invention discloses from the method for these cells produce products.In some instances, this cell also comprise the coding one or more have: one or more exogenous nucleic acid molecule of glutamate dehydrogenase activity, CoA transferase active, 3-hydroxy propionyl group-CoA lytic enzyme and/or 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities and alanine dehydrogenase or the active polypeptide of pyruvic acid-glutamate transaminase.In another example, this cell also comprises 4-aminobutyric acid and/or Beta-alanine-2-oxoglutarate transamination enzymic activity and 3-HP dehydrogenase activity and/or 3-Hydroxyisobutyrate dehydrogenase activity.In addition, this cell can comprise CoA hydrolytic enzyme activities, polyalcohols acid synthase activity and/or lipase or esterase activity.

In another example, comprise L-Ala 2,3-aminomutase activity; The CoA transferase active; β-alanyl-CoA ammonia lyase activity; Active and the active cell of 3-HP-CoA dehydratase of alanine dehydrogenase or pyruvic acid-glutamate transaminase is produced the ester of 3-HP for example and/or 3-HP, such as the product of 3-hydroxypropionate methyl esters, 3-hydroxypropionate ethyl ester, 3-hydroxypropionate propyl ester and/or 3-hydroxypropionate butyl ester.In some instances, this cell further comprises glutamate dehydrogenase activity, CoA transferase active, 3-hydroxy propionyl group-CoA lytic enzyme and/or 3-hydroxy-isobutyryl base-CoA hydrolytic enzyme activities.Correspondingly, the present invention also provides the method for producing one or more this class product.These methods are included in to cultivate under the condition that allows this product of production and comprise CoA transferase active, β-alanyl-CoA ammonia lyase activity, 3-HP-CoA dehydratase activity and comprise glutamate dehydrogenase activity, CoA transferase active, 3-hydroxy propionyl group-CoA lytic enzyme, 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities and/or alanine dehydrogenase or the active cell of pyruvic acid-glutamate transaminase in some instances.

Another aspect of the present invention provides to remove has L-Ala 2, outside the 3-aminomutase activity, has CoA transferase active, β-alanyl-CoA ammonia lyase activity, 3-hydroxy propionyl group-CoA dehydratase activity and the active cell of polyalcohols acid synthase.In some instances, these cells can comprise the coding one or more have: the exogenous nucleic acid molecule of CoA transferase active, β-alanyl-CoA ammonia lyase activity, 3-hydroxy propionyl group-CoA dehydratase activity, alanine dehydrogenase or pyruvic acid-glutamate transaminase activity and the active polypeptide of polyalcohols acid synthase.This cell can be used for, and for example, produces co-polymer and other compound such as polymeric 3-HP and 3-HP, such as the product of butyric ester, valerate and other compound.

In another example; this cell removes has L-Ala 2; outside the 3-aminomutase activity; have CoA transferase active, β-alanyl-CoA ammonia lyase activity, alanine dehydrogenase or pyruvic acid-glutamate transaminase activity and polyalcohols acid synthase activity, thereby can produce for example product of polymeric 3-HP.In some instances, these cells can comprise the coding one or more have CoA transferase active, β-alanyl-CoA ammonia lyase activity and/or active one or more exogenous nucleic acid molecule of polyalcohols acid synthase.

Another aspect of content of the present invention provides and has comprised L-Ala 2, the cell of 3-aminomutase activity, CoA transferase active, β-alanyl-CoA ammonia lyase activity, alanine dehydrogenase or pyruvic acid-glutamate transaminase activity and lipase or esterase activity.In an example, this cell also comprises the CoA hydrolytic enzyme activities.In some instances, this cell comprise the coding one or more have the exogenous nucleic acid molecule of the polypeptide of CoA transferase active, β-alanyl-coenzyme A ammonia lyase activity, lipase or esterase activity and/or CoA hydrolytic enzyme activities.This cell especially can be used for producing product such as acrylate (for example, methyl acrylate, ethyl propenoate, propyl acrylate and butyl acrylate).

The invention discloses and to produce 1, the cell of ammediol and the method for application thereof.1, ammediol can have the polypeptide of enzymic activity by utilization, is generated by 3-HP-CoA or 3-HP.When 3-HP-CoA is converted into 1; during ammediol; can use polypeptide with oxidoreductase activity or reductase activity; the polypeptide that for example has acetylize aldehyde: NAD (+) oxydo-reductase and alcohol: NAD (+) the oxidoreductase activity enzyme of the enzyme classification of 1.1.1.1 and/or 1.2.1.10 (for example, from).When preparing 1 from 3-HP, during ammediol, can use and (for example have the aldehyde dehydrogenase activity, enzyme from 1.2.1-classification) polypeptide and (for example have alcohol dehydrogenase activity, the composition of the polypeptide enzyme from the 1.1.1.-classification), for example aldehyde dehydrogenase (NAD (P)+) (EC 1.2.1.-) and ethanol dehydrogenase (EC 1.1.1.1).

In some instances, product is in external generation (in the extracellular).In other example, use the combination results product of (in cell) method in external and the body.In other example, product is to produce in the body.For relating to the method for step in the body, cell can be the cell or the whole organism of separation and Culture, such as transgenic plant, non-human mammal or unicellular organism, such as yeast and bacterium (for example, Bacterium lacticum, galactococcus, bacillus and escherich's bacillus cell).This hereinafter cell is called the production cell.Producing products that cells produce by these can be organic product, such as Beta-alanine, 3-HP, pantothenic acid and its derivative, and for example organic acid, polyvalent alcohol (promptly 1, ammediol), coenzyme A (CoA) and L-Ala described herein 2,3-aminomutase.

Pantothenic acid is a kind of a lot of growth of animal and healthy necessary VITAMIN, and it relates to the synthetic and degraded of lipid acid.The shortage of this VITAMIN causes the clinical discomfort of general.Therefore, use the pantothenic acid of producing in this disclosed method to deliver medicine to the experimenter that pantothenic acid lacks with the treatment significant quantity.Producing the cell of pantothenic acid and utilizing the cell of the disclosure is disclosed by the method that Beta-alanine produces pantothenic acid.The production cell that produces pantothenic acid and/or CoA can be used for express alpha-ketone pantothenic acid hydroxymethyl transferases (E.C.2.1.2.11); α-ketone pantothenic acid reductase enzyme (E.C.1.1.1.169) and pantothenic acid synthase (E.C.6.3.2.1) produce pantothenic acid, or express Pantothen kinase (E.C.2.7.1.33) in addition; 4 '-phosphoric acid hydroxyl pantoyl base-1-cysteine synthase (E.C.6.3.2.5); 4 '-phosphoric acid hydroxyl pantoyl base cysteic acid decarboxylase (E.C.4.1.1.36); ATP:4 '-phosphopantetheine adenosyl transferase (E.C.2.7.7.3) and dephosphorylation-CoA kinases (E.C.2.7.1.24) produces coenzyme A.

Brief description of the drawings

Fig. 1 is intermediate product generation 3-HP and the derivative thereof through Beta-alanine, and the diagram that is produced the approach of Beta-alanine by α-Bing Ansuan.

Fig. 2 is the diagram that is used to produce the approach of Beta-alanine.

Fig. 3 is the diagram that is used for being produced by Beta-alanine the approach of coenzyme A and pantothenic acid.

Fig. 4 is the Methionin 2 of subtilis wild-type, 3-aminomutase (KAM, SEQ ID NO:31) and coding L-Ala 2 thereof, the sequence contrast of the mutant form of 3-aminomutase (SEQ ID NO:21).Replacement shows with runic.Fe-S bunch-binding motif underlines, and the PLP-binding motif of inferring is an italic.

Fig. 5 is the Methionin 2 of porphyromonas gingivalis wild-type, 3-aminomutase (kam, SEQ ID NO:28) and coding L-Ala 2 thereof, the sequence contrast of the mutant form of 3-aminomutase (aam, SEQID NO:30).Replacement shows with runic.Fe-S bunch-binding motif underlines, and the PLP-binding motif of inferring is an italic.

Fig. 6 is the Methionin 2 of subtilis and porphyromonas gingivalis wild-type, 3-aminomutase (kam, SEQ ID NO:31 and 28), with and the coding L-Ala 2, the sequence contrast of the mutant form of 3-aminomutase (aam, SEQ ID NO:21 and 29).Replacement at same loci is represented with runic.

Sequence table

In the nucleic acid and aminoacid sequence of appended sequence table, represent nucleotide base with the abbreviation of standard letter, and represent amino acid with three character codes.The strand that only shows each nucleotide sequence, but be appreciated that be also included within by complementary strand any reference of shown chain in.

SEQ ID NOS:1 and 2 is used to clone subtilis Methionin 2, the PCR primer of 3-aminomutase (KAM) gene.

SEQ ID NO:3 is the nucleotide sequence of subtilis KAM gene.

SEQ ID NOS:4 and 5 is used to increase the PCR primer of CAT gene of pKD3.

SEQ ID NOS:6 and 7 is PCR primers of the insertion panD locus that is used to confirm that the CAT gene is correct.

SEQ ID NOS:8 and 9 is used to increase the nucleotide sequence of primer of CAT gene of pKD3.

SEQ ID NOS:10 and 11 is the subtilis Methionin 2 that is used in wild-type, produces the nucleotide sequence of the primer of L103M sudden change in the 3-aminomutase gene.

SEQ ID NOS:12 and 13 is the subtilis Methionin 2 that is used in wild-type, produces the nucleotide sequence of the primer of M136V sudden change in the 3-aminomutase gene.

SEQ ID NOS:14 and 15 is the subtilis Methionin 2 that is used in wild-type, produces the nucleotide sequence of the primer of D339H sudden change in the 3-aminomutase gene.

SEQ ID NOS:16-19,26,27 and 32 is the nucleotide sequences that are used for from the primer of Alcaligenes faecalis (Alcaligenes faecalis) M3A clone 3-HP dehydrogenase gene.

SEQ ID NO:20 is a L-Ala 2, the nucleotide sequence of 3-aminomutase DNA.

SEQ ID NO:21 is a L-Ala 2, the proteic aminoacid sequence of 3-aminomutase.

SEQ ID NO:22 is the nucleotide sequence of β-alanyl-CoA ammonia lyase (ACL-1) cDNA.

SEQ ID NO:23 is β-alanyl-proteic aminoacid sequence of CoA ammonia lyase (ACL-1).

SEQ ID NO:24 is the nucleotide sequence of CoA transferring enzyme cDNA.

SEQ ID NO:25 is the aminoacid sequence of CoA transferase protein.

SEQ ID NO:28 is the aminoacid sequence of porphyromonas gingivalis KAM.

SEQ ID NO:29 is a L-Ala 2, the nucleotide sequence of 3-aminomutase.

SEQ ID NO:30 is a L-Ala 2, the proteic aminoacid sequence of 3-aminomutase.

SEQ ID NO:31 is the aminoacid sequence of subtilis KAM.

SEQ ID NO:33 is the nucleotide sequence from the 3-HP dehydrogenase gene of Alcaligenes faecalis M3A.

SEQ ID NO:34 is the aminoacid sequence from the 3-HP dehydrogenase gene of Alcaligenes faecalis M3A.

SEQ ID NOS:35-37 is the nucleotide sequence that is used to clone the primer of Beta-alanine-CoA ammonia lyase (ACL-1 and ACL-2).

SEQ ID NOS:38-40 is the nucleotide sequence that is used for from the primer of escherichia coli cloning CoA transferring enzyme.

SEQ ID NOS:41-48 is the nucleotide sequence that is used to produce the primer of the operon 1 that comprises ACL-1 or ACL-2, CoA transferring enzyme and CoA hydratase gene and 2.

SEQ ID NOS:49-52 is the nucleotide sequence that is used to produce the primer of the operon 3 that comprises 4-Aminobutyrate aminotransferase and 3-hydroxy-isobutyrate dehydrogenase gene.

SEQ ID NO:53 is the nucleotide sequence of β-alanyl-CoA ammonia lyase (ACL-2) cDNA.

SEQ ID NO:54 is β-alanyl-proteic aminoacid sequence of CoA ammonia lyase (ACL-2).

SEQ ID NOS:55-56 is the nucleotide sequence that is used for from the primer of pATH-2-2-1 plasmid amplification ATH-2 operon.

SEQ ID NOS:57-58 is the nucleotide sequence that is used for from the primer of pATD plasmid amplification ATD operon.

SEQ ID NOS:59-60 is used to increase the nucleotide sequence of primer of subtilis L- Ala 2,3 aminomutases.

SEQ ID NOS:61-62 is used to increase the nucleotide sequence of primer of rat Beta-alanine aminotransferase gene.

SEQ ID NOS:63-64 is the nucleotide sequence that is used for from the primer of Alcaligenes faecalis amplification 3-HP desaturase.

SEQ ID NOS:65-66 is the nucleotide sequence that is used for from the primer of rat amplification α-Bing Ansuan aminotransferase gene.

The specific descriptions of several embodiments

Abbreviation and term

The explanation that following term and method are provided is to describe content of the present invention better and to instruct those of ordinary skill in the art to implement content of the present invention.Employed at this, comprise " mean that " one " or " one " or " being somebody's turn to do " of " comprising " and singulative comprises plural reference, unless context has clearly regulation in addition.For example, " comprising a kind of albumen " refers to comprise one or more this albumen, and " comprising this cell " refers to comprise one or more cell and well known to a person skilled in the art equivalent etc.

Unless explanation is arranged in addition, otherwise all technology and scientific terminology have the common same meaning of understanding as those skilled in the art as used herein.Although can be used for implementing or detecting content of the present invention to similar or equivalent method described herein and material, appropriate means and substance description are as follows.This material, method and embodiment are illustrative and not restrictive.Other characteristic of disclosed content and advantage are conspicuous in following detailed Description Of The Invention and claim.

L-Ala 2,3-aminomutase: the enzyme that can in cell for example, α-Bing Ansuan be converted into Beta-alanine.Comprise from for example procaryotic any L-Ala 2 of any organism, 3-aminomutase gene, cDNA or protein.In an example, L-Ala 2, the 3-aminomutase is to have L-Ala 2, the Methionin 2 of the active sudden change of 3-aminomutase, the Methionin 5 of 3-aminomutase or sudden change, 6-aminomutase: Methionin 2, (or note is a Methionin 2 to the 3-aminomutase in genetic database, the gene of 3 aminomutases) can be from any organism, prokaryotic organism for example, subtilis (Bacillus subtilis) for example, the abnormal cocci of anti-radiation the (Deinococcus radiodurans), clostridium subterminale (Clostridium subterminale), porphyromonas gingivalis (Porphyromonas gingivalis) or intestinal bacteria, and use any method known in the art to suddenly change to obtain.

In specific example, L-Ala 2,3-aminomutase nucleotide sequence comprise that the sequence or its maintenance coding that show in SEQ IDNOS:20 or 29 have L-Ala 2, fragment, variant or the syzygy of active peptide of 3-aminomutase or proteinic ability.In another example, L-Ala 2,3-aminomutase protein comprise aminoacid sequence or its maintenance L-Ala 2 that shows in SEQ ID NOS:21 or 30, the active fragment of 3-aminomutase, variant or syzygy.

In another example, L-Ala 2,3-aminomutase sequence comprises the wild-type sequence of total length, SEQ ID NO:21 or 30 and keep to transform α-Bing Ansuan be the short sequence of Beta-alanine ability for example, the amino acid 50-390 of SEQ ID NO:21 for example, the amino acid/11 01-339 of SEQ ID NO:21, the amino acid/11 5-340 of the amino acid/11 5-390 of SEQ ID NO:30 and SEQ ID NO 30.This specification sheets comprises L-Ala 2, and it is any variant, fragment or the fusion sequence of Beta-alanine ability that the allelic variant of 3-aminomutase and maintenance transform α-Bing Ansuan.

L-Ala 2,3-aminomutase activity: transforming α-Bing Ansuan is the L-Ala 2 of Beta-alanine, the ability of 3-aminomutase.In an example, this activity occurs in the cell.In another example, this activity occurs in external.This activity can use any method known in the art to measure, screening analysis of for example describing in embodiment 6 and 9-11 and enzyme activity determination method.In addition, have L-Ala 2, the active enzyme of 3-aminomutase can be by (for example using people's such as Abe method, J.Chromatography B with enzyme and α-Bing Ansuan or Beta-alanine incubation and by high performance liquid chromatography, 712:439,1998) determine that reaction product identifies.In an example, it is that the conversion α-Bing Ansuan is the L-Ala 2 of Beta-alanine in the intestinal bacteria of functional deficiency panD gene, the ability of 3-aminomutase.

Antibody: a kind of molecule that comprises specificity in conjunction with (immune response) antigenic antigen binding site.Example comprises polyclonal antibody, monoclonal antibody, human monoclonal antibodies or its immune significant part.

It comprises immunoglobulin molecules and immunocompetence part thereof.Spontaneous antibody (for example, IgG) comprises four polypeptide chains, by two weight (H) chains and two light (L) chains that connect in the disulfide linkage.Yet the antigen-combined function of antibody can be implemented by the fragment of naturally occurring antibody.The immune significant part of monoclonal antibody includes, but are not limited to: Fab, Fab ', F (ab ') ₂, Fabc and Fv part (referring to summary, Better and Horowitz, Enzymology method Methods.Enzymol.1989,178:476-96).Other example of Fab includes, but are not limited to: (i) the Fab fragment of being made up of VL, VH, CL and CH1 structural domain; The (ii) Fd fragment of forming by VH and CH1 structural domain; The (iii) Fv fragment of forming by the VL and the VH structural domain of antibody single armed; The (iv) dAb fragment of forming by the VH structural domain; (v) isolating complementarity determining region (CDR); (vi) F (ab ') ₂Fragment comprises the segmental divalence fragment of two Fab that connects hinge region by disulfide linkage.In addition, although segmental two structural domains of Fv are by the isolated genes coding, make them (be known as the strand Fv (scFv) that forms through recombination method as one protein chain can produce the synthetic joint.This single-chain antibody is also included.

" specificity in conjunction with " refers to the ability of particular agent (" specificity combinating reagent ") and specific analyte specific reaction, for example specifically with antibody mediated immunity reaction or the specific peptide sequence of specific combination.This combination is the nonrandom association reaction between for example antibody molecule and antigenic determinant.The binding specificity of antibody generally is decided by the reference point of antibody difference in conjunction with specific antigen and independent antigenic ability, and distinguishes two different antigens, the antigen that especially has two unique epi-positions thus.The antibody of specific combination defined epitope is considered to " specific antibody ".

Can produce L-Ala 2,3-aminomutase polypeptide (for example SEQ ID NO:21 and/or 30), L-Ala 2, the fragment of 3-aminomutase polypeptide (for example amino acid/11 5-331 of the amino acid/11 5-390 of the amino acid/11 01-339 of the amino acid 50-390 of SEQ ID NO:21, for example SEQ ID NO:21 or SEQ ID NO:30, for example SEQ ID NO:30) or its variant, the segmental mono-clonal of syzygy or polyclonal antibody.Best, the antibody at one or more epi-position on the polypeptide antigen will detect those polypeptides specifically.That is to say, will discern and can not discern basically or in conjunction with other polypeptide in conjunction with those specific polypeptide at the antibody of a specific polypeptide.Measuring antibodies specific ground is to come base by any in a large amount of standard immunoassay measuring methods in conjunction with specific polypeptide; For example, the Western trace (referring to, people (ed.) molecular cloning such as Sambrook for example: laboratory manual, second edition, vol.1-3, cold spring harbor laboratory publishes, and the cold spring port is approximately thin, and 1989).

In order to measure antibody preparation (for example at anti-L-Ala 2 by the Western trace, 3-aminomutase polypeptide, the preparation that produces in SEQ ID NO:21 or 30 the mouse for example) polypeptide that is fit to of specific detection (for example, L-Ala 2,3-aminomutase polypeptide), can separate from the total cell protein of cell extraction and by sds polyacrylamide gel electrophoresis.Isolating total cell protein matter can be transferred to film (for example, cellulose nitrate) subsequently, and with this film and antibody preparation incubation.After the washing film is removed the antibody of non-specific binding, the suitable second antibody that can use desmoenzyme (for example, anti--mouse antibodies) existence of detection specificity binding antibody, described enzyme is alkaline phosphatase for example, causes producing dense blueness-colored compound owing to use 5-bromo-4-chloro-3 indyl phosphoric acid salt/nitroblue tetrazolium (NBT)s by the immunolocalization alkaline phosphatase.

Obtaining to be suitable as immunogenic pure basically polypeptide from transfectional cell, transformant or wild-type cell can.The concentration of the polypeptide of final preparation can be by for example adjusting to the level of every milliliter of several micrograms on the Amicon filtration unit.In addition, from full-length polypeptide to having only 9 polypeptide in the amino-acid residue scope can be used as immunogen.This peptide species can produce in cell culture, and it is synthetic to use the standard method chemistry, and maybe can obtain by big polypeptide being cut into the little polypeptide that can be purified.When appearing at context major histocompatibility complex (MHC) molecule, in the time of for example in the immunity system of MHC class I or MHC class II molecule, the polypeptide that has only 9 amino-acid residue length can be immunogenic.Therefore, have at least 9,10,11,12,13,14,15,20,25,30,35,40,45,50,55,60,70,80,90,100,150,200,250,300,350,400,450,500,550,600,650,700,750,800,900,1000,1050,1100,1150,1200,1250,1300,1350 or the L-Ala 2 of more continuous amino acid residue, the polypeptide of 3-aminomutase polypeptide can be used as the immunogen of producing antibody.

Can prepare monoclonal antibody by the hybridoma of mouse according to the traditional method of Kohler and Milstein (natural Nature 256:495,1975) or its deutero-method at this disclosed any polypeptide.

Can prepare the polyclonal antiserum of the xenogenesis epitope antibodies that is included in this disclosed any polypeptide by the animal that is fit to this polypeptide (or its fragment, syzygy or variant) immunity, it can be unaltered or modifies for improving immunogenicity.Effectively the method for immunize rabbit can find in people such as Vaitukaitis (J.Clin.Endocrinol.Metab.33:988-91,1971).

Antibody fragment can replace complete antibody to use and can express at an easy rate in prokaryotic host cell.The method that the immune significant part of preparation and use monoclonal antibody is also referred to as " antibody fragment " is known, and comprise Better and Horowitz (Enzymology method (Methods Enzymol.) 178:476-96,1989), people such as Glockshuber (biological chemistry (Biochemistry) 29:1362-7,1990), U.S. Patent No. 5,648,237 (" the segmental expression of functional antibodies "), U.S. Patent No. 4,946,778 (" single polypeptide chain binding molecules "), U.S. Patent No. 5, method described in 455,030 (" use single chain polypeptide binding molecules ") and the reference wherein quoted.

Antigen: compound, composition or can stimulate antibody to produce in animal body or the material of T-cell response comprise animal such as injection or absorb the composition of administration.Comprise by heterogenous immunogen inductive antigen with the antigen of the product reaction of special body fluid or cellular immunization.Term " antigen " comprises the epitope that all are relevant.

CDNA (complementary DNA): the dna fragmentation that lacks non-encode fragment of intermediary (intron) and the decision adjusting sequence of transcribing.CDNA can synthesize from the messenger RNA(mRNA) that extracts in the cell by reverse transcription in the laboratory.

The conservative replacement: one or more aminoacid replacement of amino-acid residue (for example 1,2,5 or 10 residues) has similar biochemical property.Usually, the conservative replacement, have only slight influence or not influence to the activity of resulting polypeptide.For example, conservative replacement is at L-Ala 2, and it is the ability of Beta-alanine that the aminoacid replacement of 3-aminomutase peptide does not influence this peptide conversion α-Bing Ansuan basically.In specific example, conservative replacement is at L-Ala 2, the aminoacid replacement of 3-aminomutase peptide, and such as the conservative replacement in SEQ ID NO:21 or 30, it changes this protein conversion α-Bing Ansuan indistinctively is the ability of Beta-alanine.Can be used for measuring L-Ala 2, the active method of 3-aminomutase is disclosed (embodiment 6 and 9-11) at this.L-Ala scanning can be used for identifying L-Ala 2, and which amino-acid residue can allow aminoacid replacement in the 3-aminomutase peptide.In an example, when the conservative amino acid (for example following listed) of L-Ala or other is replaced by one or more natural amino acid, L-Ala 2, the active change of 3-aminomutase is no more than 25%, and for example no more than 20%, for example no more than 10%.

In an example, comprise conservative a replacement in the peptide, such as the conservative replacement in SEQ ID NO:21 or 30.In another example, comprise 10 or conservative replacement still less in the peptide, or still less such as 5.Polypeptide can produce by the nucleotide sequence that uses this polypeptide of site-directed mutagenesis for example or PCR standard method operation coding to comprise one or more conservative replacement.Selectively, can produce polypeptide by the method for peptide synthesis that uses standard makes it comprise one or more conservative replacement.

In the variant that replaces at least a residue of aminoacid sequence be removed and inserted different residues in its position.Can replace original amino acid in the protein and be considered to the conservative amino acid whose example that replaces and comprise: Ser replaces Ala; Lys replaces Arg; Gln or His replace Asn; Glu replaces Asp; Ser replaces Cys; Asn replaces Gln; Asp replaces Glu; Pro replaces Gly; Asn or Gln replace His; Leu or Val replace Ile; Ile or Val replace Leu; Arg or Gln replace Lys; Leu or Ile replace Met; Met, Leu or Tyr replace Phe; Thr replaces Ser; Ser replaces Thr; Tyr replaces Trp; Trp or Phe replace Tyr; And Ile or Leu replacement Val.

Can find in other position about the conservative further information that replaces, people such as Ben-Bassat (J.Bacteriol.169:751-7,1987), people such as O ' Regan (Gene 77:237-51,1989), people such as Sahin-Toth (Protein Sci.3:240-7,1994), people such as Hochuli (Bio/Technology6:1321-5,1988), WO00/67796 (people such as Curd) and at genetics and molecular biological standard textbook.

Disappearance: nucleic acid is the removal of the sequence of DNA for example, and the zone of both sides is linked together.

Detectable: as can to determine to exist or occur.For example, if the signal that produces by Beta-alanine by force to enough can be measured, the production from the α-Bing Ansuan to the Beta-alanine is exactly detectable.

DNA: thymus nucleic acid.DNA is the long chain polymer (some viruses have the gene that comprises Yeast Nucleic Acid, RNA) that comprises the genetic material of most organisms.Repeating unit in the DNA polymkeric substance is 4 kinds of different Nucleotide, and each comprises in 4 bases one, is incorporated into VITAMIN B4, guanine, cytosine(Cyt) and the thymus pyrimidine of the dezyribonucleoside sugar of subsidiary phosphate.The Nucleotide of triplet is considered to codon, and the password of dna molecular is corresponding to the amino acid of polypeptide.The term codon also is used in reference to corresponding (and complementary) sequence that dna sequence dna is transcribed into 3 Nucleotide among the mRNA.

External source: any nucleic acid that refers to not be to derive from the specific cells that obtains at occurring in nature at this employed term " external source " about nucleic acid and specific cells.Therefore, in a single day the non-natural nucleic acid that exists be introduced into cell and just be considered to external source with respect to this cell.Naturally occurring nucleic acid can be external source with respect to specific cells also.For example, in case separate the cell that is introduced into people Y from this karyomit(e) of whole karyomit(e)s of the cell of people X, be exactly the nucleic acid of external source with respect to the cell of Y.

Functional deficiency: sudden change, part or lack completely, insert or other variation makes gene order suppress the generation of this gene product, and/or make this gene product not have function.For example, the prevention of the functional deficiency of panD produces Beta-alanine by the aspartate decarboxylase by the panD genes encoding by aspartic acid in the intestinal bacteria.Thereby this functional deficiency of panD makes the aspartate decarboxylase inactivation cause the growth of intestinal bacteria in the growth medium that lacks Beta-alanine or pantothenic acid to be suppressed in the intestinal bacteria.

Function equivalent: have equal function.In context, L-Ala 2, the function equivalent molecule of 3-aminomutase molecule comprise maintenance L-Ala 2, the differing molecular of 3-aminomutase function.For example, function equivalent can pass through L-Ala 2, and the sequence variation in the 3-aminomutase provides, and the peptide that wherein has one or more sequence variation keeps the function of unaltered peptide, so it keeps α-Bing Ansuan is converted into the ability of Beta-alanine.

The example of sequence variation includes but not limited to, conservative replacement, disappearance, sudden change, frameshit and insertion.In an example, given polypeptide binding antibody, and functional equivalent is the polypeptide in conjunction with same antibody.Therefore functional equivalent comprises equally with polypeptide having the specific peptide of identical combination, and can be used as the reagent (for example in the production of pantothenic acid and 3-HP) that replaces this polypeptide.Functional equivalent comprises that binding sequence is discontinuous in an example, wherein the polypeptide of antibodies linear epitope.Therefore, if peptide sequence is MKNKWYKPKR (amino acid/11 of SEQIDNO:21-10), functional equivalent comprises discontinuous epi-position, can show as ( ^*The insertion amino acid of=any number): NH ₂- ^*-M ^*K ^*N ^*K ^*W ^*Y ^*K ^*P ^*K ^*R-COOH.In this example, if the three-dimensional structure of polypeptide is and the amino acid/11 that combines SEQIDNO:21-10 monoclonal antibody bonded the amino acid/11 of this polypeptide and SEQIDNO:21-the 10th then, function equivalent.

Hybridization: form bimolecular ability according to complementary single stranded DNA and/or RNA, detect the method for the nucleotide sequence complementarity of two kinds of nucleic acid molecule.Can use nucleic acid hybridization technique to obtain isolating nucleic acid of the present invention.In brief, have and L-Ala 2, some homologys of 3-aminomutase (for example with SEQIDNOS:20 and 29 or its variant or segmental homology) any nucleic acid can be used as probe, by medium to the rigorous condition of height hybridization identify similar nucleic acid.In a single day this nucleic acid is identified, can be purified subsequently, check order and analyze to determine whether it is to have L-Ala 2, the active L-Ala 2 of 3-aminomutase, 3-aminomutase.

Hybridization can be analyzed by Southern or Northern and carry out to identify DNA or the RNA sequence with probe hybridization respectively.This probe can be labeled, and for example uses vitamin H, fluorophore, digoxin, enzyme or the radio isotope of 32P for example.DNA to be analyzed or RNA can be on agarose or polyacrylamide gel electrophoretic separation, transfer on nitrocotton, nylon or other the suitable film, and use standard technique well known in the art and probe hybridization, those technology are at people such as Sambrook (1989) molecular cloning, second edition, cold spring harbor laboratory, Plainview has description in the 7.39-7.52 part in New York.Usually, probe length is about at least 20 Nucleotide.For example, can use to comprise L-Ala 2, the probe of the Nucleotide of 20 vicinities of 3-aminomutase (for example Nucleotide of SEQ ID NO:20 or 20 vicinities of 29) is identified identical or similar nucleic acid.In addition, can use than 20 probes that Nucleotide is longer or shorter.

The present invention also provides the isolated nucleic acid sequences (for example, about at least 13,14,15 of about at least 12 base length, 16,17,18,19,20,25,30,40,50,60,100,250,500,750,1000,1400,2000,3000,4000 or 5000 base length) with L-Ala 2,3-aminomutase nucleotide sequence is SEQ ID NO:20 or 29 justice or antisense strand hybridization for example and under hybridization conditions.Hybridization conditions can be medium or highly rigorous hybridization conditions.

Medium rigorous hybridization conditions is in about 42 ℃, is comprising 25mM KPO ₄(pH7.4), salmon sperm dna, 50% methane amide, 10% dextran sulfate and the 1-15ng/ml probe (about 5 * 10 of 5 * SSC, 5 * Denhart ' s solution, 50 μ g/ml sex change, supersound process ⁷, cpm/ μ g) hybridization solution in hybridize, wash with the washing lotion that comprises 2 * SSC and 0.1% sodium lauryl sulphate simultaneously at about 50 ℃.

Highly rigorous hybridization conditions is in about 42 ℃, is comprising 25mM KPO ₄(pH7.4), salmon sperm dna, 50% methane amide, 10% dextran sulfate and the 1-15ng/ml probe (about 5 * 10 of 5 * SSC, 5 * Denhart ' s solution, 50 μ g/ml sex change, supersound process ⁷, cpm/ μ g) hybridization solution in hybridize, wash with the washing lotion that comprises 0.2 * SSC and 0.1% sodium lauryl sulphate simultaneously at about 65 ℃.

Isolating: " isolating " biotic component (for example nucleic acid molecule or protein) separates certainly or purifying other biotic component in biological cell substantially, this composition wherein, promptly other karyomit(e) and extrachromosomal DNA, RNA and protein are naturally occurring." isolating " nucleic acid and protein comprise nucleic acid and the protein by the purification process purifying of standard.This term also comprises by at the recombinant expressed nucleic acid of host cell and nucleic acid, protein and the peptide of protein and chemosynthesis.

In an example, the nucleic acid of the natural generation of isolating finger its not with its available from link to each other the continuously sequence of (side is at 5 ' end, and opposite side is at 3 ' end) of naturally occurring biological gene group link to each other continuously.For example, isolating nucleic acid can be but be not limited to, the recombinant DNA molecules of any length, and the nucleotide sequence of the both sides of common discovery next-door neighbour recombinant DNA molecules is removed or lacks in naturally occurring genome.Therefore, isolating nucleic acid includes but not limited to, (for example be independent of recombinant DNA that other sequence exists as isolating molecule, cDNA or genomic DNA fragment by PCR or restriction endonuclease processing), and the plasmid, virus that are incorporated into carrier, self-replicating are (for example, retrovirus, adenovirus or simplexvirus) in, or be incorporated into recombinant DNA in prokaryotic organism or the Eukaryotic genomic dna.In addition, isolating nucleic acid can comprise the recombinant DNA molecules of hybridization or integrative nucleic acid sequence part.

In an example, also comprise the nucleic acid that any non-natural exists, because the nucleotide sequence that non-natural exists does not have to find and do not have next-door neighbour's sequence at occurring in nature in naturally occurring genome about the employed term of nucleic acid " isolating ".For example, the nucleic acid that non-natural exists is considered to isolating nucleic acid as the nucleic acid of through engineering approaches.The nucleic acid of through engineering approaches can use conventional molecular cloning or chemical nucleic acid synthetic technology to produce.The nucleic acid that isolating non-natural exists can be independent of other sequence, or is incorporated into carrier, autonomously replicating plasmid, virus (for example, retrovirus, adenovirus or simplexvirus), or in prokaryotic organism or the Eukaryotic genomic dna.In addition, the nucleic acid of isolating non-natural existence can comprise the recombinant DNA molecules of the nucleotide sequence part of hybridization or fusion.

Leucine 2, the 3-aminomutase: can transform alpha-aminoisocaproic acid is β-leucic enzyme.Comprise any leucine 2 from any organism, 3-aminomutase gene, cDNA, RNA or protein, such as from prokaryotic organism or eukaryote, for example from rat, people, chicken or clostridium sporogenes (Clostridium sporogenes) (Poston, J.Biol.Chem.251:1859-63,1976).This specification sheets comprises leucine 2, the allelic variant of 3-aminomutase, and maintenance conversion alpha-aminoisocaproic acid is any variant, fragment or the fusion rotein of β-leucic ability.

Methionin 2,3-aminomutase: can transform the enzyme that α-Methionin is beta-lysine.Comprise any Methionin 2 from any organism, 3-aminomutase gene, cDNA, RNA or protein, for example from prokaryotic organism, for example subtilis, the abnormal cocci of anti-radiation the, clostridium subterminale, porphyromonas gingivalis, Alcaligenes faecalis, hemophilus influenzae (Haemophilusinfluenzae) or intestinal bacteria.This specification sheets comprises Methionin 2, the allelic variant of 3-aminomutase, and maintenance conversion α-Methionin is any variant, fragment or the fusion sequence of the ability of beta-lysine.In an example, comprise by in common dna sequence data storehouse, such as being labeled as Methionin 2 among the GenBank, the polypeptide of the genes encoding of 3-aminomutase.

Nucleic acid: comprise RNA and DNA, include but not limited to, cDNA, genomic dna and synthetic (for example, chemosynthesis) DNA.This nucleic acid can be two strands or strand.Wherein the nucleic acid of strand can be sense strand or antisense strand.In addition, nucleic acid can be cyclic or linearity.

Oligonucleotide: the linear polynucleotide of at least 9 Nucleotide (for example DNA or RNA) sequence, for example at least 15,18,24,25,27,30,50,100 or even 200 length of nucleotides.

Be operably connected: when first nucleotide sequence was in the functional relationship with second nucleotide sequence, first nucleotide sequence was operably connected with second nucleotide sequence.For example, if promotor influences transcribing or expressing of encoding sequence, then promotor is operably connected with encoding sequence.Usually, the dna sequence dna that is operably connected is adjacency and two protein coding zones that connect in the identical reading frame are essential.

ORF (open reading frame): the nucleotide triplet of the coded amino acid of a series of no any terminator codon (codon).These sequences can be translated into peptide usually.

Pantothenate or pantothenic acid: the commercially important VITAMIN that is used for makeup, medicine and nutritious prod.Be used interchangeably at this term pantothenic acid and pantothenate, and not only refer to free acid but also refer to the salt of D-pantothenic acid, for example calcium salt, sodium salt, ammonium salt or sylvite.Pantothenate can use at this disclosed cell and method and be produced by Beta-alanine by chemosynthesis or biotechnology.

The method of measuring the amount of pantothenate is known (for example referring to people such as people's such as Rieping U.S. Patent No. 6,184,006 and Eggeling U.S. Patent No. 6,177,264).For example, the quantitative assay of D-pantothenate can be by using plant lactobacillus (Lactobacillus plantarum) (test strain: plant lactobacillus ATCC 8014, catalog number 3211-30-3; Substratum: Bacto pantothenate analysis substratum (laboratory, Michigan, the U.S.), catalog number 0604-15-3) the pantothenate analysis is carried out.Just grow when only there is pantothenate in this indicator strain in indicator medium and show measurable, the linear growth of luminosity that depends on pantothenate concentration in the substratum.Can use the half calcium salt calibration (Sigma catalog number P2250) of pantothenate.Optical density(OD) can be determined at the wavelength of 580nm.

The modification of peptide: the present invention includes L-Ala 2,3-aminomutase peptide and synthetic embodiment.In addition, analogue (organic molecule of non-peptide), derivative (peptide of the chemistry functional that begins to obtain from disclosed peptide sequence) and have L-Ala 2, the active variant of 3-aminomutase (homologue) can be used in the method described herein.Comprise it to be the aminoacid sequence of naturally occurring L-and/or D-amino acid etc. at this disclosed peptide.

Can come modified peptides by the number of chemical technology, have active in essence identically with generation, and have the derivative of other desired characteristic arbitrarily with the peptide of unmodified.For example, no matter proteinic carboxyl is C-terminal or side chain, can pharmacology on the form of salt of acceptable positively charged ion or esterification provide, forming the ester of C1-C6, or to be converted into general formula be NR ₁R ₂Amide, R wherein ₁And R ₂Be respectively H or C ₁-C ₁₆Alkyl, or in conjunction with the heterocycle that forms such as 5-or 6-unit ring.No matter the amino of peptide is N-terminal or side chain, can be the additive salt of acceptable acid on the pharmacology, and the form such as HCl, HBr, acetate, phenylformic acid, sulfonation toluene, toxilic acid, tartaric and other organic salt maybe can be modified to C ₁-C ₁₆Alkyl or dialkyl amido or further be converted into amide.

The hydroxyl of peptide side chain can use technique known to be converted into C ₁-C ₁₆Alkoxyl group or C ₁-C ₁₆Ester.Available one or more halogen atom of the phenyl of peptide side chain and phenol ring such as F, Cl, Br or I, or is used C ₁-C ₁₆Alkyl, C ₁-C ₆Alkoxyl group, carboxylic acid and ester thereof, or the amide of this carboxylic acid is replaced.The methylene radical of peptide side chain may extend to homologous C ₂-C ₄Alkene.Mercaptan can be protected with many known protecting groups such as in the ethanamide group any one.Those skilled in the art will recognize that also the method that is used for ring texture is imported disclosed peptide is to select and the conformation restriction of structure is provided and causes the increase of stability.For example, the halfcystine of C-or N-end can be added peptide, make when this peptide of oxidation, will comprise the disulfide linkage that produces cyclic peptide.Other method of peptide cyclisation comprises formation thioether and carboxyl and aminoterminal amide and ester.

The embodiment of polypeptide stand-in and organic stand-in also within the scope of the invention, so this peptide-and the three-dimensional structure imitation peptide main chain of organic stand-in chemical ingredients and the three-dimensional structure of amino acid side chain composition, produced the detectable L-Ala 2 that has of the present invention, the active proteinic polypeptide of 3-aminomutase-and organic stand-in.For computer model is used, pharmacophoric group is three dimension definitions of idealizing that are used for bioactive structural requirement.Peptide-and organic stand-in can be next in suitable various pharmacophoric groups by present computer simulation software (auxiliary medicinal design or CADD use a computer) design.Referring to Walters, " the area of computer aided model of medicine ", Klegerman and Groves eds., 1993, Pharmaceutical Biotechnology, Interpharm Press:Buffalo Grove, IL pp.165-174 and Principles of Pharmacology, Munson (ed.) 1995, Ch.102 is used for the technical specification of CADD.Use the stand-in of this technology preparation to be also included within the scope of the present invention.In an example, by L-Ala 2,3-aminomutase or its variant, fragment or syzygy produce simulation L-Ala 2, the active stand-in of 3-aminomutase.

Polynucleotide: the linear nucleic acid sequence of random length.Therefore, polynucleotide comprise the nucleic acid molecule of about at least 15,25,50,75,100,200 or 400 (oligonucleotide) and full-length cDNA.

Probe and primer: " probe " comprises the isolating nucleic acid that contains detectable mark or reporter molecules.Typical mark comprises radio isotope, part, chemoluminescence agent, fluorophore and enzyme.The method that is used for mark and instruct selects to be suitable for multiple purpose mark is for example, people such as Sambrook (ed.), molecular cloning: laboratory manual 2nd ed., press of vol.1-3 cold spring harbor laboratory, cold spring port, New York, 1989 and people (ed.) Current Protocols in Molecular Biology such as Ausubel, Greene Piblishing and Wiley-Interscience, there is discussion in New York (regular update) in 1987.

" primer " generally is the nucleic acid molecule with 10 above Nucleotide (for example, have between about 10 Nucleotide and about 100 Nucleotide nucleic acid molecule).Primer can be annealed into the complementary target nucleic acid chain by nucleic acid hybridization and form hybrid between primer and the target nucleic acid chain, and extends along target nucleic acid chain by for example archaeal dna polymerase subsequently.Can use primer to amplifying nucleic acid sequence, for example by polymerase chain reaction (PCR) or other nucleic acid amplification method.

Be used to prepare and use the method for probe and primer for example to be described in, with reference to as people such as Sambrook (ed.), molecular cloning: laboratory manual, second edition, vol.1-3, press of cold spring harbor laboratory, cold spring port, New York, 1989; People such as Ausubel (ed.)), Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York (regular update), 1987; With people such as Innis, PCR Protocols:A Guideto Methods and Applications, press of institute: San Diego, 1990.The PCR primer be to deriving from known array, for example, by for example use the computer program of primer Primer (version 0.5, _ 1991, Whitehead Institute for Biomedical Research, Cambridge Mass.) is designed according to purpose.The specificity that those skilled in the art may appreciate that particular probe or primer increases with length, but probe or primer be at full length sequence in the magnitude range that is as short as 5 successive nucleotide sequences.Therefore for example, the primer annealing of 20 continuous nucleotides for target, has higher specificity than the corresponding primer that has only 15 Nucleotide.Therefore, in order to obtain bigger specificity, selectable probe and primer comprise, for example, and 25,30,35,40,50,60,70,80,90,100,150,200,250,300,350,400,450,500,550,600,650,700,750,800,850,900,950,1000,1050,1100,1150,1200,1250,1300,1350,1400,1450,1500 or more successive Nucleotide.

Promotor: the nucleic acid regulating and controlling sequence of a series of mediation transcribed nucleic acids.Promotor comprises the essential nucleotide sequence of contiguous transcription initiation site, for example, and with regard to the TATA element of polymerase II type promotor.Promotor also optionally comprises and is positioned at from the enhanser of the far-end of the thousands of bases of transcription initiation site as many as or checks element.

Purifying: the term purifying do not require absolute purity; More precisely, it means relative term.Therefore, for example, the peptide formulations of purifying be wherein peptide or protein than peptide in the cell interior environment or more enrichment of protein, so this peptide is isolating with the cellular component that may follow with it (nucleic acid, lipid, carbohydrate and other polypeptide) basically.In another example, the peptide formulations of purifying is that wherein peptide is not contaminated basically, such as providing according to the chemosynthesis of peptide.

In an example, when at least 50% of example weight is made up of peptide, for example at least 60% of sample, 70%, 80%, 85%, 90%, 92%, 95%, 98% or 99% or more when forming by peptide, L-Ala 2,3-aminomutase peptide is a purifying.Can be used for the method example of purifying antigen, include but not limited to, the disclosed method of people such as Sambrook.(molecular cloning: laboratory manual, the cold spring port, New York, 1989, Ch.17).The determining and can pass through of lipidated protein, for example, the polyacrylamide gel electrophoresis of protein example shows the band of single polypeptide then by this polyacrylamide gel that dyes; High pressure lipuid chromatography (HPLC); Order-checking; Or other ordinary method.

Reorganization: recombinant nucleic acid is a kind of independent fragments sequence that has the sequence of non-natural existence and/or pass through two other sequences of artificial combination.This artificial combination thing synthesizes by chemistry usually or more generally by the separate part of manual operation nucleic acid, for example finishes by gene engineering.Also use reorganization to describe, but comprise the adjusting sequence identical and the nucleic acid molecule of coding region with the sequence of in the separated organism of this nucleic acid, finding by manual operation.

Identity/the similarity of sequence: two or more nucleotide sequences, or the identity/similarity between two or more aminoacid sequences are to represent with identity between the sequence or similarity.The identity of sequence can be measured by identity percentage ratio; Per-cent is high more, and sequence is then identical more.The similarity of sequence can be measured (having considered conservative aminoacid replacement) by similarity percentage ratio; Per-cent is high more, and sequence is then similar more.When using standard method to carry out sequence alignment, the homologue of nucleic acid or aminoacid sequence or positive analogue have the sequence identity/similarity of relative height.When just similarly protein or cDNAs stemmed from the nearer kind of relation (for example, the sequence of people and mouse), the kind (for example, people and C.elegans sequence) farther with being derived from relation compared, and this homology is more significant.

The method that is used for the comparison of comparative sequences is well known in the art.The arthmetic statement of multiple program and sequence alignment is in Smith and Waterman, Adv.Appl.Math.2:482,1981; Needleman and Wunsch, molecular biology magazine J.Mol.Biol.48:443,1970; Pearson and Lipman, Proc.Natl.Acad.Sci.USA.85:2444,1988; Higgins and Sharp, Gene, 73:237-44,1988; Higgins and Sharp, CABIOS5:151-3,1989; People such as Corpet, Nuc.Acid Res.16:10881-90,1988; People such as Huang, Computer Appls.in the Biosciences8,155-65,1992; With people such as Pearson, Meth.Mol.Bio.24:307-31, people such as 1994.Altschul, J.Mol.Biol.Biol.215:403-10,1990, the concrete consideration item that provides sequence alignment method and homology to calculate.

NCBIBasicLocal Alignment Search Tool (BLAST) (people such as Altschul, molecular biology magazine J.Mol.Bioi.215:403-10,1990) can obtain from several sources, comprise the national bioinformation center (National Library of NCBI medicine, the 38A building, 8N805 chamber, Bethesda, MD 20894) and on Internet, be used for program blastp, blastn, blastx, tblastn and the tblastx of sequential analysis.Out of Memory can find on the NCBI network address.

Use relatively nucleotide sequence of BLASTN, use BLASTP comparing amino acid sequence simultaneously.For two nucleotide sequences relatively, the file that option :-i is set to comprise first nucleotide sequence to be compared (for example, C: seq1.txt) can followingly be set;-j is set to comprise the file (for example, C: seq2.txt) of second nucleotide sequence to be compared;-p is set to blastn;-o is set to any required filename (for example, C: output.txt);-q is set to-1;-r is set to 2; And other option keeps its default value.For example, can use following order to produce the output file that comprises two comparisons between sequence: C: B12seq-i c: seq1.txt-j c: seq2.txt-p blastn-o c: output.txt-q-1-r 2.

For two aminoacid sequences relatively, the file that option B12seq:-i is set to comprise first aminoacid sequence to be compared (for example, C: seq1.txt) can followingly be set;-j is set to comprise the file (for example, C: seq2.txt) of second aminoacid sequence to be compared;-p is set to blastp;-o is set to any required filename (for example, C: output.txt); And other option keeps its default value.For example, can use following order to produce the output file that comprises two comparisons between aminoacid sequence: C: B12seq-ic: seq1.txtjc: seq2.txt-p blastp-o c: output.txt.If the sequence of two comparisons has homology, this specified output file will provide the zone of homology as the sequence of arranging then.If the sequence of two comparisons does not have homology, this specified output file will can not provide the sequence alignment of arrangement then.

In case comparison, the number of coupling is determined by calculating the number that identical Nucleotide or amino-acid residue come across position in two sequences.The percentage ratio of sequence identity by the coupling number divided by identifying the sequence length of illustrating in the sequence, or (for example divided by bonding length, come own 100 the successive Nucleotide or the amino-acid residue of illustrating in the sequence of identifying), then end value be multiply by 100 definite.For example, when having the nucleotide sequence of 1166 couplings, then have identity (that is 1166 ÷ 1554 * 100=75.0), of 75.0 percentage ratios with sequence to be measured with sequence contrast to be measured with 1154 Nucleotide.The percentage ratio of sequence identity value is rounded near 1/10th.For example, 75.11,75.12,75.13 and 75.14 round up reduces to 75.1,75.15,75.16,75.17,75.18 and 75.19 is rounded to 75.2 simultaneously.Length value is integer always.In another example, target sequence comprises and the zone of coming 20 Nucleotide of 20 successive Nucleotide arrangements of the own sequence of identifying, the following zone that comprises the sequence identity of sequence 75 percentage ratios that have and identified (that is 15-20 * 100=75).

Greater than about 30 amino acid whose aminoacid sequences, use the function of Blast 2 sequences for relatively, utilize the default BLOSUM62 matrix that is set to default parameter, (breach existence value is 11, and each residue breach value is 1).Usually with contrast sequence, use NCBI Basic Blast 2.0, use breach blastp such as nr or swissprot database to calculate to have at least 70% sequence identity to characterize homology full length amino acid sequence.The query search that is undertaken by the blastn program filters (Hancock and Armstrong, 1994, the bio-science application Comput.Appl.Biosci.10:67-70 of computer) with DUST.Other program is used SEG.In addition, can carry out manual sequence alignment.When by this method assessment, the protein with bigger similarity may show the identity percentage ratio of increase, the sequence identity such as at least 75%, 80%, 85%, 90%, 95% or 99%.

When comparing short peptide when (being less than about 30 amino acid), use Blast 2 functional nucleotide sequences than correspondence, utilize the PAM30 matrix (open breach 9, extension breach point penalty 1) that is set to default parameter to carry out.When by the assessment of this method, the protein with bigger similarity may show the identity percentage ratio of increase, the sequence identity such as at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% for reference sequences.When relatively less than the sequence identity of full sequence, homology may generally have at least 75% sequence identity for 10-20 amino acid whose zone, and can have at least 85%, 90%, 95% or 98% sequence identity for the identity of reference sequences according to them.The method that is used for the sequence identity in definite this short zone has description on the NCBI network address.

Two kinds of tight indications of nucleic acid molecule are the phase mutual crosses under rigorous condition of two kinds of molecules.Rigorous condition is that sequence relies on and is different under different environmental parameters.With L-Ala 2, the nucleic acid molecule of 3-aminomutase gene order hybridization is hybridized respectively under aforesaid condition usually in based on whole L-Ala 2, the probe of the portion gene of 3-aminomutase gene or selection under rigorous condition.

Because the degeneracy of genetic code, that the nucleotide sequence that does not show height identity may still be encoded is identical or similar (conservative) aminoacid sequence.Can produce variation in the nucleotide sequence by using this degeneracy to produce the identical in essence proteinic multiple nucleic acid molecule of all codings.This homologous nucleotide sequence can, for example, have at least 60%, 70%, 80%, 90%, 95%, 98% or 99% the sequence identity that this method is measured of passing through.

The scope that those skilled in the art will appreciate that these sequence identity just is used to provide guidance; The scope that is provided is provided the strong significant homology that obtains is possible.

Two kinds of nucleotide sequences are that substantially the same selectable (and inessential cumulative) indication is that the polypeptide of first nucleic acid encoding and the polypeptide of second nucleic acid encoding are immunological cross-reactions.

Specific-binding agent: basically only in conjunction with the target that limits, such as the reagent of target peptide.For example, L-Ala 2,3-aminomutase wedding agent comprises anti-L-Ala 2, the antibody of 3-aminomutase and basically only in conjunction with L-Ala 2, other reagent of 3-aminomutase (for example peptide or medicine).Can use L-Ala 2, the antibody of 3-aminomutase protein (or its fragment) comes purifying or identifies this protein.

Transform: for example by Protocols in Molecular Biology with the nucleic acid molecule transfered cell.As used in this, term transforms and comprises all technology of nucleic acid molecule being introduced this cell, includes but not limited to use the virus vector transfection, engages, imports exposed DNA with the plasmid vector conversion and by electroporation, lipofection and particle electron gun.

Variant, fragment or fused protein: L- Ala 2,3 aminomutase protein of the present invention comprise its variant, fragment and syzygy.Coded protein (for example SEQ ID NO:20 or 29), the L-Ala 2 that merges, the dna sequence dna of 3 aminomutase protein or proteinic fragment of L- Ala 2,3 aminomutases or variant can be expressed in eukaryotic cell, bacterium, insect and/or plant to allow protein by through engineering approaches.In order to obtain to express, dna sequence dna can be changed and be operably connected to other and regulate on the sequence.Comprise adjusting sequence and proteinic final product and be called carrier.This carrier can be imported into eucaryon, bacterium, insect and/or vegetable cell.In case allow proteinic generation at this carrier of cell interior.

Fused protein comprises, for example L-Ala 2,3-aminomutase (or its variant, multiformity, mutant or fragment), SEQ ID NO:21 or 30 for example, be connected to the L-Ala 2 that does not suppress required, 3 aminomutase activity for example do not suppress to transform α-Bing Ansuan and are the protein on other aminoacid sequence of ability of Beta-alanine.In an example, another aminoacid sequence is no more than about 10,12,15,20,25,30 or 50 amino acid whose length.

Those of ordinary skill in the art can recognize that dna sequence dna can be changed in many aspects and do not influence the biological activity of this encoded protein matter.For example, can use PCR, change in the dna sequence dna of 3-aminomutase at coding L-Ala 2.This variant can be for being used to express the codon that this proteinic host cell is had a preference for, or promotes other sequence variation of expressing and the variant of optimizing.

Carrier: thus be imported into the nucleic acid molecule that cell produces transformant.Carrier can comprise and allows its nucleotide sequence of duplicating of replication origin for example in cell.Carrier also can comprise one or more selectable marker gene and other genetic elements known in the art.

L-Ala 2, the nucleic acid of 3-aminomutase and polypeptide

Have L-Ala 2, the active polypeptide of 3-aminomutase is disclosed in this.In an example, this polypeptide is the aminomutase aminoacid sequence of sudden change, and for example Methionin 2,3-aminomutase, leucine 2,3-aminomutase or Methionin 5,6-aminomutase sequence.Have L-Ala 2, the example of the active polypeptide of 3-aminomutase is presented in SEQ ID NOS:21 and 30.Yet the present invention also comprises and keeps L-Ala 2, the active SEQ IDNOS:21 of 3-aminomutase and 30 variant, syzygy and fragment.Spendable segmental example includes, but are not limited to: the amino acid 50-390 of SEQ ID NO:21,50-350,60-350, amino acid/11-390,15-390,15-340 or the 19-331 of 75-340 or 100-339 and SEQ ID NO:30.Can be substituted, still keep L-Ala 2 simultaneously, the active example of 3-aminomutase includes but not limited to: V21I or the V21L of SEQ ID NO:21; Y71P; L17I; K361R; A410V; And/or the T40S of Y430F or Y430W and SEQ ID NO:30; V96I or V96L; D102E; A252V; And/or L393V, with and the combination.

The invention provides enzyme polypeptide, such as L-Ala 2,3-aminomutase (for example SEQ ID NO:21 and/or 30, and maintenance L-Ala 2, the active variant of 3-aminomutase, fragment and syzygy).It should be appreciated by those skilled in the art that the enzyme sequence that can use variation, as long as this enzyme keeps required enzymic activity, for example L-Ala 2,3-aminomutase activity.For example, disclosed content provides the amino acid whose polypeptide that comprises at least 15 connections identical with the enzyme sequence of for example L- Ala 2,3 aminomutase sequences.Being appreciated that the present invention also provides comprises more than at least 15 amino-acid residues (for example, 16,17,18 at least, 19,20,21,22,23,24,25,26,27,28,29,30,50,75,100,150,200,250,300 or amino acids residue more) the polypeptide of aminoacid sequence, with disclosed at this or other identical polypeptide of available any enzyme is disclosed.

In addition, the invention provides the polypeptide of enzyme, such as L-Ala 2,3-aminomutase peptide (for example, SEQ ID NO:21 and/or 30), it comprises having the aminoacid sequence that enzyme amino acid sequence changes.The variant sequence can comprise single insertion, single disappearance, single replacement, a plurality of insertion, a plurality of disappearance, a plurality of replacement, or its any combination (for example, single disappearance and a plurality of insertion are together).This peptide species with such as L-Ala 2, the enzyme sequence of 3-aminomutase sequence has at least 60,65,70,75,80,85,90,95,97,98 or 99% sequence identity is as long as keep desired enzymic activity by this amino acid sequences encoded peptide.

Have the variant amino acid polypeptide of sequence and can keep enzymic activity, such as L-Ala 2,3-aminomutase activity.This peptide species can produce by using the nucleotide sequence such as the standard method operation coded polypeptide of site-directed mutagenesis or PCR.One type modification comprises the replacement of one or more amino-acid residue, such as being no more than the amino-acid residue that 10 aminoacid replacement have similar biochemical property, and promptly conservative the replacement.

The variation of more essence can obtain by selecting less conservative replacement, for example, is chosen in the residue that keeps having in the following character remarkable Different Effects: (a) structure of polypeptide main chain, for example lamella or helical conformation in the zone that replaces; (b) in the electric charge or the hydrophobicity of target site polypeptide; Or (c) volume of side chain.The replacement that is generally expected that the variation that generation is big on the function of polypeptide is: (a) hydrophilic residue, and for example, Serine or Threonine replace (or quilt) hydrophobic residue, for example leucine, Isoleucine, phenylalanine, Xie Ansuan or L-Ala (replacement); (b) halfcystine or proline(Pro) are replaced by (or passing through) any other residue; (c) have the residue of positive electricity side chain, for example Methionin, arginine or Histidine replace (or by) negative electricity residue, for example L-glutamic acid or aspartic acid (replacement); Or (d) have a residue of big side chain, for example phenylalanine replaces the residue that (or by) do not have side chain, for example glycine (replacement).The effect of these aminoacid replacement (or other disappearance or adding) can be assessed the polypeptide with enzymic activity by the ability that transforms as identical this polypeptide catalysis same substrate of product analysis of relevant natural polypeptides catalysis.Therefore, provide to have to be no more than 5,10 20,30,40 or 50 conservative polypeptide that replace at this.

The present invention also discloses coding and has had L-Ala 2, and the active polypeptide of 3-aminomutase for example comprises the isolating nucleic acid of the sequence of SEQ ID NO:20 or 29.Yet the present invention also comprises the maintenance coding and has L-Ala 2, the SEQ IDNOS:20 of active protein of 3-aminomutase or peptide and 29 variant, syzygy and fragment.Coding has L-Ala 2 in an example, and the isolating nucleic acid of 3-aminomutase active polypeptide is operably connected on the promoter sequence, and can become the part of carrier.This nucleic acid can be to be used for transformant and to prepare transformant and/or the recombinant nucleic acid of genetically modified non-human mammal.

The invention discloses and comprise that coding has L-Ala 2,3-aminomutase active polypeptide (for example SEQ ID NO:20 and/or 29 or keep L-Ala 2, active its fragment of 3-aminomutase, syzygy or variant) the transformant of at least one exogenous nucleic acid molecule.In an example, this cell transformed produces Beta-alanine by α-Bing Ansuan.In another example, this cell produces 3-HP, pantothenic acid, CoA and/or organic compound such as 1, ammediol.

Be coded in the nucleotide sequence of this disclosed enzyme; such as L-Ala 2; 3-aminomutase (SEQ ID NO:20 and 29), Methionin 2; 3-aminomutase (SEQ ID NOS:3 and 28); and β-alanyl CoA ammonia lyase SEQ ID NO:22), (and at this disclosed any other enzyme), can comprise codase and keep whole nucleotide sequences of the part of required enzymic activity.For example, the nucleic acid of enzyme can comprise at least 15 successive Nucleotide of enzymatic nucleic acid sequence.Being appreciated that the present invention also provides comprises more than 15 Nucleotide (for example, 16,17,18 at least, 19,20,21,22,23,24,25,26,27,28,29,30,40,50,75,10,200,500 or polynucleotide more) nucleotide sequence of length, and with such as SEQ ID NO:20 and/or 29 shown L-Ala 2, the identical isolating nucleic acid of enzyme sequence any part of 3-aminomutase sequence.

In addition, the invention provides the variation that comprises enzyme sequence, Bian Yi L-Ala 2 for example, the isolating enzymatic nucleic acid sequence of 3-aminomutase nucleotide sequence.Variant can comprise single insertion, single disappearance, single replacement, a plurality of insertion, a plurality of disappearance, a plurality of replacement, or its any combination (for example, single disappearance and a plurality of insertion are together), as long as the peptide of coding keeps L-Ala 2,3-aminomutase activity thus.This isolated nucleic acid molecule can with for example L-Ala 2, the enzyme sequence of 3-aminomutase sequence has at least 60,70,75,80,85,90,92,95,97,98 or 99% sequence identity, as long as the peptide by this nucleic acid encoding keeps needed enzymic activity, for example L-Ala 2,3-aminomutase activity.For example, can be to L-Ala 2,3-aminomutase nucleotide sequence produces following variation: for SEQ ID NO:20,12 " a " available " g " replaces; 1050 " g " available " a " replaces; 255 " a " available " g " " t " or " c " replace; For SEQ ID NO:29,6 " a " available " g " " t " or " c " replace; 66 " t " available " c " replaces; And 315 " g " available " a " " t " or " c " replacement.

The codon preference of particular types and codon usage table can be used for the engineered isolated nucleic acid molecule of utilizing the codon preference of specific kind.For example, can be designed to have the preferential codon that uses of specific purpose organism at this disclosed enzyme.

The present invention also provides the isolated nucleic acid sequences of codase, and for example L-Ala 2, the 3-aminomutase, and wherein this sequence is the length (for example, about at least 13 of about at least 12 bases, 14,15,16,17,18,19,20,25,30,40,50,60,100,250,500,750,1000,1500,2000,3000,4000 or 5000 base length) and under hybridization conditions with the sense strand or the antisense strand hybridization of the nucleic acid of codase.Hybridization conditions can be a rigorous hybridization conditions medium or height.

Polypeptide and nucleic acid encoding can produce by the DNA induced-mutation technique of standard, for example M13 primer mutagenesis.The details of these technology is provided in people such as Sambrook (ed.), molecular cloning: laboratory manual, and second edition, vol.1-3, press of cold spring harbor laboratory, the cold spring port, New York, 1989, among the CH.15.Nucleic acid molecule can comprise the variation of coding region to be fit to be imported into the preference of the specific organism of molecule to the codon use.

Selectively, this coding region can change encoding sequence by the degeneracy of utilizing genetic code, simultaneously changed nucleotide sequence by this way basically, it is still encoded and has same acid sequence or similar to natural aminoacid sequence basically polypeptide.For example, because the degeneracy of genetic code, L-Ala is encoded by the triplet of 4 kinds of Nucleotide codons: GCT, GCA, GCC and GCG.Therefore, the nucleotide sequence of open reading frame can be an any of these codon and do not influence the characteristic of aminoacid sequence or this polypeptide of coded polypeptide in the L-Ala change in location.Based on the degeneracy of genetic code, the nucleic acid variant can derive from and use standard DNA induced-mutation technique as the described herein, or passes through the synthetic nucleotide sequence of nucleotide sequence.Therefore, the present invention also comprises coding phase homopolypeptide but by the degeneracy of genetic code and at nucleic acid molecule different aspect the nucleotide sequence.

Has L-Ala 2, the active cell of 3-aminomutase

The invention discloses and have L-Ala 2, the active cell of 3-aminomutase.This cell can produce Beta-alanine by α-Bing Ansuan.In an example, this cell has and depends on naturally occurring sudden change, and/or the sudden change that causes in this cell chromosome, for example by with the mutagenesis of cellular exposure in chemistry or ultraviolet, L-Ala 2,3-aminomutase activity.Comprise L-Ala 2, the active cell of 3-aminomutase can be eucaryon or protokaryon.The example of this cell includes but not limited to, Bacterium lacticum, galactococcus, bacillus, escherich's bacillus, Geobacillus, coryneform bacteria (Corynebacterium), clostridium, fungi, plant and yeast cell.In an example, vegetable cell is a plant, such as the part of transgenic plant.

In an example, have L-Ala 2, the active cell of 3-aminomutase is a cell transformed.This cell can comprise coding L-Ala 2, the 3-aminomutase, the sequence that for example comprises SEQ ID NO:20 or 29, or it keeps coding to have L-Ala 2, at least one exogenous nucleic acid molecule of variant, fragment or the syzygy of the active proteinic ability of 3-aminomutase.In an example, the nucleic acid molecule of this external source is the Methionin 2 of sudden change, 3-aminomutase, the Methionin 2 of Tu Bian protokaryon for example, 3-aminomutase.In special example, the procaryotic Methionin 2 of this sudden change, the 3-aminomutase is the Methionin 2 of subtilis, the abnormal cocci of anti-radiation the, clostridium subterminale, Alcaligenes faecalis, hemophilus influenzae, intestinal bacteria or the porphyromonas gingivalis of sudden change, the 3-aminomutase.Other Methionin 2, the 3-aminomutase can be by the evaluation of use methods known in the art, for example method by searching for similar sequence and/or hybridize by use on BLAST.In special example, the Methionin 2 of sudden change, 3-aminomutase are the subtilis of sudden change or the porphyromonas gingivalis Methionin 2 of sudden change, the 3-aminomutase.In another example, the nucleic acid molecule of external source is the Methionin 5 of sudden change, 6-aminomutase, the Methionin 5 of Tu Bian protokaryon for example, 6-aminomutase.Selectively, the nucleic acid molecule of external source is the leucine 2 of sudden change, 3-aminomutase, or the Methionin 5 of sudden change, 6-aminomutase, Tu Bian Si Shi clostridium (C.sticklandii) Methionin 5 for example, 6-aminomutase.

In specific example, the Methionin 2 of sudden change, 3-aminomutase are to have the subtilis Methionin 2 that replaces sudden change, 3-aminomutase at L103, D339 and/or M136 position.For example, replacement can comprise the replacement of L103M, L103K, L103R, L103E or L103S.In another or additional example, replace the replacement that comprises D339H, D339Q, D339T or D339N.In another example, replacement can comprise the replacement of L103M, M136V, the replacement of D339H or its arbitrary combination.

The invention discloses and comprise L-Ala 2, the cell of 3-aminomutase activity and other enzymic activity.Can use this cells produce Beta-alanine, 3-HP, pantothenic acid, CoA and organic acid, polyvalent alcohol, such as 1, ammediol, vinylformic acid, polymeric acrylate, acrylic acid ester, polymeric 3-HP, 3-HP and such as co-polymer, valerate or the salt of butyro-other compound and the ester of other compound and 3-HP.

In an example, this cell also comprises alanine dehydrogenase or pyruvic acid/glutamate transaminase activity, CoA transferase active or CoA synthetic enzyme, β-alanyl-CoA ammonia lyase activity, 3-HP-CoA dehydratase activity, glutamate dehydrogenase activity, 3-hydroxy propionyl group-CoA lytic enzyme or 3-hydroxyl isobutyryl-CoA hydrolytic enzyme activities.In another example, this cell also comprises alanine dehydrogenase or pyruvic acid-glutamate transaminase activity, 4-aminobutyric acid and/or Beta-alanine-2-oxoglutarate transamination enzymic activity, glutamate dehydrogenase activity, and 3-HP or 3-Hydroxyisobutyrate dehydrogenase activity.In these examples, can use cell to produce 3-HP.

In another example; cell also comprises alanine dehydrogenase or pyruvic acid/glutamate transaminase activity, CoA transferring enzyme or CoA synthase activity, β-alanyl-CoA ammonia lyase activity, 3-HP-CoA dehydratase activity, glutamate dehydrogenase activity, and 3-hydroxy propionyl group-CoA lytic enzyme 3-hydroxyl isobutyryl-CoA hydrolytic enzyme activities.In another example, this cell also comprises alanine dehydrogenase or pyruvic acid-glutamate transaminase activity, 4-aminobutyric acid and/or Beta-alanine-2-oxoglutarate transamination enzymic activity, glutamate dehydrogenase activity, and 3-HP or 3-Hydroxyisobutyrate dehydrogenase activity; And lipase or esterase activity.Can use the ester of this cells produce 3-HP, such as 3-hydroxy methyl propionate, 3-hydroxy-propionic acid ethyl ester, 3-hydroxy-propionic acid propyl ester, 3-hydroxy-propionic acid butyl ester or 3-hydroxy-propionic acid 2-(ethyl hexyl) ester.

In another example, cell also comprises alanine dehydrogenase or pyruvic acid/glutamate transaminase activity, CoA synthase activity, β-alanyl-CoA ammonia lyase activity, 3-HP-CoA dehydratase activity, glutamate dehydrogenase activity; And polyalcohols acid synthase activity.Can use this cells produce polymeric 3-HP.

In another example, cell also comprises alanine dehydrogenase or pyruvic acid/glutamate transaminase activity, CoA synthase activity, β-alanyl-CoA ammonia lyase activity, glutamate dehydrogenase is active and poly-hydroxy acid synthase activity.Can use this cells produce polymeric acrylate.

In another example; cell also comprises alanine dehydrogenase or pyruvic acid/glutamate transaminase activity, CoA transferring enzyme or CoA synthase activity, β-alanyl-CoA ammonia lyase activity, glutamate dehydrogenase activity; and lipase or esterase activity; wherein can use the acrylic acid ester of this cells produce, for example methyl acrylate, ethyl propenoate, propyl acrylate or butyl acrylate.

Selectively; this cell also comprises alanine dehydrogenase or pyruvic acid-glutamate transaminase activity, CoA transferring enzyme or CoA synthase activity, β-alanyl-CoA ammonia lyase activity, 3-HP-CoA dehydratase activity, glutamate dehydrogenase activity, 3-hydroxy propionyl group-CoA lytic enzyme or 3-hydroxyl isobutyryl-CoA hydrolytic enzyme activities, and aldehyde or alcohol dehydrogenase activity.Can use this cells produce 1, ammediol.

In an example, cell also has α-ketone pantothenic acid hydroxymethyl transferases (E.C.2.1.2.11), α-ketone pantothenic acid reductase enzyme (E.C.1.1.1.169), and pantothenate synthetase (E.C.6.3.2.1) activity.Can use this cells produce pantothenic acid.Selectively or additionally; this cell also have Pantothen kinase (E.C.2.7.1.33), 4 '-phosphoric acid hydroxyl pantoyl base-1-cysteine synthase (E.C.6.3.2.5), 4 '-phosphoric acid hydroxyl pantoyl base cysteic acid decarboxylase (E.C.4.1.1.36), ATP:4 '-phosphopantetheine VITAMIN B4 transferring enzyme (E.C.2.7.7.3), and dephosphorylation-CoA kinases (E.C.2.7.1.24) activity.Can use this cells produce coenzyme A (CoA).

Evaluation has L-Ala 2, the method for the active cell of 3-aminomutase

The invention discloses and identify to have L-Ala 2, the method for the active cell of 3-aminomutase.This method is included in the substratum that contains α-Bing Ansuan rather than Beta-alanine or pantothenic acid, or cell can produce α-Bing Ansuan by carbon, oxygen, hydrogen and the nitrogen in substratum source therein, but do not comprise in the substratum of Beta-alanine or pantothenic acid, cultivate the cell of functional deficiency panD, the cell that for example prokaryotic cell prokaryocyte, and evaluation can be grown in the substratum that lacks Beta-alanine or pantothenic acid.In specific example, this cell also is functional deficiency panF.The growth table clear-cells of cell produces Beta-alanine by α-Bing Ansuan, shows that also this cell has L-Ala 2,3-aminomutase activity.On the contrary,, show that this cell can not produce Beta-alanine by α-Bing Ansuan, show that also this cell does not have L-Ala 2,3-aminomutase activity if cell does not get growth and/or existence on the substratum at shortage Beta-alanine or pantothenic acid.

In an example, the cell of functional deficiency panD transforms with the aminomutase of one or more sudden change, such as the Methionin 2 that comprises sudden change, and the leucine 2 of 3-aminomutase, sudden change, the Methionin 5 of 3-aminomutase and/or sudden change, the library of 6-aminomutase.In specific example, with the Methionin 2 of sudden change, the library of 3-aminomutase transforms this cell before cultivating and screening.Enzyme Methionin 2, the 3-aminomutase is before from clostridium subterminale SB4 (people such as Chirpich, journal of biological chemistry J.Bio1.Chem.245:1778-89,1970) and subtilis (people such as Chen, journal of biological chemistry Biochem.J.348:539-49,2000) clone comes out in, and has shown the mutual conversion of catalysis Methionin and beta-lysine.The aminomutase of sudden change, such as the Methionin 2 of sudden change, the 3-aminomutase can screen its L-Ala of giving 2, the active ability of 3-aminomutase.In addition, although have L-Ala 2, the active polypeptide of 3-aminomutase was not before described, and such enzyme may be present in occurring in nature.Therefore, the cell of functional deficiency panD can be with comprising coding L-Ala 2, the library of the gene of 3-aminomutase transforms, and comprising α-Bing Ansuan by giving these cells, or carbon, oxygen, hydrogen, with the ability of growing in the substratum of nitrogenous source so that this cell can produce α-Bing Ansuan, and do not comprise Beta-alanine or pantothenic acid separates this gene.

In another example, this method further is included in the aminomutase of sudden change and identifies mutant, identifies that subsequently the aminomutase of this sudden change is given this cell L-Ala 2, the active thereby cell that can grow in substratum of 3-aminomutase.In order to identify this sudden change, the nucleic acid of aminomutase or amino acid can be checked order and be compared with nonmutationed aminomutase sequence, give cell L-Ala 2 with evaluation, the active sudden change of 3-aminomutase.

Production has L-Ala 2, the method for the active peptide of 3-aminomutase

The invention discloses to produce and have L-Ala 2, the active L-Ala 2 of 3-aminomutase, the method for 3-aminomutase peptide.This method is included in and allows cells produce L-Ala 2, cultivates disclosed have L-Ala 2, the active cell of 3-aminomutase under the condition of 3-aminomutase peptide.In an example, this method comprises cultivating to have one or more coding L-Ala 2, the 3-aminomutase (for example comprises SEQ ID NO:20 and/or 29 or keep L-Ala 2, active its variant of 3-aminomutase, syzygy or fragments sequence) the cell of exogenous nucleic acid molecule, thereby produce L-Ala 2, the 3-aminomutase.

The present invention also discloses the method for preparing Beta-alanine from α-Bing Ansuan.In an example, this method is included in to allow to cultivate under the condition of cell by α-Bing Ansuan generation Beta-alanine and has L-Ala 2, the active cell of 3-aminomutase.In an example, this method comprises cultivating to have one or more coding L-Ala 2, the cell of the exogenous nucleic acid molecule of 3-aminomutase, so that this L-Ala 2, the 3-aminomutase can produce Beta-alanine by α-Bing Ansuan.In an example, the nucleic acid of external source comprises SEQ ID NO:20 and/or 29 or keep its L-Ala 2, the active variant of 3-aminomutase, syzygy or fragments sequence.

In specific example, this cell function disappearance panD or panD and panF.

Produce the approach of 3-HP, pantothenic acid and derivative thereof

The invention discloses and relate to by L-Ala 2, the 3-aminomutase, for example use disclosed L-Ala 2,3-aminomutase sequence and disclosedly have a L-Ala 2, the active L-Ala cell of 3-aminomutase is produced the method and the material of Beta-alanine from α-Bing Ansuan.Disclose in addition to relate to and produced pantothenic acid and 3-HP by Beta-alanine, and CoA and for example 1, the co-polymer of ammediol, vinylformic acid, polymeric acrylate, acrylic acid ester, polymeric 3-HP, 3-HP and other compound, such as butyric ester, valerate and other compound, and the method for other organic compound of the ester of 3-HP and material.Particularly, the invention provides the L-Ala 2 that is used for producing Beta-alanine by α-Bing Ansuan, the nucleic acid of 3-aminomutase (such as SEQID NO:20 and 29), polypeptide (for example SEQ ID NO:21 and 30), host cell, and method and material, wherein can use α-Bing Ansuan more effectively to prepare Beta-alanine pantothenic acid and 3-HP and derivative thereof, such as CoA with such as 1, the organic compound of the ester of ammediol, vinylformic acid, polymeric acrylate, acrylic acid ester, polymeric 3-HP and 3-HP.

Can use several pathways metabolisms to produce organic compound (Fig. 1 and 3) from the Beta-alanine that produces by α-Bing Ansuan.

The approach of 3-HP and its derivative

As shown in Figure 1, Beta-alanine can be converted into β-alanyl-CoA by the polypeptide that use has CoA transferase active (EC 2.8.3.1) or a CoA synthase activity (E.C.6.2.1.-).It is the endogenous polypeptide of Beta-alanine that Beta-alanine can transform α-Bing Ansuan by host cell from α-Bing Ansuan, and/or by using L-Ala 2 with reorganization, the 3-aminomutase, such as comprise SEQID NO:20 and/or 29 or its keep L-Ala 2, the sequence cell transformed of the active fragment of 3-aminomutase, variant or syzygy produces.The polypeptide that β-alanyl-CoA can be subsequently has β-alanyl-CoA ammonia lyase activity (EC 4.3.1.6) by use is converted into acrylyl-CoA.The polypeptide that acrylyl-CoA can be subsequently has a 3-HP-CoA dehydratase activity (EC 4.2.1.-) by use is converted into 3-hydroxy propionyl group-CoA (3-HP-CoA).3-HP-CoA can be 3-HP by several enzymatic conversions subsequently; these several enzymes include but not limited to: have CoA transferase active (EC 2.8.3.1) polypeptide, have the polypeptide of 3-hydroxy propionyl group-CoA hydrolytic enzyme activities (EC 3.1.2.-); with polypeptide, can use these enzymes that 3-HP-CoA is converted into 3-HP with 3-hydroxyl isobutyryl-CoA hydrolytic enzyme activities (EC 3.1.2.4).

As shown in Figure 1, can have the 4-aminobutyric acid and/or Beta-alanine-active polypeptide of 2-oxoglutaric acid transaminase produces 3-HP from Beta-alanine, wherein produce malonic semialdehyde from Beta-alanine by utilization.This malonic semialdehyde can be converted into 3-HP with polypeptide with 3-HP dehydrogenase activity (EC 1.1.1.59) or the polypeptide with 3-Hydroxyisobutyrate dehydrogenase activity (EC 1.1.1.31).

The derivative of 3-HP can produce from Beta-alanine as shown in Figure 1.The 3-HP-CoA of gained can be converted into polymeric 3-HP by the polypeptide with many alkyd synthase activity (EC 2.3.1.-).Selectively or additionally, 3-HP-CoA can be converted into 1 by the polypeptide with oxidoreductase activity or reductase activity, ammediol.

Resulting acrylyl-CoA can be converted into polymeric vinylformic acid by the polypeptide with many alkyd synthase activity (EC 2.3.1.-).Selectively or additionally, acrylyl-CoA can be converted into vinylformic acid by the polypeptide with CoA transferase active and/or CoA hydrolytic enzyme activities; And the vinylformic acid of gained can be converted into acrylic acid ester by the polypeptide with lipase or esterase activity.

Resulting 3-HP can be converted into the ester of 3-HP by the polypeptide with lipase or esterase activity (EC 3.1.1.-).Selectively or additionally, can produce 1 from 3-HP, ammediol by the combination that has the active polypeptide of aldehyde dehydrogenase and have a polypeptide of alcohol dehydrogenase activity.

The approach of pantothenic acid and derivative thereof

As shown in Figure 3, can be that pantothenic acid has α-ketone pantothenic acid hydroxymethyl transferases (E.C.2.1.2.11), α-ketone pantothenic acid reductase enzyme (E.C.1.1.1.169) and the active peptide of pantothenic acid synthase (E.C.6.3.2.1) and produces pantothenic acid from Beta-alanine by transforming Beta-alanine.

The derivative of pantothenic acid can produce as follows from Beta-alanine.Resulting pantothenic acid can by by have Pantothen kinase (E.C.2.7.1.33), 4 '-phosphoric acid panthenol acyl-1-cysteine synthase (E.C.6.3.2.5), 4 '-phosphoric acid panthenol acyl cysteic acid decarboxylase (E.C.4.1.1.36), ATP:4 '-phosphopantetheine VITAMIN B4 transferring enzyme (E.C.2.7.7.3) and dephosphorylation-active polypeptide of CoA kinases (E.C.2.7.1.24) be converted into CoA.

Enzyme

Has Methionin 2, the nucleic acid of the active polypeptide of 3-aminomutase and this polypeptide of encoding can obtain from multiple kind, include but not limited to: clostridium subterminale, intestinal bacteria, subtilis, the abnormal cocci of anti-radiation the, porphyromonas gingivalis, thermophilic production fluid bacterium (Aquifex aolicus), or hemophilus influenzae.For example, have Methionin 2, the active aminoacid sequence of 3-aminomutase is presented among the SEQ ID NO:28 of the SEQ ID NO:31 of subtilis and porphyromonas gingivalis.

In another example, coding has L-Ala 2, the nucleic acid of the active polypeptide of 3-aminomutase is shown in the SEQ ID NO:20 (amino acid sequence corresponding is shown in SEQ ID NO:21) of subtilis, and the SEQ ID NO:29 (amino acid sequence corresponding is shown in SEQ ID NO:30) that is shown in porphyromonas gingivalis.In addition, other has L-Ala 2, and the nucleic acid of the active polypeptide of 3-aminomutase and this peptide species of coding can use method described here to obtain.For example, can use L-Ala 2,3-aminomutase variant coding has L-Ala 2, the active polypeptide of 3-aminomutase as mentioned above.

Having the polypeptide of CoA transferase active and the nucleic acid of this peptide species of coding can obtain from multiple kind, includes but not limited to the huge ball-type bacterium of Erichsen, clostridium propionicum, Ke Shi clostridium (Clostridium kluyveri) and intestinal bacteria.For example, the nucleic acid of polypeptide of coding with CoA transferase active is shown in the SEQ ID NO:24 of the huge ball-type bacterium of Erichsen.In addition, having the polypeptide (SEQ ID NO:25) of CoA transferase active and the nucleic acid (SEQ ID NO:24) of this peptide species of coding can as the described hereinly obtain.For example, can use CoA transferring enzyme variant coding to have the polypeptide of CoA transferase active.For example, can carry out following variation: 49 " a " available " c " to the nucleotide sequence (SEQ ID NO:24) of CoA transferring enzyme replaces; 590 " a " available " atgg " replaces; Can be " g " preceding insertion " aaac " of 393; Or 736 " gaa " can be lacked.Be appreciated that sequence listed in the sequence table can comprise the combination of many variations and any kind variation, as long as this peptide keeps the CoA transferase active.In addition, can carry out following variation to the aminoacid sequence of the CoA transferring enzyme that is shown in SEQ ID NO:25: 17 " k " available " p " or " h " replace; 125 " v " available " i " or " f " replace.

Nucleic acid with β-alanyl-active polypeptide of CoA ammonia lyase and this peptide species of coding can obtain from the multiple kind that includes but not limited to clostridium propionicum.For example, the nucleic acid of coding with β-alanyl-active polypeptide complex of CoA ammonia lyase can obtain from the clostridium propionicum described in embodiment 10.The nucleic acid of coding β-alanyl CoA ammonia lyase can comprise the sequence of listing as among the SEQ ID NO:22.In addition, the nucleic acid (SEQ ID NO:22) with β-active polypeptide of alanyl CoA ammonia lyase (SEQ ID NO:23) and this peptide species of encoding can as the described hereinly obtain.For example, can use the variant coding of the β-alanyl-CoA ammonia lyase sequence that is shown in SEQ ID NO:22 to have β-alanyl-active polypeptide of CoA ammonia lyase.

Nucleic acid with the polypeptide of 3-hydroxy propionyl group-CoA dehydratase activity (being also referred to as allyl acyl group-CoA hydratase activity) and this peptide species of encoding can be available from including but not limited to orange green subdue bacterium (Chloroflexus auranticus), fold candida (Candida Rugosa), Crimson rhodospirillum (Rhodosprillium rubrum) and the red bacterium of pod membrane (Rhodobacter capsulates).For example, the nucleic acid of coding with 3-hydroxy propionyl group-active polypeptide of CoA dehydratase is open in WO02/42418.

Nucleic acid with the active polypeptide of glutamate dehydrogenase and this peptide species of coding can obtain from multiple kind.

Having the polypeptide of 3-hydroxy propionyl group-CoA or 3-hydroxyl isobutyryl-CoA hydrolytic enzyme activities and the nucleic acid of this peptide species of coding can obtain from the multiple kind that includes but not limited to Pseudomonas fluorescens (Pseudomonas fluorescens), rattus rattus (Rattus rattus) and people (Homo sapiens).For example, the nucleic acid of coding with polypeptide of 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities can obtain and have a listed sequence as GenBank accession number U66669 from Genus Homo.

Nucleic acid with 4-aminobutyric acid and/or Beta-alanine-2-oxoglutaric acid transamination enzymic activity, 3-HP dehydrogenase activity and the active polypeptide of 3-Hydroxyisobutyrate dehydrogenase and this peptide species of encoding can obtain from multiple kind.

Nucleic acid with the polypeptide of many alkyd synthase activity and this peptide species of encoding can be from including but not limited to that the multiple kind of the red bacterium of class ball (Rhodobacter sphaeroides), Comamonas acidovorans (Comamonas acidororans), (Ralstonia eutropha) and Pseudomonas oleovorans (Pseudomonas oleovorans) obtains.For example, coding have the nucleic acid of the polypeptide of many alkyd synthase activity can be from red bacterium of class ball and as the sequence acquisition listed of GenBank accession number X97200.Supplementary about how pure acid enzyme can find in people such as Song (Biomacromolecules 1:433-9,2000).

Have the polypeptide of acetylize aldehyde: NAD (+) oxidoreductase activity (EC1.2.1.10) and this peptide species of coding nucleic acid can from but be not limited to colibacillary multiple kind and obtain.For example, the nucleic acid of aldehyde dehydrogenase active polypeptide of coding with acidylate can and have the sequence shown in the GenBank accession number Y09555 available from intestinal bacteria.

Aldehyde: NAD (+) oxidoreductase activity and alcohol: NAD (+) oxidoreductase activity can carry by two kinds of different polypeptide as mentioned above, or carry by single polypeptide, for example from colibacillary polyfunctional aldehyde ethanol dehydrogenase (EC1.2.1.10) (people Gene 85:209-14 such as Goodlove, 1989; GenBank accession number No.M33504).

Have aldehyde dehydrogenase (NAD (P)+) (EC1.2.1.-) active polypeptide and the coding this peptide species nucleic acid can obtain in the multiple kind of cereuisiae fermentum from including but not limited to.For example, the nucleic acid that coding has an active polypeptide of aldehyde dehydrogenase can obtain and have (the people such as Tessier of the sequence shown in the GenBank accession number No.Z75282 from cereuisiae fermentum (S.cerevisiae), FEMS Microbiol.Lett.164:29-34,1998).

Having the polypeptide of alcohol dehydrogenase activity (EC1.1.1.1) and the nucleic acid of this peptide species of coding can obtain from the multiple kind that includes but not limited to zymomonas mobilis (Z.mobilis).For example, the nucleic acid of polypeptide of coding with alcohol dehydrogenase activity can obtain and have the sequence shown in the GenBank accession number No.M32100 from zymomonas mobilis.

Nucleic acid with the polypeptide of lipase activity and this peptide species of encoding can be from including but not limited to that the multiple kind of fold candida, candida tropicalis (Candida tropicalis) and white candiyeast (Candida albicans) obtains.For example, the coding have lipase activity polypeptide can from fold candida, obtain and have the sequence shown in the GenBank accession number A81171.

Having the polypeptide of α-ketone pantothenic acid hydroxymethyl transferases and pantothenic acid synthase activity and the nucleic acid of this peptide species of coding can obtain from including but not limited to colibacillary multiple kind.For example, the nucleic acid of polypeptide of coding with α-ketone pantothenic acid hydroxymethyl transferases and pantothenic acid synthase activity can obtain and have the sequence shown in the GenBank accession number L17086 from intestinal bacteria.

Have α-ketone pantothenic acid reductase enzyme, Pantothen kinase, 4 '-phosphoric acid panthenol acyl-L-cysteine synthase, 4 '-nucleic acid of phosphoric acid panthenol acyl cysteic acid decarboxylase, ATP:4 '-phosphopantetheine VITAMIN B4 transferring enzyme and the polypeptide of dephosphorylation-CoA kinase activity and this peptide species of encoding can obtain from include but not limited to colibacillary multiple kind.For example, coding have α-ketone pantothenic acid reductase enzyme Pantothen kinase, 4 '-phosphoric acid panthenol acyl-1-cysteine synthase, 4 '-nucleic acid of the polypeptide of phosphoric acid panthenol acyl cysteic acid decarboxylase, ATP:4 '-phosphopantetheine VITAMIN B4 transferring enzyme and dephosphorylation-CoA kinase activity can obtain and have the listed sequence of GenBank accession number NC000913 from intestinal bacteria.

Term " polypeptide " with enzymic activity be meant other material of catalysis chemical reaction and in finishing the process of this reaction itself and any polypeptide of not being destroyed or changing.Usually, the polypeptide catalysis with enzymic activity forms one or more product from one or more substrate.The enzymic activity that this peptide species can have any kind includes but not limited to; enzymic activity or with following enzyme involved enzyme activity; such as L-Ala 2, the 3-aminomutase; dehydratase/hydratase; 3-hydroxy propionyl group-CoA dehydratase/hydratase; alanine dehydrogenase; the CoA transferring enzyme; 3-hydroxy propionyl group-CoA lytic enzyme; 3-hydroxyl isobutyryl-CoA lytic enzyme; the CoA lytic enzyme; many pure acid synthases; the Beta-alanine ammonia lyase; 4-aminobutyric acid or Beta-alanine-2-oxoglutaric acid transaminase; the 3-HP desaturase; 3-Hydroxyisobutyrate dehydrogenase; glutamate dehydrogenase; lipase; esterase; acetylize aldehyde: NAD (+) oxydo-reductase; alcohol: NAD (+) oxydo-reductase; aldehyde dehydrogenase; the alcoholdehydrogenase hydroxymethyl transferases; reductase enzyme; synthase; kinases; synthetic enzyme; decarboxylase; α-ketone pantothenic acid hydroxymethyl transferases; α-ketone pantothenic acid reductase enzyme; pantothenate synthetase; Pantothen kinase; 4 '-phosphoric acid panthenol acyl-1-cysteine synthase; 4 '-phosphoric acid panthenol acyl cysteic acid decarboxylase; ATP:4 '-phosphopantetheine VITAMIN B4 transferring enzyme; dephosphorylation-CoA kinases; acetylize aldehyde: NAD (+) oxydo-reductase; alcohol: NAD (+) oxydo-reductase; aldehyde dehydrogenase (NAD (P)+); alcoholdehydrogenase and VITAMIN B4 transferring enzyme.

The method for preparing 3-HP, pantothenic acid and derivative thereof

Each step that approach provided of describing among Fig. 1 and 3 all can be in cell (in the body) or extracellular (external, for example, in container or post) carry out.In addition, the organic compound product can make up by synthetic in the body and external synthetic and produce.In addition, but external step after chemical reaction or enzymatic reaction are carried out.

For example, can use in this cell that provides or microorganism the step that provides in Fig. 1 and 3 is provided, maybe can use the extract that comprises polypeptide to carry out the step that Fig. 1 and 3 provides with shown enzymic activity.In addition, can use chemical treatment to carry out conversion in Fig. 1 and 3.For example, can acrylyl-CoA be converted into vinylformic acid by hydrolysis.Other chemical treatment comprises but is not limited to, and vinylformic acid is converted into the trans esterification of acrylate.

Polypeptide expression

Polypeptide described herein can be produced respectively in the host cell of host cell or combination such as enzyme listed among Fig. 1.In addition, having the active polypeptide of certain enzyme can be the polypeptide that natural existence or non-natural exist.Naturally occurring polypeptide is to have the aminoacid sequence of finding at occurring in nature, comprises any polypeptide of wild-type and multiformity polypeptide.Naturally occurring polypeptide can be available from including but not limited to any kind of animal (for example, Mammals), plant, fungi and bacterium.The polypeptide that non-natural exists is any polypeptide that has not the aminoacid sequence of finding at occurring in nature.Therefore, the polypeptide of non-natural existence can be the mutant form of naturally occurring polypeptide or the polypeptide of through engineering approaches.For example, have L-Ala 2, the polypeptide that the active non-natural of 3-aminomutase exists can be to have Methionin 2,3-aminomutase activity, and at least some L-Ala 2, the mutant of the active naturally occurring polypeptide of 3-aminomutase (for example SEQID NO:21 and/or 30).Polypeptide can be by for example sequence interpolation, disappearance, displacement or its make up and suddenly change.

The invention discloses genetically-altered cells, can using this cell to be implemented in one or more steps in institute's description approach here, maybe can to use this genetically-altered cells to be used for follow-up at the disclosed polypeptide of produced in vitro.For example, independent microorganism can comprise the exogenous nucleic acid that is encoded to necessary each polypeptide of describing among enforcement Fig. 1 and 3 of step.This cell can comprise many exogenous nucleic acid molecules.For example, specific cell can comprise 1,2,3 or 4 kind of different exogenous nucleic acid molecule, wherein every kind of coding transforms into pyruvic acid the necessary polypeptide of 3-HP as shown in Figure 1, maybe when comprising when being encoded to conversion acrylyl-CoA and becoming the exogenous nucleic acid of the necessary polypeptide of 3-HP, specific cell can in the seedbed produce to transforming pyruvic acid and become the necessary polypeptide of acrylyl-CoA.

In addition, one of single exogenous nucleic acid molecule codified or more than one polypeptide.For example, single exogenous nucleic acid molecule can comprise coding 2,3 and even 4 kind of sequence of homopolypeptide not.Further, cell described herein can comprise specific exogenous nucleic acid molecule, for example the single copy or the multiple copied (for example, about 5,10,20,35,50,75,100 or 150 copies) of certain enzyme.Cell described herein can comprise more than a specific exogenous nucleic acid.For example, specific cell can comprise the exogenous nucleic acid molecule X of about 50 copies and the exogenous nucleic acid molecule Y of about 75 copies.

In another example, cell can comprise coding and have L-Ala 2, the exogenous nucleic acid molecule of the active polypeptide of 3-aminomutase (or it keeps L-Ala 2, the active variant of 3-aminomutase, fragment or syzygy), for example SEQ ID NO:20 and/or 29.But this cell can have the L-Ala 2 of any detection level, and 3-aminomutase activity comprises the meta-bolites by Beta-alanine, for example the activity that detects of the generation of pantothenic acid.For example, comprise coding and have L-Ala 2, the cell of the exogenous nucleic acid molecule of the active polypeptide of 3-aminomutase can have the L-Ala 2 that per hour forms the specific activity of 1 μ g Beta-alanine greater than every approximately gram stem cell weight, and 3-aminomutase activity (for example, per hour form about 10,20,30,40 greater than every gram stem cell weight, 50,60,70,80,90,100,125,150,200,250,300,350,400,500 or the Beta-alanine of more μ g).Selectively, cell can have L-Ala 2, and the 3-aminomutase is active so that from 1 * 10 ⁶The cell extract of cell have and form about 1ng Beta-alanine greater than every milligram of total protein per minute and (for example, form about 10,20,30 greater than every milligram of total protein per minute, 40,50,60,70,80,90,100,125,150,200,250,300,350,400,500 or the Beta-alanine of more ng) specific activity.

Can use any method described herein to identify and obtain the nucleic acid molecule that coding has the polypeptide of enzymic activity.For example, the nucleic acid molecule of polypeptide that coding has enzymic activity can use conventional molecular cloning or chemical nucleic acid synthetic method and technology, comprises that PCR identifies and obtains.In addition, can use according to genetic code standard nucleic acid sequencing technologies and software program that nucleotide sequence is converted into aminoacid sequence are determined whether specific nucleic acid has any sequence homology with known enzyme polypeptide.Can use for example more multiple sequence of sequence alignment software of MEGALIGN (DNASTAR, Madison, WI, 1997).

In addition, the nucleic acid molecule of coding known enzyme polypeptide can use conventional molecule clone technology (for example, site-directed mutagenesis) to suddenly change.Possible sudden change includes but not limited to, the combination that disappearance, insertion and base replacement and disappearance, insertion and base are replaced.Further, (for example, GenBank) identification code has the nucleotide sequence of peptide activity can to use nucleic acid and pool of amino acids.In brief, can use any aminoacid sequence that has some homologys with the polypeptide with enzymic activity, or the nucleotide sequence that any and the sequence with peptide activity of encoding have some homologys is searched for GenBank as inquiry.The polypeptide that can analyze this evaluation subsequently is to determine whether they show enzymic activity.

In addition, can use nucleic acid hybridization technique to identify and the nucleic acid molecule of the polypeptide of obtaining to encode with enzymic activity.In brief, can use the nucleic acid molecule of the known enzyme polypeptide of any coding or its fragment as probe to highly rigorous condition, to identify similar nucleic acid molecule by hybridization medium.This similar nucleic acid molecule subsequently can be separated, order-checking and analyzing to determine whether this encoded polypeptides has enzymic activity.

Also can use the cloning by expression technology to identify and the nucleic acid molecule of the polypeptide of obtaining to encode with enzymic activity.For example, can use and screen the phage that comprises the enzyme polypeptide with the interactional substrate of known certain enzyme polypeptide and show the library.Phage shows that the library can produce people such as (, biochemical analysis Anal.Biochem.238:1-13,1990) Burritt as described, maybe can from goods providers such as Novagen (Madison WI) locates to obtain.

Further, can use sequencing polypeptides technical evaluation and acquisition coding to have the nucleic acid molecule of peptide activity.For example, can be by the polypeptide of gel electrophoresis separation and purification, and determine its aminoacid sequence by for example amino acid micrometering preface technology.In case determine, can use this aminoacid sequence to design the annealed Oligonucleolide primers.Can use the annealed Oligonucleolide primers to obtain the nucleic acid of this polypeptide of coding by PCR.In case obtain, this nucleic acid can be checked order, be cloned in the suitable expression vector, and imports in the microorganism.

Can use any method with the exogenous nucleic acid molecule transfered cell.For example, the fusion of heat-shocked, lipofection, electroporation, conjugation, protoplastis and biological transmission are the ordinary methods that is used for nucleic acid is imported bacterium and yeast cell.(referring to, for example, people such as Ito, J.Bacterol.153:1638,1983; People such as Durrens, Curr.Genet.18:7-12,1990; People's molecular clonings such as Sambrook: the laboratory refers to handbook, press of cold spring harbor laboratory, New York, the U.S., second edition, 1989; With Becker and Guarente, Methods in Enzynology 194:182-7,1991).Other is used for including but not limited to from the method for exogenous nucleic acid molecule express amino acid sequence, makes up nucleic acid so that controlling element promotes the expression of nucleic acid encoding sequence.Usually, controlling element is to regulate the dna sequence dna that other dna sequence dna is expressed at transcriptional level.Therefore, controlling element includes but not limited to, promotor, enhanser etc.The promotor that can use any kind is from exogenous nucleic acid molecule express amino acid sequence.The example of promotor includes but not limited to, constitutive promoter, tissue-specific promotor and to particular stimulation (for example, light, oxygen, chemical concentrations) reaction or unresponsive promotor.The method that is used for nucleic acid is transferred to mammalian cell also is known, for example uses virus vector.

The exogenous nucleic acid molecule that comprises in the specific cells of the present invention can remain on cell interior in any form.For example, exogenous nucleic acid molecule can be incorporated in the genome of cell or keep unbound state.That is to say that cell can be stable or instantaneous transfectant.Microorganism can comprise the specific exogenous nucleic acid molecule of list or multiple copied (for example,, about 5,10,20,35,50,75,100 or 150 copies), such as the nucleic acid of codase.

Prepare organic acid and relevant product by host cell

Can use this nucleic acid that provides and aminoacid sequence and cell come together to produce Beta-alanine, pantothenic acid and 3-HP and derivative such as CoA thereof its, and organic compound is such as 1, the ester of ammediol, vinylformic acid, polymeric vinylformic acid, acrylic acid ester, 3-HP and polymeric 3-HP.This cell can come from any kind, such as listed in the taxonomy webpage of National Institute of Health.This cell can be eucaryon or protokaryon.For example, genetically-altered cells can be mammalian cell (for example, human, mouse and cell ox), vegetable cell (for example,, corn, wheat, rice and soya cells), the fungal cell (for example, aspergillus (Aspergillus) and head mold (Rhizopus) cell), yeast cell or bacterial cell (for example, Bacterium lacticum, galactococcus, bacillus, escherich's bacillus and clostridium cell).In an example, cell is a kind of microorganism.Term " microorganism " refers to that the organism of any microcosmic includes but not limited to, bacterium, algae, fungi and protozoon.Therefore, intestinal bacteria, subtilis, Bacillus licheniformis (B.licheniformis), cereuisiae fermentum, Kluveromyces lactis, Candida blankii, fold candida and Pichia pastoris (Pichia pastoris) are microorganisms and can as the described hereinly use.In another example, cell is the part of bigger organism, such as plant, such as transgenic plant.Can be used and include but not limited to genetically engineered crops such as corn, rice, wheat and soybean by the example that Beta-alanine prepares the plant of 3-HP, pantothenic acid or other organic compound.

In an example, cell by hereditary change so that produce specific organic compound.In one embodiment, cell produces 3-HP and/or pantothenic acid by Beta-alanine, such as approach shown in Fig. 1 and 3.In another embodiment, cell produces the derivative of 3-HP and/or pantothenic acid, such as CoA, and organic compound, such as 1, the ester of ammediol, vinylformic acid, polymeric vinylformic acid, acrylic acid ester, 3-HP and polymeric 3-HP.

In an example, contained the exogenous nucleic acid molecule that one or more coding has the active polypeptide of specific enzymes by hereditary change with the cell that synthesizes specific organic compound.For example, microorganism can comprise the exogenous nucleic acid that coding has 3-hydroxy propionyl group-active polypeptide of CoA dehydratase.In this case, acrylyl-CoA can be converted into the 3-hydroxypropionate-CoA that produces 3-HP.Can offer that this cell that a kind of coding of cell has the peptide activity of catalytic combination deposits yields do not produce exogenous nucleic acid molecule.Selectively, can supply with the common exogenous nucleic acid molecule that produces of this cell that cell coding has the peptide activity of catalytic combination deposits yields.In this case, genetically-altered cells can be produced more compound, or more effectively produces this compound than the similar cell that does not have this hereditary change.

The cell of the exogenous nucleic acid molecule of the peptide activity that comprising encodes has the generation that causes 3-HP, pantothenic acid and/or its derivative is disclosed in another example.The product that produces can come out from this emiocytosis, does not reclaim this organic compound and do not need to destroy cytolemma.In an example, cell produces 3-HP, pantothenic acid and/or its derivative with the production concentration (for example, about at least 1g/L, 5g/L, 10g/L, 25g/L, 50g/L, 75g/L, 80g/L, 90g/L, 100g/L or 120g/L) of about at least every liter of 100mg.In determining specific cells, during such as the productive rate of the compound of 3-HP, pantothenic acid and/or its derivative, can use any method.Referring to, for example, Applied Environmental Microbiology 59 (12): 4261-51993).Cell in the context of the present invention can utilize various carbon sources.

Cell can comprise one or more coding and have the 3-HP of causing, pantothenic acid and/or its derivative, CoA, 1 for example, ammediol, vinylformic acid, polyacrylic acid, vinylformic acid-ester, 3-HP-ester and comprise the polymkeric substance of 3-HP and the exogenous nucleic acid molecule of the peptide activity that multipolymer generates.The method that evaluation comprises the cell of exogenous nucleic acid is known.This method includes but not limited to, PCR and nucleic acid hybridization technique, and for example Northern and Southern analyze (referring to hybridization described herein).Sometimes, can use immuning tissue-chemistry and Measurement for Biochemistry to determine by the polypeptide expression of specific nucleic acid molecule encoding whether cell comprises specific nucleic acid by detecting.For example, can use and polypeptide is had specific antibody determine whether specific cells comprises the nucleic acid of this polypeptide of encoding.Further, can use Measurement for Biochemistry to determine by detecting the organic product that produces owing to expression whether cell comprises the specific nucleic acid molecule that coding has peptide activity with peptide activity.For example, after the exogenous nucleic acid that coding is had 3-hydroxy propionyl group-CoA dehydratase active polypeptide imports the cell of undesired this peptide species of expression, detect 3-HP and can show that this cell not only comprises the exogenous nucleic acid molecule of importing but also the exogenous nucleic acid molecule of this importing is expressed encoded polypeptides.Be used to detect that to have specific enzymes method active or specific organic product be known, for example, the existence of organic compound such as 3-HP can be by Sullivan and described mensuration of Clarke (J.ASSOC.Offic.Agr.Chemists, 38:514-8,1955).

Cell with polypeptide active of minimizing

The invention discloses the hereditary change cell of polypeptide active with minimizing.Active term " minimizing " or " reduction " about cell and specific polypeptide is meant lower than activity level measured in the compared cell of identical kind as used herein.For example, if comparable microorganism has at least some enzymic activity X, the specified microorganisms that then lacks enzymic activity X has the enzymic activity X of minimizing.

The polypeptide active that cell can have any type minimizing includes but not limited to enzyme, transcription factor, transporter, acceptor, signaling molecule etc.For example, cell can comprise to destroy and has the regulation and control of panD active polypeptide and/or the exogenous nucleic acid molecule of encoding sequence.Destroying panD can stop cell to produce Beta-alanine.

The polypeptide active that reduces can be that peptide concentration descends, the specific activity decline of polypeptide or the result of its combination.Can use many diverse ways to produce the cell of polypeptide active with minimizing.For example, can use conventional mutagenesis or knock out the engineering cell and make it have ruined regulating and controlling sequence or polypeptid coding sequence.(Methods in Yeast Genetics (1997 version), Adams, Gottschling, Kaiser, and Sterns, cold spring port press, 1998; Datsenko and Wanner, Proc.Natl.Acad.Sci.USA 97:6640-5,2000).Selectively, can use antisense technology to reduce the activity of specific polypeptide.For example, thus can engineered cell make its cDNA that comprises the encoding antisense molecule stop the translation of polypeptide.Term " antisense molecule " comprises any coding strand corresponding nucleic acids molecule or nucleic acid analog (for example, peptide nucleic acid(PNA)) that comprises with endogenous polypeptide.Antisense molecule also can have side joint sequence (for example, regulating and controlling sequence).Therefore, antisense molecule can be the oligonucleotide of ribozyme or antisense.Ribozyme can have any universal architecture, includes but not limited to that hair clip, tup or axe shape structure provide molecule cutting RNA.Further, available gene silencing reduces the activity of specific polypeptide.

Can use any method to identify the cell of polypeptide active with minimizing.For example, can use enzyme described herein Analysis and Identification alive to have the cell that reduces enzymic activity.

Prepare organic acid and associated products through ex vivo technique

Can separately or unite the polypeptide that uses purifying with cell and produce pantothenic acid, 3-HP and/or its derivative with enzymic activity, such as CoA, and organic compound is such as 1, the ester of ammediol, vinylformic acid, polymeric vinylformic acid, acrylic acid ester, 3-HP and polymeric 3-HP.For example, can use the generation of the precursor 3-HP-CoA that comprises preparation catalysis 3-HP with the active pure basically polypeptide of 3-hydroxy propionyl group-CoA dehydratase.

Further, can be separately or unite with the polypeptide of purifying and/or cell and to use the cell-free extract that comprises polypeptide to produce pantothenic acid, 3-HP and/or its derivative with enzymic activity.For example; can use the cell-free extract cause Beta-alanine that comprises polypeptide to form β-alanyl-CoA with CoA transferase active; simultaneously can use the microorganisms producing 3-HP that comprises polypeptide, wherein this polypeptide has catalysis and forms the necessary enzymic activity of the required reaction of 3-HP by β-alanyl-CoA.In another example, can use to comprise α-ketone pantothenic acid hydroxymethyl transferases (E.C.2.1.2.11), α-ketone pantothenic acid reductase enzyme (E.C.1.1.1.169), and the cell-free extract of pantothenic acid synthase (E.C.6.3.2.1) forms pantothenic acid from Beta-alanine.Can use any method to produce cell-free extract.For example, can use osmotic shock, supersound process and/or multiple freeze-thaw cycle, come to produce cell-free extract by filtration and/or centrifugation subsequently from intact cell.

Can use the polypeptide of cell, purifying, and/or cell-free extract production 3-HP, chemical treatment produces another kind of compound successively.For example, can use microorganisms producing 3-HP, use chemical process that 3-HP is changed into derivative simultaneously, such as the ester of polymeric 3-HP or 3-HP.Similarly, can use chemical process to utilize cell described herein, pure basically polypeptide and/or cell-free extract to produce specific compound, this compound (for example is converted into 3-HP or other organic compound successively, 1, the ester of ammediol, vinylformic acid, polymeric vinylformic acid, acrylic acid ester, 3-HP and polymeric 3-HP).For example, can produce acrylyl-CoA, can use microorganism that acrylyl-CoA is converted into 3-HP simultaneously by chemical process.

Similarly, can use the polypeptide of cell, purifying and/or cell-free extract to produce pantothenic acid, this pantothenic acid is produced another kind of compound by chemical treatment successively.For example, can use microorganisms producing pantothenic acid, use chemical process that pantothenic acid is changed into derivative simultaneously, such as CoA.Similarly, can use chemical process, utilize cell described herein, pure basically polypeptide and/or cell-free extract to produce specific compound, this compound is converted into pantothenic acid or other compound (for example, CoA) successively.For example, can use chemical process to produce pantothenic acid, can use microorganism that pantothenic acid is converted into CoA simultaneously.

Cell fermentation is produced organic acid

The invention discloses the method for producing pantothenic acid, 3-HP and/or its derivative, produce cell by in substratum, cultivating, such as microorganism to produce pantothenic acid, 3-HP and/or its derivative.Usually, substratum and/or culture condition can be fit to microorganism growth to competent density and the effective product that produces.For the method for scale operation, can use for example described elsewhere any method (Manual of Industrial Microbiology and Biotechnology, second edition, editor: Demain and Davies, ASM press; Principles of Fermentation Technology, Stanbury and Whitaker, Pergamon).

In brief, big jar (for example, 100 gallons, 200 gallons, 500 gallons or the above jar) that comprises the suitable culture medium with glucose carbon source for example inoculated specific microorganism.After the inoculation, cultivate this microorganism to allow to produce biomass.In case reach required biomass, the fermented liquid that comprises microorganism can be changed over to second jar.This second jar can be any size.For example, second jar can be bigger than first jar, little, or of a size.Usually, second jar is bigger than first, so that other substratum can be added the fermented liquid in first jar.In addition, second interior substratum of jar can be identical or different with the substratum of use in first jar.For example, first jar can comprise the substratum with wood sugar, and second jar comprises the substratum with glucose.

In case shift, can cultivate this microorganism to allow to produce pantothenic acid, 3-HP and/or its derivative.In case produce, can use any method to separate the product that is generated.For example, can use conventional isolation technique to remove biomass, and can use conventional separation method (for example, extraction, distillation and ion-exchange techniques) to obtain pantothenic acid, 3-HP and/or its derivative from sterile fermented liquid from fermented liquid.Selectively, this product can be separated when it is produced, or it can be terminated the back in the production phase of this product and separates from fermented liquid.

Produce product from disclosed biosynthetic pathway

The compound that is produced by any step in Fig. 1 and 3 can be chemically converted to other organic compound.For example, 3-HP can be formed valuable polyester monocase, 1, ammediol by hydrogenation.Organic acid such as 3-HP can utilize any method that for example is used for hydrogenation succsinic acid and/or lactic acid to carry out hydrogenation.For example, 3-HP can utilize metal catalyst to come hydrogenation.In another example, 3-HP can be dehydrated to form vinylformic acid.Can use any method to carry out dehydration reaction.For example, can when having catalyzer (for example, metal or inorganic acid catalyst), heat 3-HP to form vinylformic acid.Also can utilize polypeptide (for example, the enzyme of enzyme classification 1.1.1.-) in external or body, to produce 1, ammediol with oxidoreductase activity.

In another example, available pantothenic acid forms coenzyme A.Available have Pantothen kinase (E.C.2.7.1.33), 4 '-phosphoric acid panthenol acyl-1-cysteine synthase (E.C.6.3.2.5), 4 '-phosphoric acid panthenol acyl cysteic acid decarboxylase (E.C.4.1.1.36), ATP:4 '-phosphopantetheine VITAMIN B4 transferring enzyme (E.C.2.7.7.3), and the active polypeptide of dephosphorylation-CoA kinases (E.C.2.7.1.24) is produced coenzyme A.

1, the preparation of ammediol

The invention discloses and be used to produce 1, the method for ammediol and cell.1, ammediol can produce from 3HP-CoA or 3-HP.Can have the genetic engineering modified generation 3-HP-CoA of oxydo-reductase/active enzyme of desaturase type or cell or the microorganism of 3-HP prepares 1, ammediol by clones coding.

For example, can have acetylize aldehyde in existence: NAD+) 3-HP-CoA is converted into 1, ammediol during the enzyme of oxydo-reductase and alcohol: NAD (+) oxidoreductase activity.This conversion can be in vivo, external or its make up and carry out.These activity can be carried by single polypeptide or by two kinds of different polypeptide.Single enzyme comprises from people such as colibacillary multifunctional aldehyde-ethanol dehydrogenase (EC 1.2.1.10) Goodlove, Gene 85:209-14,1989; GenBank accession number No.M33504).Have acetylize aldehyde: NAD (+) oxydo-reductase EC1.2.1.10) or alcohol: the enzyme of single-activity NAD (+) oxydo-reductase EC 1.1.1.1) is described.From the gene (GenBank accession number No.Y09555) of colibacillary coding acidylate aldehyde dehydrogenase with from the separated and order-checking of gene (GenBank accession number No.M32100) of the coding ethanol dehydrogenase of zymomonas mobilis.The gene of encoding such enzymes can be cloned in the organism or cell that produces 3-HP-CoA by well-known Protocols in Molecular Biology.It is 1 that these enzymes will be given cell transformation 3-HP-CoA in the organism that produces 3-HP-CoA or the expression in the cell, the ability of ammediol.These enzymes can utilize well-known technology for the substrate specificity of 3-HPCoA, change or improve such as fallibility PCR or mutator gene coli strain.

Can by with 3-HP with have aldehyde dehydrogenase (NAD (P)+) (EC 1.2.1.) and contact with the active enzyme of ethanol dehydrogenase (EC 1.1.1.1) and realize 3-HP to 1, the conversion of ammediol.This conversion can be in vivo, external or its make up and carry out.For example, clone and express these genes and will give cell or organism to transform 3-HP be 1, the ability of ammediol in microorganism that produces 3-HP or cell.These enzymes can utilize well-known as mentioned above technique variation to improve for the substrate specificity of 3-HP-CoA.

Utilize high performance liquid chromatography (HPLC) analyze between yeast phase or in analyzed in vitro, generate 1, ammediol.Chromatographic separation can realize by using the Bio-Rad87H ion exchange column.With 0.01N vitriolic moving phase with the flow velocity of 0.6ml/min by and to keep the temperature of post be 45-65 ℃.Exist in the sample 1, ammediol can use refractive index detector (people such as Skraly, Appl.Environ.Microbiol.64:98-105,1998) to detect.

Embodiment 1

Clone subtilis Methionin 2,3-aminomutase (KAM gene)

In order to identify the L-Ala 2 that produces the Beta-alanine that is used for L-Ala, the 3-aminomutase, to carrying out similar reaction but do not accept the L-Ala Beta-alanine and carry out random mutation and screen subsequently to have L-Ala 2, the enzyme of the active sudden change of 3-aminomutase with evaluation as the enzyme of substrate.Present embodiment has been described the Methionin 2 from subtilis (SEQ ID NO:3 and 31) clone, 3-aminomutase (E.C.5.4.3.2).It should be appreciated by those skilled in the art that similar method can be used for clone's Methionin 2 from any required organism, 3-aminomutase.

Select subtilis Methionin 2, the 3-aminomutase is because it is reported that it is stable to air, therefore allows to be used for the screening activity under anaerobism and aerobic condition.In addition,, can reduce the active Methionin 2 of overexpression because this enzyme has lower specific activity than Methionin 2,3 aminomutases of clostridium subterminale, 3-aminomutase or L-Ala 2, the 3-aminomutase is to the deleterious effect of escherichia coli host.

For clones coding Methionin 2, the subtilis KAM gene of 3-aminomutase uses following method.(American type culture collection (ATCC), Manassas VA) obtain subtilis ATCC 6051, and (CA) method according to manufacturer recommendation prepares chromosomal DNA for Qiagen, Valencia to use Genomic Tip 20/G from ATCC.Primer by pcr amplification KAM gene is to serve as that the basis is designed with complete subtilis genome sequence (GenBank registration number No:NC000964), and this sequence is at people such as Chen (Biochem.J.348:539-49,2000) and in the U.S. Patent No. 6,248,874 disclose.Use the PCR primer:

GCGCGAGGAGGAGTT CATATGAAAAACAAATGGTATAAAC (SEQ ID NO:1) and

CGGGCACCGCTTCGAG GCGGCCGCACCATTCGCATG (SEQ IDNO:2), wherein underlined Nucleotide are used for NdeI and the NotI site of PCR product cloning in the plasmid.

PCR reaction solution (cumulative volume 100 μ l) comprises every kind of primer (SEQ ID NOS:1 and 2), the 10 μ L10 * Pfu Turbo reaction buffer (Stratagene of 0.5 μ g subtilis chromosomal DNA, 0.2 μ M, Inc., La Jolla, CA), every kind of triphosphopyridine nucleotide of 0.2mM and the Pfu Turbo archaeal dna polymerase (Stratagene) of 5 units.This PCR is reflected at 95 ℃ of heating 2 minutes, stand then 95 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ of 30 circulations of 2 minutes kept 10 minutes in addition at 72 ℃ subsequently.

The particle dyeing coprecipitator of resulting PCR product by adding 3 μ l (Novagen, Inc.Madison, WI), the ammonium acetate of 100 μ l 5M and 400 μ l ethanol sedimentations.Resuspended reaction solution NdeI and NotI (New England Biolabs, Inc.Beverly, MA) digestion, with QIAquick PCR purification kit (Qiagen) purifying, and connect test kit (Roche Molec μ lar Biochemicals with rapid DNA, Indianapolis, IN) be connected to the pET-22b (+) of identical enzymic digestion (Novagen) or among the pPRONde to produce plasmid pET-KAM1 and pPRO-KAM1 respectively.Plasmid pPRONde is pPROLar.A122 (Clontech Laboratories, Inc., PaloAlto, derivative CA), wherein the NdeI site uses the QuikChange site-directed mutagenesis test kit of Stratagene to be implemented in initial ATG codon by oligonucleotide-site-directed mutagenesis.Methionin 2 in these carriers, the expression of 3-aminomutase are subjected to T7 promotor among the pET22 (b) or the mixing lac/ara promoters driven among the pPRO-Nde.Connector is transformed into bacillus coli DH 5 alpha, and (Life Technologies, Gaithersburg MD), and verify the clone by checking order.Subtilis KAM gene is presented among the SEQ ID NO:3 (aminoacid sequence is presented among the SEQ ID NO:31), and the mutagenic treatment of carrying out as described below, has L-Ala 2 with evaluation, the active mutant of 3-aminomutase.

Embodiment 2

The mutagenesis of subtilis KAM gene in vitro

In order to suddenly change, use the method for fallibility PCR external in subtilis KAM gene (SEQ ID NO:3), the importing.Similarly method can be used for sudden change is imported any coding Methionin 2, the KAM gene of 3-aminomutase, such as KAM gene (GenBank registration number No:RDR02336) from radiation abnormal cocci (Deinococcus radiodurans), itself and subtilis KAM protein sequence, clostridium subterminale (Clostridium subterminale) (GenBank accession number No:AF159146) or porphyromonas gingivalis (P.gingivalis) (incomplete genome, genome research mechanism is referring to embodiment 5) 52% identity arranged.

In a method, following use GeneMorph PCR Mutagenesis test kit (Stratagene).With 10,1,0.1 or every kind of T7 promoter primer of the template pET-KAM1 DNA of 0.01ng and 125ng and T7 terminator primer (in the Novagen products catalogue given sequence) recommend according to manufacturers, set up the reactant of 50 μ l, 94 ℃ were heated 30 seconds, stand 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ of 30 circulations of 2 minutes kept 10 minutes in addition at 72 ° subsequently.

Resulting PCR product is with the particle of 3 μ l dyeing coprecipitator (Novagen), the ammonium acetate of 50 μ l5M, 200 μ l ethanol sedimentations,, digestion resuspended with NdeI and NotI, and the PCR product of the various mutagenesis of 120ng is connected test kit (Roche Molec μ larBiochemicals) with rapid DNA be connected among the pPRONde with identical endonuclease digestion.Connecting mixture digests with the remaining carrier DNA that does not insert of linearizing with restriction endonuclease BamHI (New England Biolabs), use ethanol sedimentation as described, and be transformed into the ElectroMax DH10B Bacillus coli cells (Invitrogen of electroreception attitude, Carlsbad, CA) in.From each library comprise 15,000-20, the transformant of kantlex-resistance of 000 clone is scraped and is used the plasmid library of Plasmid Midi test kit (Qiagen) preparation mutagenesis from selected flat board.

In second method, based on people such as Xu (BioTechniques 27:1102-8,1999) Mn-dITP PCR method uses pET-KAM1 DNA as template and manganese-inductive fallibility PCR of initially taking turns with T7 promotor and T7 terminator zone homologous primer.This reaction mixture (50 μ L) comprises and has 2mM MgCl ₂1 * TaqPCR damping fluid, DNA, the 40 μ M MnCl of 100ng ₂, the various primers of 0.2 μ M, the various dNTP of 200 μ M and the Taq polysaccharase (Roche Molec μ lar Biochemicals) of 5 units.The PCR program is included in 94 ℃ of initial sex change of following 2 minutes; 94 ℃ 30 seconds, 54 ℃ of 1 minute and 72 ℃ of 20 circulations of 2.25 minutes; And 72 ℃ of final extensions of 7 minutes.

PCR product with 3 microlitres increases the template that PCR is taken turns in second of mispairing as use dITP during increasing.Second takes turns PCR mixture (100 μ L) comprises and has 2mM MgCl ₂Each primer, the various dNTP of 200 μ M and the TaqDNA polysaccharase of 10 units of dITP, 0.2 μ M of 1 * Taq polysaccharase PCR damping fluid, 40 μ M.The PCR program is identical with the program that is used for the first round, but is made up of 30 circulations.The PCR product separates on the 1%TAE-sepharose and uses QIAquick gel extraction method (Qiagen) purifying.The PCR product of purifying is with restriction enzyme NdeI and NotI digestion and be connected in the pPRO-Nde carrier of using identical enzymic digestion, gel-purified, and with shrimp alkaline phosphotase (Roche) dephosphorization acid.Ligation uses T4 dna ligase (New England BioLabs) to carry out 16 hours in 16 ℃, add 1 of other volume * connection damping fluid and ligase enzyme thereafter, and this reaction continues at room temperature 2 hours again.

With QIAquick PCR purification column purifying ligation liquid and elution in the water of 30 μ L.The reactant of 2 microlitres is transformed into intestinal bacteria Electromax ^TMDH10B ^TM(Life Technologies, Inc.) cell and being inoculated in the LB substratum that comprises 25 μ g/mL kantlex.Contrast connects and shows that background level (carrier that does not have insertion) is less than 3%.Carrying out multiple transforms to obtain about 40,000 clones.Scrape the clone and use Qiagen MiniSpin plasmid method to prepare plasmid DNA from flat board.Plasmid DNA is with ammonium acetate and the ethanol sedimentation concentration before with the host who improves it and screened being transformed into.Plasmid DNA is also separated from single clone and the mutation rate of order-checking to obtain to estimate.The average mutation rate of this method is the Nucleotide/Kb of 1.3 changes.

In the 3rd method, carry out mutagenesis PCR based on the method for Cadwell and Joyce (PCR Methods Appl.2:28-33,1992).This method is used and is comprised 21.2mM MgCl ₂, 2.0mM MnCl ₂, 3.2mM dTTP and 3.2mM dCTP the multiple diluent of mutagenesis damping fluid.Remove MgCl with 1.5mM ₂The pET-KAM1 template DNA of each dNTP, 50ng of each primer, 200 μ M of 1 * Taq PCR damping fluid, 0.25 μ M and the Taq archaeal dna polymerase (Roche) of 10 units outside, the mutagenesis damping fluid that adds following volume is to separate PCR reactant (final volume of each is 100 μ L): 0,1.56,3.13,6.25,12.5 and 25 μ L.The PCR program comprises 94 ℃ of initial sex change of 2 minutes; 94 ℃ 30 seconds, 54 ℃ of 1 minute and 72 ℃ of 30 circulations of 2.25 minutes; With 72 ℃ of final extensions of 7 minutes.

Behind the PCR, is that 5mM, SDS to 0.5% and Proteinase K to 50 μ g/mL processing reaction thing are to remove Taq polysaccharase (Mats μ Mura and Ellington by adding EDTA to final concentration, PCR Mutagenic PCR of Protein-Coding Genes for In Vitro Evolution.Methods in Molec μ lar Biology., Vol 182:In Vitro Mutagenesis, 2 ^NdEd.Ed.J.Braman Hamana.Press Inc.Totowa, NJ, 2001).With reactant be heated to 65 ℃ 15 minutes and use gel-purified as mentioned above.First four step is handled the PCR product that has produced competent clone.Digestion PCR product connects into pPRO-Nde and is transformed into intestinal bacteria Electromax ^TMDH10B ^TMIn the cell.Isolated plasmid dna and order-checking mutation rate from single clone to obtain to estimate.The average mutation rate that 1-4 handles changes (every Kb0-4.7 Nucleotide that changes) between 0-0.47%.Repeat to transform to obtain about 50,000 clones of selected processing.Scrape the clone and use Qiagen MiniSpin plasmid method to prepare plasmid DNA from flat board.With ammonium acetate and the ethanol sedimentation plasmid DNA concentration before with the host who increases it and screened being transformed into.

Embodiment 3

The mutagenesis in vivo of subtilis KAM gene

To import subtilis KAM gene (SEQ ID NO:3) in order suddenling change in vivo, pPRO-KAM1 to be delivered in intestinal bacteria XL1 Red (Stratagene) mutant strain.The plasmid pPRO-KAM1 of about 50ng is transformed into competent XL1-Red cell according to the guidance of manufacturers and transformant is inoculated in the LB substratum that comprises 25 μ g/mL kantlex.Select about 200 transformant at random, scrape and be inoculated into 2 portions of 5ml LB meat soups that comprise 25 μ g/ml kantlex from transforming flat board.A at 30 ℃, another part is 37 ℃ of grow overnight.

The one little aliquot sample of each part is inoculated in the fresh LB meat soup that comprises 25 μ g/ml kantlex, from each culture of 1.5ml, uses QiaSpin Mini test kit (Qiagen) to extract the plasmid DNA of mutagenic treatment simultaneously.Overnight growth and plasmid DNA are extracted and are repeated 2 times or more times, produce the plasmid library of mutagenic treatment with increasing by 3 circulations that are exposed to mutant strain from two kinds of different temperature.Plasmid DNA s concentrated by ethanol sedimentation before being transformed into selected bacterial strain.

Embodiment 4

The structure of intestinal bacteria Δ panD ∷ CAT bacterial strain

For identification code can be realized L-Ala 2, the gene of the polypeptide of 3-aminomutase reaction need effectively screen or select required activity.Therefore, the intestinal bacteria of using Beta-alanine to synthesize the pantothenic acid of the composition that is followed successively by coenzyme A (CoA) and acyl carrier protein (ACP) by identification have been improved screening method.CoA and ACP are acyl carriers main in the living organism body, and growth is absolutely necessary.

In intestinal bacteria, the main path of Beta-alanine comes from by the aspartic acid (Fig. 3) in the catalytic reaction of the aspartate decarboxylase of panD genes encoding (E.C.4.1.1.11).The functional deficiency sudden change of panD causes Beta-alanine auxotrophy and growth-inhibiting, and this can pass through to add the pantothenic acid or the Beta-alanine of external source, or alleviates by producing Beta-alanine from other source.

Two coli strains are used to the screening that the both lacks in Beta-alanine is synthetic.Bacterial strain DV1 (#6865, intestinal bacteria heredity original seed center, New Haven CT; Vallari and Rock, J.Bacteriol 164:136-42,1985) by the chemical mutagenesis preparation, all the become intestinal bacteria mutant of non-functional host (karyomit(e)) sudden change of two genes of panF and panD.The panF genes encoding is from the picked-up of substratum to pantothenic acid, so the Beta-alanine that is used to grow that is combined as of panD and panF provides stricter prerequisite.Therefore, although the DV1 bacterial strain is known, it is used for selecting to have L-Ala 2, and the purposes of the active cell of 3-aminomutase was not known in the past.

The bacterial strain of another selection, BW25113 Δ panD ∷ CAT comprises the disappearance of panD locus, with stop can panD suddenlys change when the Beta-alanine of no external source reverse mutation.These enter the bacterial strain that the panD locus has the inset that is endowed the chlorampenicol resistant mark by the CAT gene, quilt is by Datsenko and Wanner (Proc.Natl.ACAD.Sci. U.S. 97:6640-5,2000) gene inactivation method uses the coli strain BW25113/pKD46 and the BW25141/pKD3 at intestinal bacteria heredity original seed center to make up.

The CAT gene of pKD3 is used primer

TATCAATTCGTTACAGGCGATACATGGCACGCTTCGGCGCGTGTAGGCTGGAGCTGCTTC (SEQ ID NO:4) and

GATGTCGCGGCTGGTGAGTAACCAGCCGCAGGGATAACAACATATGAATATCCTCCTTAG (SEQ ID NO:5) increases, wherein underlined sequence corresponds respectively to the zone that is right after panD locus upstream and downstream in the escherichia coli chromosome, but not underlined zone is to allow amplification to comprise the segmental homology zone of gene among the pKD3.The PCR reaction solution is included in the every kind of primer of various dNTP, 0.2 μ M of 30 μ l 10 * spissated PCR damping fluid (Roche Molec μ lar Biochemicals) in the 300 μ l final volume, plasmid pKD3,0.2mM and the Taq polysaccharase (Roche Molec μ lar Biochemicals) of 15 units.PCR is reflected at 95 ℃ of incubations 30 seconds, be then 95 ℃ 30 seconds, 45 ℃ 30 seconds, 72 ℃ of 30 circulations of 1 minute, then in 72 ℃ 10 minutes.PCR product ethanol sedimentation with DpnI digestion, with QIAquick PCR purification kit (Qiagen) purifying, and is transformed among the BW 25113/pKD46 of express recombinant function.Transformant is inoculated on the LB flat board that comprises 25 μ g/ml paraxin and 5 μ M Beta-alanines.

By being supplemented with the non-selective LB substratum of 5 μ M Beta-alanines, in the transformant of 43 ℃ of mono-clonal purifying paraxin-resistances, and the maintenance situation of test sheet clone chlorampenicol resistant, the loss (showing the elimination of pKD46) of amicillin resistance and the needed Beta-alanine of in M9-glucosyl group basal culture medium, growing.The confirmation that the CAT gene correctly inserts the panD locus is by using side joint in the primer (TTACCGAGCAGCGTTCAGAG that inserts the site, SEQ ID NO:6 and CACCTGGCGGTGACAACCAT, SEQ ID NO:7) clone PCR of the Δ panD ∷ CAT bacterial strain that produces is carried out.When the PCR product of 713 base pairs of expection wild-type panD locus generation, Δ panD ∷ CAT construct produces the product of 1215 base pairs.(Datsenko and Wanner, Proc.Natl.Acad.Sci. U.S. 97:6640-5,2000) make up the derivative of Δ panD ∷ CAT bacterial strain as mentioned above, and wherein the CAT gene of Cha Ruing is removed by the activity of the FLP recombinase of being encoded by plasmid pCP20.These bacterial strains are called Δ panD.

Second approach of Beta-alanine be present in the intestinal bacteria based on the metabolic reduction approach of uridylic (West, Can.J.Microbiol.44:1106-9,1998, Fig. 2).In this approach, uridylic is reduced into dihydrouracil by enzyme dihydropyrimidine dehydrogenase (E.C.1.3.1.2).Dihydrouracil is converted into N-carbamyl-Beta-alanine by dihydropyrimidinase (E.C.3.5.2.2) then, and it is hydrolyzed to Beta-alanine, CO by N-carbamyl-Beta-alanine amidohydrolase (E.C.3.5.1.6) successively ₂And NH ₃In order to prevent to form Beta-alanine by this approach, with the gene of coding dihydropyrimidine dehydrogenase, yeiA (GenBank registration number No.AAC75208) inserts disappearance by the method for aforesaid Datsenko and Wanner.The CAT gene of pKD3 uses primer

GCGGCGTGAAGTTTCCCAACCCGTTCTGCCTCTCTTCTTCGTGTAGGCTGGAGCTGCTTC (SEQ ID NO:8) and

TTACAACGTTACCGGGTGTTCTTTCTCGCCTTTCTTAAACCATATGAATATCCTCCTT AG(SEQ ID NO:9) amplification, wherein underlined sequence corresponds respectively to the zone that escherichia coli chromosome is right after yeiA locus upstream and downstream, and not underlined sequence be with pKD3 in allow to comprise the regional homologous of the segmental amplification of CAT gene.The insertion mutant that separates paraxin-resistance as mentioned above, and resistance marker transduceed into Δ panD bacterial strain to produce the Δ panD/ Δ yeiA ∷ CAT of dual sudden change.

Produce the electroreception attitude cell of intestinal bacteria BW 25115 Δ panD ∷ CAT, Δ panD or Δ panD/ Δ veiA ∷ CAT and be used as the sudden change Methionin 2 that transforms as described in example 6 above, the host in 3-aminomutase DNAs library.

Embodiment 5

The clone and the vitro mutagenesis of porphyromonas gingivalis KAM gene

By from the genomic dna pcr amplification from Methionin 2, the 3 aminomutase genes of porphyromonas gingivalis and be cloned into NdeI and the NotI site of carrier pET22B (Novagen).Mutagenesis PCR is the method by Cadwell and Joyce (PCR Methods Appl.2:28-33,1992), is used for that the mutagenesis damping fluid of the T7 promotor that increases and T7 terminator primer and per 100 μ l reactants, 6.25 μ l or 9.38 μ l carries out.The PCR product is through gel-purified (Qiagen) and subsequently with NdeI and NotI digestion.The PCR product of digestion is connected in the pPRONde carrier and is transformed into intestinal bacteria Electromax as described in example 2 above ^TMDH10B ^TMCarrying out multiple transforms to obtain 60,000 clone of each sudden change processing at least.Scrape clone and preparation and precipitation plasmid DNA to improve its concentration from flat board.Resulting library has 0.3% and 0.35% mutation rate.

Embodiment 6

Has L-Ala 2, the active clone's of 3-aminomutase evaluation

With the Methionin 2 of the mutagenic treatment of generation in the foregoing description 2,3-aminomutase plasmid library is transformed into the coli strain DV1 cell of electroreception attitude.Transformant is inoculated among the LB of the suitable dilution that comprises 25 μ g/ml kantlex to obtain the estimated value of total transformant, and be inoculated into and be supplemented with 0.4% glucose, 0.2% VITAMIN and measure casamino acids (DIFCO/Becton Dickinson, Sparks, MD) and 25 μ g/ml kantlex (Sigma, St.Louis is in M9 minimum medium MO).For carrying out some screenings, add IPTG to 0.25mM.

With the colibacillary Δ panD ∷ CAT bacterial strain embodiment 2 described in the embodiment 4, the library that produces in 3 and 5 transforms in a similar fashion, be supplemented with 0.4% glucose and 25 μ g/ml kantlex (Sigma, St.Louis is in M9 minimum medium MO) except transformant is inoculated into.For screening subtilis library, add IPTG to 0.25mM, add Fe ₂(NH ₄) ₂SO ₄To 50 μ M and add paraxin to 25 μ g/ml.Literary composition screens the porphyromonas gingivalis storehouse, and IPTG is added to 50 μ M, Fe ₂(NH ₄) ₂SO ₄Be added to 50 μ M, paraxin is added to 25 μ g/ml, and the L-L-Ala is added to 1mg/ml and L-Methionin is added to 2mg/ml.

Measure by clone's number of growing on the LB that adds 25 μ g/ml kantlex, that grows on the minimum medium flat board is approximately 1 * 10 with respect to the transformant sum ^-4The transformant of frequency.Use Qiagen Miniprep test kit to prepare plasmid DNA and it is transformed into colibacillary Δ panD ∷ CAT bacterial strain again to confirm that the ability that can grow is to be endowed by the function that plasmid carries under the situation that lacks Beta-alanine from the clone who grows on the minimum medium.From the clone who transforms again prepare plasmid DNA and to the kam gene sequencing with any variation of decision with respect to wild-type subtilis or porphyromonas gingivalis kam gene order.

Coding L-Ala 2, the subtilis kam gene order of the sudden change of 3-aminomutase is presented among the SEQ ID NO:20 and amino acid sequence corresponding is presented among the SEQ ID NO:21.The plasmid that carries these sequences is called as pLC4-7LC1.Compare with wild-type subtilis kam gene order (Fig. 4), in the sequence of sudden change, observe 3 seed amino acids and change.At L-Ala 2, L103M replacement, M136V replacement and D339H replacement are arranged in the 3-aminomutase albumen, and (wherein first amino acid is wild-type sequence, numeral is amino acid whose position, and second amino acid is at L-Ala 2, observed sequence in the 3-aminomutase sequence).FeS bunch-binding motif (the amino acid/11 34-146 of SEQ ID NO:21) and the PLP-binding motif (the amino acid 288-293 of SEQ ID NO:21) of inferring are also shown among Fig. 4.This is a L-Ala 2, and first of 3-aminomutase nucleic acid and aminoacid sequence shows card.Coding L-Ala 2, the porphyromonas gingivalis kam gene order of the sudden change of 3-aminomutase is presented among the SEQ ID NO:29 and amino acid sequence corresponding is presented among the SEQ ID NO 30.Compare with wild-type porphyromonas gingivalis sequence (Fig. 5), in the sequence of sudden change, observe 5 seed amino acids and change.At L-Ala 2, there are N19Y replacement, L53P replacement, H85Q replacement, D331G replacement and M342T to replace in the 3-aminomutase albumen.Yet, may not be these all sudden changes be to have L-Ala 2,3-aminomutase activity is necessary.In the sequence alignment of subtilis and porphyromonas gingivalis mutain, porphyromonas gingivalis D331G replaces the position (Fig. 6) that is positioned at the active site of protein consistent with subtilis D339H replacement, and this shows it may is particularly important.FeS bunch-binding motif (the amino acid/11 26-138 of SEQ ID NO:30) and the PLP-binding motif (the amino acid 280-285 of SEQ ID NO:30) of inferring are also shown among Fig. 5.This is a L-Ala 2, and another of 3-aminomutase nucleic acid and aminoacid sequence shows card.

The kam gene of sudden change can be converted into α-Bing Ansuan Beta-alanine and therefore allow to produce the ability of pantothenic acid, is by the growth of Δ panD transformant in comprising the minimum medium of pantothenic acid and the growth phase liquid growth test relatively in the substratum that lacks pantothenic acid are determined.Initial inoculum comprises from the washed cell of grown culture or the cell that scrapes from flat board.

As the example of the cell that uses washing as inoculum, the 3-5mL culture begin by mono-clonal and in the LB meat soup that adds 40 μ g/ml kantlex in 30 ℃ of grow overnight.Read the OD of culture ₆₀₀And the cell of the equivalent number by every kind of culture of centrifugal results (about 600 total OD * μ l, for example OD4.0 * 150 μ l).Cell is resuspended among the NaCl of 200 μ l 0.85% with 0.85% NACl washed twice, and use 30 μ l diameter as the glass test tube of 13mm in about 0.05 initial OD ₆₀₀Be inoculated in (6g/L Na in the minimum medium of 3ml based on M9 ₂HPO ₄, 3g/L KH ₂PO ₄, 0.5g/L NaCl, 1g/L NH ₄Cl, 2mM MgSO ₄, 4g/L glucose, 1mM CaCl ₂, 250 μ M IPTG, 40 μ g/ml kantlex, 50 μ M Fe (NH ₄) ₂(SO ₄) ₂).Control cultures comprises the minimum medium that is supplemented with 20 μ M pantothenic acid or the LB meat soup of 40 μ g/ml kantlex is arranged.Culture did not shake growth about 18 hours and measured OD in 37 ℃ ₆₀₀

As shown in table 1, in the minimum medium that is not added with pantothenic acid or Beta-alanine, use remaining pantothenic acid or the Beta-alanine of preserving to grow to 0.21 average OD although carry the cell of vehicle Control ₆₀₀(the OD that obtains when having pantothenic acid ₆₀₀About 30%), carry 2,3-aminomutase clone's cell grows to 0.50 average OD ₆₀₀, be obtained when having pantothenic acid about 90%.Add Fe ²⁺Do not increase the growth of vehicle Control cell, but allow L-Ala 2,3-aminomutase-tolerance cell obtains and the stand density that equates that has pantothenic acid or obtained in being rich in the LB broth culture.This shows L-Ala 2, and 3-aminomutase gene provides the source of the Beta-alanine of additional panD sudden change.

Table 1: growth test

Substratum

Plasmid	Replicon	Substantially	Substantially+Fe 2+	Substantially+pantothenic acid	?LB
						? ?pPRONde ? ?pLC4-7LC1 ?	? ??1 ??2 ??1 ??2	? ??0.206 ??0.217 ??0.458 ??0.460	? ??0.210 ??0.209 ??0.550 ??0.541	??(OD 600) ??0.670 ??0.683 ??0.522 ??0.576	? ?0.647 ?0.640 ?0.572 ?0.552

As the example that uses plate culture as inoculum, scrape the minimum medium of cloning and be resuspended in 50 μ l shortage pantothenic acid from flat board.Use suspension (20 μ l) to be seeded in the 1mL minimum medium in the little test tube of 1.5mL and to use 20 μ l to inoculate in the 1mL minimum medium that is supplemented with pantothenic acid.The latter's culture is as the contrast of the varied number of inoculum adding.The reaction of the culture of no pantothenic acid growth can be expressed as the ratio of the growth on the growth on the substratum that lacks pantothenic acid and the substratum that is comprising pantothenic acid.Culture shook growth 1-3 days and measured OD in 25-37 ℃ of nothing ₆₀₀Obtain the test of more anaerobic growths to bigger degree by the filling test tube.This is useful in the test of porphyromonas gingivalis mutant.

Table 2: the clone who scrapes/half anaerobic test.

	?OD 600：M9	??OD 600: M9+ pantothenic acid	?OD 600：M9/OD 600: the ratio of M9+ pantothenic acid
				??Pg?aam ??Pg?aam ??Pg?aam ??Pg?aam ??Pa?aam ??Pg?aam ??pPRONde ??Bs?aam ??Bs?aam ??Pg?kam ??Pg?kam	?0.711 ?0.617 ?0.702 ?0.712 ?0.689 ?0.719 ?0.148 ?0.783 ?0.777 ?0.064 ?0.195	??0.791 ??0.77 ??0.811 ??0.879 ??0.843 ??0.851 ??0.824 ??0.801 ??0.838 ??0.792 ??0.876	?0.90 ?0.80 ?0.87 ?0.81 ?0.82 ?0.84 ?0.18 ?0.98 ?0.93 ?0.08 ?0.22

Pg aam=has the plasmid and the L-Ala 2 of the porphyromonas gingivalis kam gene of the sudden change of carrying, the active cell of 3-aminomutase

Bs aam=has the plasmid and the L-Ala 2 of the subtilis kam gene of the sudden change of carrying, the active cell of 3-aminomutase

Pg kam=has the cell of the plasmid that carries wild-type porphyromonas gingivalis kam gene

Embodiment 7

Subtilis Methionin 2, the generation of idiovariation in the 3-aminomutase

At the wild-type subtilis Methionin 2 of the foregoing description 5, the sudden change of identifying in the 3-aminomutase gene is at wild-type subtilis Methionin 2, uses Stratagene QuikChange in the 3-aminomutase gene (SEQ ID NO:3) ^TMThe Site-Directed test kit makes up separately.The oligonucleotide that is used to produce the L103M sudden change is:

CACAAAACAAAATACGATATGGAAGACCCGCTCCATGAGGATGAAGATTCA (SEQ ID NO:10), and TGAATCTTCATCCTCATGGAGCGGGTCTTCCATATCGTATTTTGTTTTGTG (SEQ ID NO:11).

The oligonucleotide that is used to produce the M136V sudden change is:

GAATCAATGTTCCGTATACTGCCGCTAC (SEQ ID NO:12) and

GTAGCGGCAGTATACGGAACATTGATTC(SEQ?ID?NO：13)。

The oligonucleotide that is used to produce the D339H sudden change is:

GTTCCTACCTTTGTTGTACACGCACCAGGCG (SEQ ID NO:14), and CGCCTGGTGCGTGTACAACAAAGGTAGGAAC (SEQ ID NO:15).

Use the liquid growth test of describing among the embodiment 6, cell with the plasmid that carries the L103M sudden change separately can be grown in the minimum medium that does not add pantothenic acid or Beta-alanine, yet different with the cell degree with pLC4-7LC1 plasmid, the cell that carries M136V or D339H sudden change separately has host's Δ panD phenotype.The L103M sudden change is identical with the combination results and the pLC4-7LC1 of M136V and D339H sudden change in wild-type subtilis kam sequence, give the gene of the ability of in lacking Beta-alanine or pantothenic acid, growing, confirm these 3 the sudden change or its subgroup close for giving L-Ala 2,3-aminomutase activity is sufficient.

It will be understood by those skilled in the art in these positions and can produce selectable replacement.Therefore use similar with 11 to SEQ ID NOS:10, and be at random oligonucleotide wherein, can obtain to have L103K, L103R, L103E and L103S replace gives the mutant of the ability that Δ panD bacterial strain can grow when lacking Beta-alanine or pantothenic acid corresponding to the codon of L103.Further, use similar with 15 to SEQ ID NO:14, be at random oligonucleotide wherein, obtain to have D339Q, D339T, D339N replaces gives the mutant of the ability that Δ panD bacterial strain can grow when lacking Beta-alanine or pantothenic acid corresponding to the codon of D339.

Embodiment 8

Do not use the Methionin 2 of mutagenic treatment, the 3-aminomutase

To L-Ala 2, the screening that 3-aminomutase activity is carried out

Evaluation has L-Ala 2, the selectable method of the active cell of 3-aminomutase be with aforesaid such as DV1 or Δ panD ∷ CAT cell inoculation in aforesaid substratum, and without the Methionin 2 of mutagenic treatment, the storehouse transfection of 3-aminomutase they.Screen this cell as mentioned above, and as the checking L-Ala 2 described in embodiment 6 and 9, the active existence of 3-aminomutase.

Cell can be before inoculation mutagenic treatment, for example by with cellular exposure in uviolizing or chemical preparations (for example MES).This allows to separate to have at one or more to cause cell to have L-Ala 2, the sudden change in active other gene of 3-aminomutase.

Selectively, cell can be unaltered (for example unconverted, not mutagenic treatment) before inoculation.This method allows to separate abiogenous have L-Ala 2, the active bacterial strain of 3-aminomutase.

Embodiment 9

L-Ala 2, the proof of 3-aminomutase

The L-Ala 2 of the cell that the above-mentioned sieve method of upchecking obtains, 3-aminomutase activity.For storehouse (embodiment 2, the 3 and 5) cell transformed with mutagenic treatment, the molecular biology method that uses standard is from selected host's separation quality grain.Resulting plasmid is transformed among the selected host again, separation quality grain again, and as be shown in the examples resulting clone is checked order.For unconverted cell (embodiment 8), for example use shotgun cloning to give L-Ala 2, the active gene of 3-aminomutase.

Can use some measuring methods to detect L-Ala 2,3-aminomutase activity is such as by [3- ¹³C] L-Ala process [3- ¹³C] Beta-alanine mensuration [ ¹³C] biosynthesizing of coenzyme A, by use measure transform α-Bing Ansuan to Beta-alanine enzyme activity determination, or measurement carries L-Ala 2, the cell of 3-aminomutase obtains the mensuration that the existence of Beta-alanine in the cell extract is carried out.

From [3- ¹³C] α-Bing Ansuan process [3- ¹³C] Beta-alanine carry out [ ¹³C] biosynthesizing of coenzyme A

The insertion disappearance of the Δ panD gene of Beta-alanine is produced in its gene product (Aspartate 1-decarboxylase) catalysis from aspartic acid, cause the shortage of pantothenic acid and can not produce coenzyme A thus.Yet, have L-Ala 2,3-aminomutase and can walk around this shortage by the Δ panD cell that α-Bing Ansuan produces Beta-alanine; Especially, there is [3-when these cells ¹³C] α-Bing Ansuan when growth, can with [ ¹³C] mark mixes coenzyme A.This test confirms isolating subtilis L-Ala 2 in embodiment 6,3-aminomutase sequence (SEQ ID NOS:20 and 21) but the catalysis α-Bing Ansuan to the conversion of Beta-alanine.

The intestinal bacteria Δ panD/ Δ yeiA ∷ CAT cell that transforms with pPRONde, pPRO-KAM1 or pLC4-7LC1 is removing 25 μ g/ml kantlex and 10 μ M Fe (NH ₄) ₂(SO ₄) ₂With (embodiment 6) in the minimum medium outside 1mM L-Ala (unlabelled) and the 10 μ M Beta-alanines in 37 ℃ of grow overnight.This culture had 25 μ g/ml kantlex, 10 μ M Fe (NH ₄) ₂(SO ₄) ₂And 11mM[3- ¹³C] and α-Bing Ansuan (99%, Cambridge isotopic laboratory, Andover MA) does not still have the minimum medium of unlabelled α-Bing Ansuan or Beta-alanine to dilute 100 times.30 ℃ of growths are after about 20 hours, by centrifugal recovery cell and by Jaskowski and Rock (bacteriology magazine J.Bacteriol.148:926-32,1981) method produces extract, the thioesters of coenzyme A is converted into the form of free sulfhydryl group when having the 10mM dithiothreitol (DTT).

This extract uses and comprises that the Waters2690 liquid chromatograph Micromass Ultima LC/MS system with Waters996 photodiode array detector (PDA) the light absorption ratio monitor that is series between chromatographic instrument and the triple quadrupole mass spectrograph series analyzes.Use YMC ODS-AQ (3 μ M particles, 120_ hole) the reversed phase partition chromatography post of 4.6 * 150mm at room temperature to produce the LC separation.The acetonitrile (BufferB) that use comprises the aqueous 25mM ammonium acetate (BufferA) of 0.5% (v/v) acetate and comprises 0.5% (v/v) acetate carries out the gradient elution of analyte.This elution in isoconcentration 10%B 0-10 minute is then linear 10%B in the 100%B 10-12 minute.Flow velocity is 0.250mL/min, and the UV light absorption ratio of regulation and control photodiode array is from 200nm to 400nm.All parameters of this electrospray MS system are optimized, and based on the protonated molecular ion ([M+H] that produces the goal analysis thing ⁺) and production characteristic fragment ions select.The ESI-MS that uses following instrument parameter to carry out the positively charged ion mode of coenzyme A detects: kapillary: 4.0V; Cone: 80V; Hexagon 1: 25V; Hole: 0V; Hexagon 2: 0V; Source temperature: 100 ℃; Precipitation temperature: 350 ℃; Precipitation gas: 500L/h; Cone gas: 40L/h; Low-quality resolving power: 15.0; High-quality resolving power: 15.0; Ion energy: 0; Multiplication: 650.The uncertainty of report mass ratio (m/z) and molecular mass is 0.01%.The peak area of m/z 769 ([13C] coenzyme A) and the ratio of m/z 768 (unlabelled coenzyme A) are presented in the table 3.

Table 3:[ ¹³C] biosynthesizing of coenzyme A

Plasmid or sample	Ratio m/z=769: m/z=768
		Coenzyme A standard pPRONde PPRO-KAM1 pLC4-7LC1	?????0.26 ?????0.36 ?????0.53 ?????1.90

Result displayed confirms to have the L-Ala of carrying 2 in the table 3, the cell of the plasmid of 3-aminomutase activity (SEQID NOS:20 and 21) sudden change, when grow in [ ¹³C] in the α-Bing Ansuan time, with normal abundance [ ¹³C] coenzyme A or have carrier or wild-type subtilis Methionin 2, the cell of 3-aminomutase gene compare generation higher [ ¹³C] coenzyme A than [ ¹²C] ratio of coenzyme A.This proves L-Ala 2, and 3-aminomutase sequence can be created in intermediate product essential in the coenzyme A biosynthesizing, Beta-alanine.

Enzymatic determination

The mensuration α-Bing Ansuan exists to determine whether cell has L-Ala 2,3-aminomutase activity to the conversion or the mensuration Beta-alanine of Beta-alanine.For example, can use definite Methionin 2 that people (journal of biological chemistry Biochem.J.348:539-49,2000) such as Chen describes, the active method of 3-aminomutase by with the enzyme or the cell extract incubation of reductibility preincubation, replace L-[U- ¹³C] L-Ala is L-[U- ¹³C] Methionin, and separate radioactive α-Bing Ansuan and Beta-alanine by paper electrophoresis, scintillation counting is equivalent to the spot of α-Bing Ansuan and Beta-alanine respectively subsequently, thereby determines L-Ala 2,3-aminomutase activity.Selectively, purifying and L-Ala 2 reductibility preincubation, the 3-aminomutase can with the α-Bing Ansuan incubation, and this reaction mixture separates to come from α-Bing Ansuan separated product Beta-alanine by high performance liquid chromatography, and product carried out quantitative analysis (people such as Abe, J.Chromatography B, 712:43-9,1998).

Also can in the complete cell of intestinal bacteria Δ panD:CAT bacterial strain, monitor and form Beta-alanine, by cell is being comprised 0.4% (w/v) glucose, 25 μ g/ml kantlex (giving the plasmid of kalamycin resistance), 0.25mM IPTG and 1mg/ml[by α-Bing Ansuan ¹³C]-the M9 minimum medium of the α-Bing Ansuan of mark in (people such as Sambrook, molecular cloning: laboratory manual Molec μ lar Cloning:Alaboratory Manual, the cold spring port, New York, 1989) cultivate, and with expressing L-Ala 2, the plasmid of 3-aminomutase transforms, extract this cell and by well known to a person skilled in the art high performance liquid chromatography/mass spectrometry method detect [ ¹³C]-beta Alanine.

Embodiment 10

Be used for the operon for synthesizing that 3-HP produces from Beta-alanine

Produce the biosynthetic pathway (figure .1) that allows to produce 3-HP through Beta-alanine.A kind of approach from the Beta-alanine to 3-HP comprises that utilization has the polypeptide of CoA transferase active, promptly from the enzyme that the CoA group is delivered to alternative enzyme from a kind of metabolite.As shown in Figure 1, Beta-alanine can use the CoA donor of polypeptide with CoA transferase active and for example acetyl-CoA or propionyl-CoA and be converted into β-alanyl-CoA.Selectively, β-alanyl-CoA can produce under the effect of the polypeptide with CoA synthase activity.β-alanyl-CoA can be deaminized to form acryloyl-CoA by having β-alanyl-active polypeptide of CoA ammonia lyase.Can carry out the hydration of acryl-CoA and produce 3-HP-CoA by having the active polypeptide of 3-HP-CoA dehydratase in the β position.3-HP-CoA can be used as the CoA donor that is used for Beta-alanine, and the polypeptide catalysis of the available CoA of the having transferase active of this reaction produces the 3-HP product.Selectively, 3-HP-CoA can produce 3-HP by the polypeptide hydrolysis with special CoA hydrolytic enzyme activities.

These approach use as among the WO02/42418 (being hereby incorporated by) or some enzymes of what follows cloning and expressing.Use the huge ball-type bacterium of Erichsen (Megasphaera elsdenii) cell (ATCC 17753), orange green bacterium (Chloroflexus aurantiacus) cell (ATCC 29365) of subduing, clostridium propionicum (Clostridium propionicum) (ATCC 25522), clostridium acetobutylicum (Clostridium acetobutylicum) (ATCC 824), Pseudomonas aeruginosa (Pseudomonas aeruginosa) (ATCC 17933), subtilis (Bacillus subtilis) (ATCC 23857), Alcaligenes faecalis (Alcaligenes faecalis) (ATCC 25094), and rat cdna (Clontech, Palo Alto is CA) as the source of DNA.It should be appreciated by those skilled in the art that the sequence that to use similar method to obtain these enzymes from any organism.

Before the structure of operon, clone, express and analyze independent gene.To be used for being cloned into pET-11a (5.7kb) expression vector that is arranged under T7 promotor (Novagen) control at the operon for synthesizing of intestinal bacteria production 3-HP, has lac/ara-1 promotor (Clontech, Palo Alto, CA) in pPROLar.A (2.6kb) carrier, and has a trc promotor (Pharmacia Biotech, Uppsala, Sweden) in pTrc99A (4.2kb) carrier.Some operons with genes involved of various combination produce as follows.Analysis for propionyl-CoA transferring enzyme and acryloyl-CoA hydratase (or 3-HP dehydratase) is described among the WO02/42418 (being hereby incorporated by).

Separation from the 3-HP dehydrogenase gene of Alcaligenes faecalis M3A

Alcaligenes faecalis (ATCC #700596) is the saline and alkaline bacterium through 3-HP metabolism acrylate.The 3-HP that is produced by acrylate can be converted into malonic semialdehyde by the 3-HP desaturase.In order to separate the gene of these desaturases of encoding, following separation Alcaligenes faecalis genomic dna.In 37 ℃ of growths, the cell with results is resuspended in the 400mL TE damping fluid Alcaligenes faecalis culture of 5mL then in trypticase soy broth.Subsequently the Proteinase K of 10%SDS, the 100 μ l 10mg/ml of 20mL and 10mL 100mg/ml N,O-Diacetylmuramidase are added cell suspension and with mixture 42 ℃ with interim mixture incubation 2 hours.Add 150mL phenol and this mixture was shaken 2 hours in 37 ℃ at least to this mixture, add about 800mL chloroform then.This mixture was by centrifugal 30 minutes of vortex mixed and 15000rpm.The upper strata water is changed in clean little centrifuge tube, use the NaOAc of 60mL 3M to reclaim with the ethanol sedimentation DNA of about 1mL and by rotor.This DNA is with 400mL TE damping fluid resuspension and add the RNase of 20mL 200mg/ml, and this mixture was in 37 ℃ of incubations 1 hour then.This DNA is with NaOAC and ethanol redeposition, and the ethanol rinsing with 70% several times and be resuspended in the TE damping fluid.

Design the primer of following sex change according to the conservative region of disclosed 3-dehydrogenase gene known amino acid sequence, this gene expection and required 3-HP desaturase homology.APHPDHF1：

5′TTYATYGGBYTSGGBAAYATGGG3(SEQ?ID?NO：16)；

AFHPDHF2：

5 ' GAYGCNCCNGTBWSSGGBGG3 ' (SEQ ID NO:17); And AFHPDHR2:

5′CATRTTRTTRCARATYTTNGC3′(SEQ?ID?NO：18)。Use the Alcaligenes faecalis genomic dna to use Taq archaeal dna polymerase (Roche) according to the explanation of manufacturers, use SEQ ID NOS:16 and 18 (reaction A) or SEQ ID NOS:17 and 18 (reaction B) to carry out the PCR reaction as template.The PCR program comprises 94 ℃ of initial incubations of 2 minutes, 94 ℃ of 4 round-robin, 30 seconds; 56 ℃, 45 seconds, 72 ℃ 3 minutes; 94 ℃ of 4 round-robin, 30 seconds; 54 ℃, 45 seconds, 72 ℃ 3 minutes; 94 ℃ of 4 round-robin, 30 seconds; 52 ℃, 45 seconds, 72 ℃ 3 minutes; 94 ℃ of 4 round-robin, 30 seconds; 50 ℃, 45 seconds, 72 ℃ 3 minutes; With 94 ℃ of 16 round-robin, 30 seconds; 47 ℃, 45 seconds, 72 ℃ 3 minutes, be 72 ℃ of last incubations of 7 minutes then.Two reactions all produce the product of about 500bp.The PCR product gel separation of reaction A is cloned among the pCR11 and is transformed in the cell of TOP10 chemoreception attitude, screens comprising on the LB substratum of 50mg/ml kantlex.Selection has the clone that correct size is inserted, and separates its plasmid and order-checking.Specificity nested primer according to the following gene of these sequences Design: GWHPDF1:

5′GGTTTACGAGGGCGAGAACGGCTTGCT3′(SEQ?ID?NO：19)；

GWHPDF2：5′CAAGCTGGGTCTGTTCATGCTGGATG3′(SEQ?ID?NO：26)；

GWHPDR1:5 ' AAGCGGTTCTCGCCCTCGTAAACCTGA3 ' (SEQ ID NO:27); With

GWHPDR2:5 ' CGCATTCAAGTCAAAGACGTTCAGGCTA3 ' (SEQID NO:32), and use the complete ORF of genome pacing technical point from the gene of coding 3-HP desaturase.The sequence of this ORF is presented among the SEQ ID NO:33, and the corresponding proteins sequence is presented among the SEQ ID NO:34.The initiator codon of 3-HP desaturase goes at the rrna-binding site of 408 of SEQ IDNO:33 and 397-403 position by being positioned at SEQ ID NO:33.Terminator codon is positioned at 1304 of SEQ ID NO:33.

Clone, expression and the analysis of L-Ala-COA ammonia lyase (ACL)

From two acl genes of clostridium propionicum clone, acl-1 (SEQ ID NO:22) coding 145 amino acid whose albumen (SEQ ID NO:23) and acl-2 (SEQ ID NO:53) coding 144 amino acid whose albumen (SEQ ID NO:54).These two kinds of albumen are height homologous and 8 amino acid differences having only the C-end.Acl-1 and acl-2 gene use following primer to clone:

Be used to clone the OsaclNdeF of acl-1:

5 '-GGGAATTCCATATGGTAGGTAAAAAGGTTGTACATC-3 ' (SEQ ID NO:35), and OsaclBamR:

5 '-GACGGATCCATTCGTCCGCTTGAATAACTAAAG-3 ' (SEQ IDNO.36) and

Be used to clone SEQ ID NO:35 and the OSacl2BamR of acl-2:

5′-CGACGGATCCCGAAAATGTCACCAAAAATTATTGAG-3′(SEQ?ID?NO：37)。Resulting sequence is cloned in the pET11a carrier that digests with Ndel and BamHI.Resulting plasmid pACL-1 and pACL-2 are transformed in BL21 (DE3) cell.The BL21 (DE3) that carries pET 11a (contrast), pACL-1 and pACL-2 is grown in the 10ml LB substratum that is supplemented with 50 μ g/ml Pyocianils to OD ₆₀₀-0.5 and induced 4 hours with 100 μ M IPTG.By Avanti J20 whizzer (Beckman, Fullerton, CA) in the centrifugal collection inductive of 3500rpm cell, and according to the explanation of manufacturers (Novagen, Madison WI) handle with Bug Buster.After acryloyl-CoA is converted into Beta-alanine-CoA (reversed reaction is corresponding to the approach among Fig. 1), resulting cell extract is used for enzyme activity determination.

Analysis of mixtures comprises the TAE of 10 μ l 1M, the NH of 20 μ l 1M ₄The H of acryloyl-COA of Cl, 2 μ l, 100 μ M, 10 μ l cell extracts and 158 μ l ₂O.The enzymatic reaction thing stops 37 ℃ of incubations 5 minutes and by the TFA that adds 200 μ l 10%.With mixture be loaded into C18 Sep-Pak Vac Icc post (Waters, Milford, MA) on, with the acetonitrile of 200 μ l 40%, 0.1% TFA elution and by at Speed Vac (Savant Instr μ Ments, Holbrook, centrifugal in NY), make volume be reduced to 100 μ l.The formation of β-alanyl-CoA uses the method for standard to detect by LC-MS.ACL-1 and ACL-2 enzyme all have activity and are used to the structure of Beta-alanine operon.

Clone, expression and analysis from colibacillary CoA transferring enzyme

By pcr amplification open reading frame yfdE (albumen that in the PubMed database, is defined as supposing).

Because this open reading frame has two potential initiation sites, use following primer clone and express two genes: the yfdE gtg nde sen that is used for yfdE-1

(5 '-AGAGAGCATATGTCTTTTCACCTTCGGC-3 '; SEQ ID NO:38) and

yfdE?atg?nde?sen

(5 '-AGAGAGGGATCCGCGGCTCCCACAATGTTGAAATG-3 ' SEQID NO:39) and

YfdE gtg nde sen (SEQ ID NO:38) and the yfdE bam antisense of yfdE-2

(5′-AGAGAGCATATGACAAATAATGAAAGCAAAGG-3′，SEQID?NO：40)。

Use is used as the template of utilizing the PCR that Pfu Turbo (Stratagene) carries out from the chromosomal DNA of intestinal bacteria MG1655, uses following PCR condition to carry out: 94 ℃ 5 minutes; 94 ℃ of 25 round-robin 30 seconds, 55 ℃ of 30 seconds and 72 ℃ 2 minutes 20 seconds are then 72 ℃ of incubations 7 minutes.The PCR reactant uses QIAquick PCR purification kit (Qiagen) purifying, with NdeI and BamHI digestion and be cloned among the pET28b (Novagen) of usefulness same restrictions enzymic digestion, and is transformed in the TOP10 cell (Invitrogen) of chemoreception attitude.Separation is from the plasmid of positive colony and be transformed in BL21 (DE3) express cell (Novagen).Cell grows into OD in 37 ℃ in the LB substratum ₆₀₀.6, induce with the IPTG of 100 μ M and inducing the back incubation other 3 hours.Wash once by this cell of centrifugal results and with 0.85%NaCl.The cell granulations precipitation is stored in-80 ℃ up to further use.

Cell granulations is deposited on ice and thaws, and is resuspended in the 4ml binding buffer liquid (NovagenHisBind purification kit).This cell (10000psi) comes cracking with three-step approach by French Pressure Cell (SLM Aminco).Cell debris is removed by centrifugal (30,000 * g 30 minutes).This extract filters in the syringe filter that the explanation according to manufacturers is loaded into the preceding usefulness 0.45 μ m of Quick900 cylinder (Novagen).The albumen of purifying uses the explanation desalination of PD-10 post (Pharmacia) according to manufacturers.Employed damping fluid is the citric acid, the NaH of 5mM of Tris, 5mM of boric acid, the 5mM of 5mM ₂PO ₄PH7.0.

Use comprises the 100mM potassiumphosphate, and pH7.0, the Beta-alanine of 100mM, the CoA transferring enzyme of 1mM acetyl-CoA and 20 μ l purifying, bulk analysis volume are the albumen that the reaction mixture of 200 μ l is analyzed purifying.Reactant is incubation 20 minutes at room temperature, uses the trifluoroacetic acid (TFA) of 100 μ l 10% to stop subsequently.Reactant uses 1 cc SepPak Vac cylinder, and (WatersMilford is MA) with 1ml methyl alcohol purifying, and with the TFA washed twice of 1ml 0.1%.Apply sample and with twice of the TFA of 1ml 0.1% washing cylinder.Sample is dried to 1/2 volume with the acetonitrile elution of the 200 μ l 40% that comprise 0.1%TFA in rotatory evaporator, and by liquid chromatography/analytical reagent composition.With yfdE-1 or the yfdE-2 analysis of protein peak corresponding to the prospective quality of β-alanyl-CoA, and this peak do not exist in the contrast of this purifying protein of disappearance, and this shows that the CoA transferring enzyme has determined that β-alanyl-CoA's is synthetic.

Operon 1 and 2:ACL-propionyl-CoA transferring enzyme-acryloyl-CoA hydratase

Structure is used for following conversion: Beta-alanine to β-alanyl-CoA to acryloyl-CoA to the operon of 3-HP.By the gene of PCR amplification coding CoA transferring enzyme from the genomic dna of the huge ball-type bacterium of Erichsen, use primer OSNBpctF (5 '-GGGAATTCCATATGAGAAAAGTAGAAATCATTACAGCTG-3 '; SEQ ID NO:41) and OSHTR (OSHTR:5 '-ACGTTGATCTCCTTCTACATTATTTTTTCAGTCCCATG-3 '; SEQ ID NO:42).

By PCR amplification CoA hydratase gene from orange green genomic dna of subduing bacterium, use primer OSTHF (5 '-CATGGGACTGAAAAAATAATGTAGAAGGAGATCAACGT-3 '; SEQ ID NO:43) and OSHBR (5 '-CGACGGATCCTCAACGACCACTGAAGTTGG-3 '; SEQ ID NO:44).

From acetone clostridium gene group dna clone ACL-1 and ACL-2 (Beta-alanine-CoA ammonia lyase) gene, the primer of amplification acl-1 is right: OsaclXbaF (5 '-CTAGTCTAGAGCTTTCTAAGAAACGATTTCCG-3 '; SEQ ID NO:45) and OSaclNdeR (5 '-GGGAATTCCATATGCGTAACTTCCTCCTGCTATCATTCACCGGGGTGCTTTCT-3 '; SEQ ID NO:46); The primer of amplification acl-2 is right:

OSacl2XbaF (5 '-CTAGTCTAGAGGAAACCGCTTAACGAACTC-3 '; SEQ ID NO:47) and OSacl2-2NdeR (5 '-GGGAATTCCATATGCGTAACTTCCTCCTGCTATTATTGAGGGTGCTTTGCATCC-3 '; SEQ ID NO:48).

In Perkin Elmer 2400 thermal cyclers, use Pfu Turbo polysaccharase (Stratagene) to carry out PCR according to the guidance of manufacturers.PCR carries out under following condition: 94 ℃ of initial denaturing steps of 2 minutes; 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ of 25 round-robin 2 minutes; Last 72 ℃ were extended 7 minutes.Resulting PCR product uses Qiagen Gel Extraction test kit, and (Qiagen Inc.) carries out gel-purified.

The PCR product of CoA-transferring enzyme and CoA hydratase is common assembling in assembling PCR.OSTHF and OSHTR primer (SEQ ID NOS:42 and 43) are complimentary to one another, and this just allows complementary DNA end to anneal mutually and two-way extended DNA in PCR.For the efficient that guarantees to assemble and increase thereafter, two terminal primer OSNBpctF and OSHBR (SEQ ID NOS:41 and 44) are added in the assembling PCR mixture of the PCR product of the CoA-transferring enzyme that comprises the 100ng purifying and CoA-hydratase and rTth polysaccharase (Applied Biosystems, Foster City, CA) that ratio is 8: 1 and Pfu Turbo polysaccharase (stratagene) mixture.The polysaccharase mixture is guaranteed the high frequency high fidelity of PCR reaction.Assembling PCR carries out under following condition: 94 ℃ of initial denaturing steps of 1 minute; 94 ℃ of 20 round-robin 30 seconds, 54 ℃ 30 seconds, 68 ℃ 2.5 minutes; 68 ℃ of final extensions of 7 minutes.Digest with gel-purified assembling PCR product and with NdeI and BamHI as mentioned above.Assembling PCR product is introduced with OSNBpctF (NdeI) and OSHBR (BamHI) primer (SEQ ID NOS:41 and 44) in the site of these Restriction Enzymes.The PCR product of digestion is at 80 ℃ of incubations 30 minutes (making the Restriction Enzyme inactivation) and be directly connected in the pET 11a carrier.

Carrier pET 11A uses Qiagen Gel Extraction test kit gel-purified with NdeI and BamHI digestion, as handling with shrimp alkaline phosphotase that manufacturers (Roche Molecular Biochemicals) is advised, and is connected with the product of assembling PCR.Use T4 ligase enzyme (Roche Molecular Biochemicals) to connect and spend the night at 16 ℃.Be transformed in the NovaBlue cell (Novagen) of chemoreception attitude connecting mixture, and be inoculated on the LB flat board that is supplemented with 50 μ g/ml Pyocianils.Select independent clone to be used for purifying DNA plasmid; Use the QiagenSpinMiniprep test kit to obtain plasmid DNA.Plasmid digests with NdeI and BamHI and analyzes by gel electrophoresis.

The plasmid called after pTH that is obtained with XbaI and NdeI digestion, uses gel electrophoresis and Qiagen Gel Extraction test kit purifying as mentioned above, and clones with the ACL-1 of identical enzymic digestion and the carrier of ACL-2 PCR product as the back.Connect and carry out as mentioned above, and will connect the NovaBlue cell that mixture is transformed into the chemoreception attitude as mentioned above.Select independent clone to be used for purifying DNA plasmid; Plasmid DNA uses the QiagenSpinMiniprep test kit to obtain.Plasmid is with XbaI and NdeI digestion and pass through gel electrophoresis analysis.The pATH plasmid of the operon that carries structure of gained is transformed in e. coli bl21 (DE3) cell to measure the expression of clone gene.

In order to measure the generation of genetic expression and 3-HP, BL21 (DE3) cell that carries pATH-1 and pATH-2 plasmid is at M9CA substratum (the Difco Laboratories that is supplemented with 10g/l glucose, 5g/l Beta-alanine and 50 μ g/ml Pyocianils, Sparks grows into OD in MA) ₆₀₀～0.5, and induce under aerobic conditions with the IPTG of 100 μ M.With the BL21 that carries the pET11a carrier (DE3) cell in contrast.After IPTG induces 2 and 4 hours, get cell sample and carry out the polyacrylamide gel electrophoresis analysis.All 3 kinds of enzymes are shown as the band of the suitable size that shows on the gel.Pass through the 3-HP that the LC-MS analyzing and testing is generated by Beta-alanine with operon construct pATH-1 and pATH-2, but in control cells, do not analyze.

Operon 3:4-aminobutyric acid transaminase-3-hydroxy-isobutyrate dehydrogenase

In selectable or other approach, Beta-alanine can be produced malonic semialdehyde by having the active polypeptide deaminizating of Beta-alanine-ketoisocaproic transaminase, its can be further by polypeptide or have the active polypeptide of 3-Hydroxyisobutyrate dehydrogenase and be reduced into 3-HP with 3-HP dehydrogenase activity.

The active method that is used for separating, check order, express and tests this peptide species is described in WO02/42418 (being hereby incorporated by).It should be appreciated by those skilled in the art that the sequence that to use similar methods from any organism, to obtain any this peptide species.

By PCR with OsabatF (5 '-

CCGGAATTCTTTAATATGCGATTTGGAGGAG-3 '; SEQ ID NO:49) and OSDATR (5 '-GTCCGTCTCCCTTTCAGCTTAAATCGCTATTCTTATAGC-3 '; SEQ ID NO:50) primer is from the gene of clostridium acetobutylicum amplification coding 4-Aminobutyrate aminotransferase.

By PCR with OSATDF (5 '-GCTATAAGAATAGCGATTTAAGCTGAAAGGGAGACGGAC-3 '; SEQ ID NO:51) and OSibdR (5 '-CGACGGATCCGCAGTGAGTGAGCCTTGGAG-3 '; SEQ ID NO:52) primer is from the gene of Pseudomonas aeruginosa amplification coding 3-Hydroxyisobutyrate dehydrogenase.PCR uses Pfu Turbo polysaccharase to carry out under following condition according to the explanation of manufacturers in the PerkinElmer2400 thermal cycler: 94 ℃ of initial denaturing steps of 2 minutes; 94 ℃ of 25 round-robin 30 seconds, 56 ℃ 30 seconds, 72 ℃ 1.5 minutes; 72 ℃ of final extensions of 10 minutes.The PCR product of gained uses QiagenGel Extraction test kit to carry out gel-purified.

The PCR product of 4-Aminobutyrate aminotransferase and 3-Hydroxyisobutyrate dehydrogenase is assembling jointly in assembling PCR.The primer that shows among the SEQ ID NOS:50 and 51 is complimentary to one another, so complementary DNA end can annealing mutually in the PCR reaction, and two-way extended DNA.In order to guarantee to assemble and the efficient of amplification thereafter, two terminal primer OSabatF and OSibdR (SEQ ID NOS:49 and 52) are added in the PCR product and assembling PCR mixture of the 4-Aminobutyrate aminotransferase that comprises the 100ng purifying and 3-Hydroxyisobutyrate dehydrogenase with 8: 1 ratio blended rTth polysaccharases and Pfu Turbo polysaccharase.Assembling PCR carries out under following condition: 94 ℃ of initial denaturing steps of 1 minute; 94 ℃ of 25 round-robin 30 seconds, 55 ℃ 30 seconds, 68 ℃ 3 minutes; Final 68 ℃ were extended 7 minutes.Assembling PCR product digests with gel-purified and with EcoRI and BamHI as mentioned above.Assembling PCR product is introduced with OSabatF (EcoRI) (SEQ ID NO:49) and OSibdR (BamHI) (SEQ ID NO:52) primer in the site of these Restriction Enzymes.The PCR product of digestion uses Qiagen Gel Extraction test kit to carry out gel-purified, and is connected in the pPROLar.A carrier 80 ℃ of heating 30 minutes.

Carrier pPROLar.A uses Qiagen Gel Extraction test kit gel-purified with EcoRI and BamHI digestion, as handling with shrimp alkaline phosphotase that manufacturers advises, and is connected with the product of assembling PCR.Connect as mentioned above, be transformed into the TOP10 cell (Novagen) of chemoreception attitude and be inoculated on the LB flat board that is supplemented with 25 μ g/ml kantlex.Select independent clone to be used for purifying DNA plasmid; Use the QiagenSpinMiniprep test kit to obtain plasmid DNA.Plasmid is with EcoRI and BamHI digestion and pass through gel electrophoresis analysis.The plasmid that carries 4-Aminobutyrate aminotransferase and 3-Hydroxyisobutyrate dehydrogenase gene that is obtained is called as pATD.

In order to observe genetic expression and to produce 3-HP, TOP 10 cells that carry pATD plasmid or plasmid-free (contrast) grow into OD in the substratum that is supplemented with 5g/l glucose, 5g/l beta Alanine and 25 μ g/ml kantlex ₆₀₀～0.5 and under aerobic conditions IPTG and 0.5% pectinose with 100 μ M induce.Analyze to detect and produce 3-HP by carry out LC-MS with the cell that carries pATD, but in control cells, do not carry out by Beta-alanine.Observe 3-HP in the cell conditioned medium liquid after IPTG induces 6 and 24 hours.

Embodiment 11

Be used for producing the operon for synthesizing of 3-HP from α-Bing Ansuan

The several operons that allow to produce through Beta-alanine 3-HP in embodiment 10, have been produced by several selectable approach.Disclosed method has described in detail by being included in disclosed L-Ala 2 in this operon, the method for 3-aminomutase sequence in this embodiment.This allows to produce 3-HP through α-Bing Ansuan.

Operon 4: α-Bing Ansuan aminomutase-ACL-propionyl-CoA transferring enzyme-acrylyl-CoA hydratase

Be used to transform α-Bing Ansuan arrive to Beta-alanine to β-alanyl-CoA-CoA makes up as follows to the operon of 3-HP.L-Ala 2 is carried in use, and (embodiment 6 for the 3-aminomutase; SEQ ID NOS:20 and 21) plasmid pLC4-7LC1 plasmid construction pLCATH2-1.The ATH-2 operon is passed through to use following primer: OSacl2NotF2:5 '-AAGGAAAAAAGCGGCCGCAGATTAAAGGAGGAATTCTCAATGG-3 ' (SEQ ID NO:55) and OShydXbaR:5 ' CTAGTCTAGATCAACGACCACTGAAGTTGG-3 ' (SEQ IDNO:56) amplification from pATH-2 (embodiment 10).Use ratio blended rTth polysaccharase and Pfu Turbo polysaccharase as mentioned above, under following condition, carry out PCR:94 ℃ of 2 minutes initial denaturing step with 8: 1; 94 ℃ of 25 round-robin 30 seconds, 56 ℃ 30 seconds, 68 ℃ 2 minutes; 68 ℃ of final extensions of 7 minutes.

The PCR product of gained uses Qiagen PCR Purification test kit purifying and digests with NotI and XbaI.The DNA of digestion heated 30 minutes so that enzyme deactivation uses Qiagen Gel Extraction test kit gel-purified, and is cloned in the pLC4-7LC-1 plasmid that digests with same enzyme at 65 ℃.Using the T4 ligase enzyme to connect at 16 ℃ spends the night.Be transformed into the Tuner cell (Novagen) of chemoreception attitude and be inoculated on the LB flat board that is supplemented with 25 μ g/ml kantlex connecting mixture.Select independent clone to be used for purifying DNA plasmid; Use the QiagenSpinMiniprep test kit to obtain plasmid DNA.Plasmid is with NotI and XbaI digestion and pass through gel electrophoresis analysis.The Tuner of gained (pLCATH2-1) cell is used to observe the expression of clone gene and produces 3-HP from α-Bing Ansuan and Beta-alanine.

Operon 5: α-Bing Ansuan aminomutase-4 aminobutyric acid transaminase-3-Hydroxyisobutyrate dehydrogenase

The operon that is used for the conversion of α-Bing Ansuan to beta Alanine to malonic semialdehyde 3-HP makes up as follows.L-Ala 2 is carried in use, and (embodiment 6 for the 3-aminomutase; SEQ ID NOS:20 and 21) plasmid pLC4-7LC1 makes up pLCATD1.The ATD operon is used: OSabatNotF:5 '-AAGGAAAAAAGCGGCCGCTTTAATATGCGATTTGGAGGAG-3 ' (SEQ ID NO:57) and OsibdXbaR:5 '-CTAGTCTAGAGCAGTGAGTGAGCCTTGGAG-3 ' (SEQ ID NO:58) amplification are from pATD plasmid (embodiment 10).As mentioned above operon 4 is carried out PCR, and the PCR product of purifying gained, with NotI and XbaI digestion, be cloned in the pLC4-7LC-1 plasmid, be transformed into the Tuner cell of chemoreception attitude, and, select independent clone as described to operon 4.

Operon induce production with 3-HP

In order to observe the production of genetic expression and 3-HP, the Tuner cell that carries pLCATH2-1, pLCATD1 plasmid or pPROLar carrier (contrast) grows into OD in the LB substratum that is supplemented with 5g/l glucose, 5g/l α-Bing Ansuan or 5g/l Beta-alanine and 25 μ g/ml kantlex ₆₀₀-0.5, and under aerobic conditions, induce with the IPTG of 100 μ M and 0.5% pectinose.The cell that pLCATH2-1 and pLCATD1 are carried in use is analyzed to detect by Beta-alanine by LC-MS and is produced 3-HP, but does not carry out in control cells.Observe 3-HP in the cell conditioned medium liquid after inducing 22 hours.

Operon 6: the amino mutase of L-Ala-beta Alanine transaminase-3-hp desaturase-α-Bing Ansuan transaminase

The operon to malonic semialdehyde to 3-HP makes up as follows to α-Bing Ansuan to Beta-alanine to be used to transform pyruvic acid.Coding L-Ala 2, the gene of 3-aminomutase by PCR with primer KAM10F (5 '-CACACAGAATTCATTAAAGAGGAG-3 '; SEQ ID NO:59) and KAMRBATR 5 '-CATAATCAAACTCAAAGTCAACCATATAAGATCTCCTCCTTACTTCATGAAGAATC CCCTCC-'; SEQ ID NO:60) amplification is from pLC4-7LC1.

The gene of Beta-alanine transaminase by PCR with primer KAMRBATF (5 '-GGAGGGGATTCTTCATGAAGTAAGGAGGAGATCTTATATGGTTGACTTTGAGTTTG ATTG-3 '; SEQ ID NO:61) and RBATAFDR (5 '-CGTGTTACTCATTTTGTCTCCTCGTCATTTACTTGAAGTCTGCTAAGATAC-3 '; (SEQ ID NO:62) amplification is from rat cDNA.

The 3-HP desaturase by PCR with primer RBATAFDF (5 '-GTATCTTAGCAGACTTCAAGTAAATGACGAGGAGACAAAATGAGTAACACG-3 '; SEQID NO:63) and (5 '-TCATTCACCCGTGAGGCCATGAATATATCTCCTTCTTAAGCTTAGTGCTTCTGACG GTAC-3 '; SEQ ID NO:64) amplification is from Alcaligenes faecalis DNA.

α-Bing Ansuan aminotransferase gene primer AFDRAATF (5 '-GTACCGTCAGAAGCACTAAGCTTAAGAAGGAGATATATTCATGGCCTCACGGGTGA ATGA-3 '; SEQ ID NO:65) and RATGPTOR (5 '-GACTAGATATCTCAGGAGTACTCATGGGTGAA-3 ' (SEQ ID NO:66) increases from rat cDNA.

Under following condition, carry out above-mentioned PCR:94 ℃ of 2 minutes initial denaturing step; 94 ℃ of 10 round-robin 30 seconds, 48 ℃ 30 seconds, 72 ℃ 2 minutes; 94 ℃ of 5 round-robin 30 seconds, 52 ℃ 30 seconds, 72 ℃ 2 minutes; 94 ℃ of 10 round-robin 30 seconds, 60 ℃ 30 seconds, 72 ℃ 2 minutes; 72 ℃ of final extensions of 7 minutes.The PCR product of gained uses Qiagen Gel Extraction test kit to carry out gel-purified.

L-Ala 2, the PCR product of 3-aminomutase and beta Alanine transaminase, and the PCR product of 3-HP desaturase and α-Bing Ansuan transaminase assembled in pairs in two assembling PCR.SEQ ID NOS:60 and 61 and SEQ ID NOS:64 and 65 in primer to being complimentary to one another, so the end of complementary DNA can be in the PCR reaction annealing and two-way extended DNA mutually.In order to guarantee to assemble and the efficient of amplification thereafter, two terminal primers (SEQ ID NOS:59 and 62) are added in the PCR product and assembling PCR mixture of amino mutase of the L-Ala that comprises two purifying of 100ng and Beta-alanine transaminase with 8: 1 ratio blended rTth polysaccharases and Pfu Turbo polysaccharase.With two other terminal primer, SEQ ID NOS:63 and 66 adds in the 3-HP desaturase comprise the 100ng purifying and α-Bing Ansuan transaminase and the assembling PCR mixture with 8: 1 ratio blended rTth polysaccharase and Pfu Turbo polysaccharase.Assembling PCR carries out under following condition: 94 ℃ of initial denaturing steps of 2 minutes; 94 ℃ of 5 round-robin 30 seconds, 48 ℃ 30 seconds, 68 ℃ 4 minutes; 94 ℃ of 5 round-robin 30 seconds, 52 ℃ 30 seconds, 68 ℃ 4 minutes; 94 ℃ of 5 round-robin 30 seconds, 55 ℃ 30 seconds, 68 ℃ 4 minutes; 94 ℃ of 10 round-robin 30 seconds, 50 ℃ 30 seconds, 68 ℃ 4 minutes; 68 ℃ of final extensions of 7 minutes.

Carry out second the assembling PCR with unite assembling to producing the operon 6 that comprises all 4 genes.Two terminal primers (SEQ ID NOS:59 and 66) are joined the L-Ala amino that comprises the 100ng purifying, and mutase/the Beta-alanine transaminase is right; 3-HP desaturase/α-Bing Ansuan the transaminase of 100ng purifying to and PCR mixture with 8: 1 ratio blended rTth polysaccharase and Pfu Turbo polysaccharase in.Assembling PCR carries out under following condition: 94 ℃ of initial denaturing steps of 2 minutes; 94 ℃ of 15 round-robin 30 seconds, 50 ℃ 30 seconds, 70 ℃ 5 minutes; 94 ℃ of 10 round-robin 30 seconds, 55 ℃ 30 seconds, 70 ℃ 5 minutes; 70 ℃ of final extensions of 7 minutes.

The PCR product of gel-purified assembling is also with EcoRI and EcoRV digestion as mentioned above.With SEQ ID NO:59 (EcoRI) and SEQ ID NO66 (EcoRV) primer the site of these Restriction Enzymes is introduced in the PCR product of assembling.The PCR product of digestion uses Qiagen Gel Extraction test kit to carry out gel-purified, and is connected in the pTrc99A carrier that digests with EcoRI and SmaI 65 ℃ of heating 30 minutes.Be connected 16 ℃ and use the T4 ligase enzyme to spend the night, mixture is transformed in the Tuner cell of chemoreception attitude, and is inoculated on the LB flat board that is supplemented with 50 μ g/ml Pyocianils.Selecting independent clone to be used for plasmid DNA purifies; Use the QiagenSpinMiniprep test kit to obtain plasmid DNA.Screen plasmid by PCR with SEQ ID NOS:59 and 66 primers and gel electrophoresis analysis.The plasmid that is obtained is named as pTrc β-ala.

(cell of pTrc β-ala) is determined the expression of clone gene and the production of the 3-HP that carries out from glucose, α-Bing Ansuan and Beta-alanine to use Tuner.Tuner (pTrc99A) is used as contrast.Cell is being supplemented with 5g/l glucose and 50 μ g/ml Pyocianils; Or 5g/l glucose, 5g/l α-Bing Ansuan and 50 μ g/ml Pyocianils; Or grow into OD in the M9CA substratum of 5g/l glucose, 5g/l Beta-alanine and 50 Pyocianils (Difco Laboratories) ₆₀₀～0.5; And under aerobic conditions, induce with the IPTG of 100 μ M and 0.5% pectinose.Analyze by LC-MS with the cell that carries pTrc β-ala from the production of the 3-HP of Beta-alanine and to detect, but in control cells, do not carry out.Observe 3-HP in the cell conditioned medium liquid after inducing 22 hours.

Embodiment 12

Produce pantothenic acid by Beta-alanine

Pantothenic acid can produce (Fig. 3) by having α-ketone pantothenic acid hydroxymethyl transferases (E.C.2.1.2.11), α-ketone pantothenic acid reductase enzyme (E.C.1.1.1.169) and the active polypeptide of pantothenic acid synthase (E.C.6.3.2.1) by Beta-alanine.

Use the cloning process of describing among the embodiment 10 and 11, the polypeptide of α-ketone pantothenic acid hydroxymethyl transferases (E.C.2.1.2.11), α-ketone pantothenic acid reductase enzyme (E.C.1.169) and pantothenic acid synthase (E.C.6.3.) can be separated, order-checking, express and test.It should be appreciated by those skilled in the art that the sequence that to use similar methods from any organism, to obtain any this peptide species.

Embodiment 13

Recombinant expressed

Use cDNA and amino-acid sequence and the enzyme disclosed herein and the sequence of the available enzyme of the public; such as L-Ala 2; the 3-aminomutase; the CoA transferring enzyme; β-alanyl-CoA ammonia lyase; 3-HP CoA dehydratase; 4-Aminobutyrate aminotransferase; Beta-alanine-2-oxoglutarate transaminase; 3-hydroxypropionate dehydrogenase; 3-Hydroxyisobutyrate dehydrogenase; glutamate dehydrogenase; the 3-HP-COA lytic enzyme; 3-hydroxy-isobutyryl-how pure the acid synthase of CoA lytic enzyme; lipase; esterase; the CoA lytic enzyme; α-ketone pantothenic acid hydroxymethyl transferases; α-ketone pantothenic acid reductase enzyme; the pantothenic acid synthase; Pantothen kinase; 4 '-phosphopantetheine VITAMIN B4 transferring enzyme; dephosphorylation-CoA kinases acetylize aldehyde: NAD (+) oxydo-reductase; alcohol: NAD (+) oxydo-reductase; aldehyde dehydrogenase (NAD (P)+) and ethanol dehydrogenase; and variant; multiformity; mutant; fragment and syzygy; the expression of any albumen such as enzyme and purification are to obtain by the laboratory technique of standard.It should be appreciated by those skilled in the art that its enzyme and fragment can be in any purpose cell or organism recombinant production and before use, for example before the production of 3-HP, pantothenic acid and derivative thereof, carry out purifying.

The method that is used to produce recombinant protein is well known in the art.Therefore scope of the present invention comprises the recombinant expressed of any albumen or its fragment such as enzyme.For example, referring to people's such as Johnson US Patent No: 5,342,764; People's such as Pausch US Patent No: 5,846,819; People's such as Fleer US Patent No: 5,876,969 and people's (molecular cloning: laboratory manual, cold spring port, New York, 1989, the 17 chapters) such as Sambrook.

In brief, the cDNA sequence part of coded protein or peptide, total length or that change can be connected to expression vector such as in the bacterial expression vector.Protein and/or peptide can be produced by promotor being placed the upstream of cDNA sequence.The example of promotor includes but not limited to, lac, trp, tac, trc, main operation and the promoter region of phage, the regulation and control zone of fd coat protein, the early stage and late promoter of SV40, be derived from the promotor of polyoma, adenovirus, retrovirus, baculovirus and simian virus, the kinase whose promotor of 3-phoshoglyceric acid, the promotor of leavening acid acid phosphatase, the promotor of yeast α-conjugative element and combination thereof.

The carrier that is fit to complete natural protein production comprises pKC30 (Shimatake and Rosenberg, 1981, Nature 292:128), pKK177-3 (Amann and Brosius, 1985Gene40:183) and pET-3 (Studier and Moffatt, 1986, J.Mol.Biol.189:113).Dna sequence dna can be changed over to other cloning vector, for example other plasmid, bacteriophage, coemid, animal virus and yeast artificial chromosome (YACs) (people such as Burke, 1987, Science 236:806-12).These carriers can import multiple host, comprise in somatocyte and simple or the complex biological body, such as bacterium, fungi (Timberlake and Marshall, 1989, Science 244:1313-7), invertebrates, plant (Gasser and Fraley, 1989, Science 244:1293) and Mammals (people such as Pursel, 1989, Science 244:1281-8), they are to provide genetically modified by importing allogenic cDNA.

In order in mammalian cell, to express, the cDNA sequence can be connected on the allogenic promotor, promotor (Mulligan and the Berg in simian virus SV40, the pSV2 carrier for example, 1981, U.S. 78:2072-6) and import (Gluzman in the cell of monkey COS-1 cell for example Proc.Natl.Acad.Sci., 1981, cell Cell 23:175-82) to realize instantaneous or secular expression.The stable integration of mosaic gene construct can pass through in mammalian cell such as Xin Meisu (Southern and Berg, 1982, J.Mol.Aool.Genet.1:327-41) and mycophenolic acid (Mulligan and Berg, 1981, Proc.Natl.Acad.Sci. U.S. 78:2072-6) biological chemistry screening and keeping.

DNA is changed over to such as being a kind of routine techniques in human or other mammiferous eukaryotic cell.Carrier imports recipient cell (transfection) with pure DNA to be passed through, for example, calcium phosphate precipitation (Graham and vander Eb, 1973, Virology 52:466), strontium phosphate precipitation (people such as Brash, 1987, Mol.Cell Biol.7:2013), electroporation (people such as Neumann, 1982, EMBO.J.1:841), lipofection (people such as Felgner, 1987, Proc.Natl.Acad.Sci. U.S. 84:7413), deae dextran (people such as McCuthan, 1968, J.Natl.CancerInst.41:351), microinjection (people such as Mueller, 1978, Cell 15:579), protoplastis merges (Schafner, 1980, U.S. 77:2163-7) or particle gun (people such as Klein, 1987, Nature 327:70) Proc.Natl.Acad.Sci..Selectively, cDNA can be by importing with viral vector infection, for example retrovirus (people such as Bernstein, 1985, Gen.Engrg.7:235), such as adenovirus (people such as Ahmad, 1986, J.Virol.57:267) or bleb (people such as Spaete, 1982, Cell 30:295).

Embodiment 14

Synthetic and the purifying of peptide

Enzyme disclosed herein; such as L-Ala 2, the 3-aminomutase; CoA; β alanyl CoA ammonia lyase; the 3-HP-CoA dehydratase; 4-Aminobutyrate aminotransferase; Beta-alanine-2-oxoglutarate transaminase; 3-hydroxypropionate dehydrogenase; 3-Hydroxyisobutyrate dehydrogenase; glutamate dehydrogenase; the 3-HP-CoA lytic enzyme; 3-hydroxy-isobutyryl CoA lytic enzyme; many pure acid synthases; lipase; esterase; the CoA lytic enzyme; α-ketone pantothenic acid hydroxymethyl transferases; α-ketone pantothenic acid reductase enzyme; the pantothenic acid synthase; Pantothen kinase; 4 '-phosphoric acid panthenol acyl-1-cysteine synthase; 4-phosphoric acid panthenol acyl cysteic acid decarboxylase; ATP:4 '-phosphopantetheine VITAMIN B4 transferring enzyme; dephosphorylation-CoA kinases acetylize aldehyde: NAD (+) oxydo-reductase; alcohol: NAD (+) oxydo-reductase; aldehyde dehydrogenase (NAD (P)+) and ethanol dehydrogenase (and variant; syzygy; multiformity; fragment and mutant) can carry out chemosynthesis by many artificial or any methods of automatization synthetic known in the art.For example; use Applied Biosystems Model 431A peptide synthesizer and use the protection of 9-fluorenylmethyloxycarbonyl (Fmoc) amino-end; with dicyclohexylcarbodiimide/hydroxybenzotriazole or 2-(1 hydrogen-benzo-triazole-1 base)-1; 1; 3; 3-tetramethyl-urea phosphofluoric acid ester/hydroxybenzotriazole (HBTU/HOBT) coupling, and use the carboxyl-p-hydroxymethyl phenoxy methylated polystyrene (HMP) of end acid or the Rink ammonification resin of Sasrin resin or carboxyl-terminal amide to carry out solid-phase peptide with the scale of 0.25 mmole (mmole) and synthesize (SPPS).

By tritylation and trityl alcoholization in trifluoroacetic acid, subsequently by (solid-phase peptide is synthesized Solid Phase Peptide Synthesis as people such as Atherton, IRL Press:Oxford, 1989) described Fmoc derivatize prepares Fmoc-deutero-amino acid from suitable precursor amino acid.

TFA dichloromethane solution cutting Sasrin resin-bonded peptide of use 1% is to produce shielded peptide.When suitable, protected propeptide between amino and the C-terminal by by using two benzenephosphonic acid trinitride in the aminoterminal free amine of newly-generated peptide and the free acid of C-terminal are reacted and cyclisation, wherein amino acid side chain is shielded.

HMP or Rink amide resin-be cut usually and the protected side chain that comprises the cyclisation peptide is utilized the solution that contains trifluoroacetic acid (TFA) in conjunction with product; also comprise water, thioanisole and dithioglycol arbitrarily, with 100: 5: 5: 2.5 ratio went protection in room temperature 0.5-3 hour.

Rough peptide comes purifying by pre-high pressure lipuid chromatography (HPLC) (HPLC), for example uses the WaterDelta-PAKC18 post and contains the water gradient elution of 0.1%TFA with the acetonitrile demulcent.After the post elution, from elutriated fraction, evaporate acetonitrile, then this elutriated fraction of freeze-drying.So the identity of the various products of production and purifying can be verified by fast-atom-bombardment mass spectrometry (FABMS) or electrospray mass spectrometry (ESMS).

In view of our disclosed principle can be applicable to many possible embodiments, should be appreciated that illustrational embodiment is a disclosed specific embodiment and should be as the restriction of the scope of the invention.Accordingly, the scope of disclosed content with following what is claimed is consistent.Therefore our claimed all inventions in the scope and spirit of these claims.

Sequence table

＜110〉Cargill Inc (CARGIL, INCORPORATED)

＜120〉L-Ala 2, and (ALANINE 2,3-AMINOMUTASE) for the 3-aminomutase

<130>SCT042701-47

<150>US?60/350,727

<151>2002-01-18

<150>US?60/375,785

<151>2002-04-25

<160>66

<170>PatentIn?version?3.1

<210>1

<211>40

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>1

gcgcgaggag?gagttcatat?gaaaaacaaa?tggtataaac???????????????????????????40

<210>2

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>2

cgggcaccgc?ttcgaggcgg?ccgcaccatt?cgcatg???????????????????????????????36

<210>3

<211>1416

<212>DNA

＜213〉subtilis (Bacillus subtilis)

<400>3

ttgaaaaaca?aatggtataa?accgaaacgg?cattggaagg?agatcgagtt?atggaaggac?????60

gttccggaag?agaaatggaa?cgattggctt?tggcagctga?cacacactgt?aagaacgtta????120

gatgatttaa?agaaagtcat?taatctgacc?gaggatgaag?aggaaggcgt?cagaatttct?????180

accaaaacga?tccccttaaa?tattacacct?tactatgctt?ctttaatgga?ccccgacaat?????240

ccgagatgcc?cggtacgcat?gcagtctgtg?ccgctttctg?aagaaatgca?caaaacaaaa?????300

tacgatctgg?aagacccgct?tcatgaggat?gaagattcac?cggtacccgg?tctgacacac?????360

cgctatcccg?accgtgtgct?gtttcttgtc?acgaatcaat?gttccatgta?ctgccgctac?????420

tgcacaagaa?ggcgcttttc?cggacaaatc?ggaatgggcg?tccccaaaaa?acagcttgat?????480

gctgcaattg?cttatatccg?ggaaacaccc?gaaatccgcg?attgtttaat?ttcaggcggt?????540

gatgggctgc?tcatcaacga?ccaaatttta?gaatatattt?taaaagagct?gcgcagcatt?????600

ccgcatctgg?aagtcatcag?aatcggaaca?agagctcccg?tcgtctttcc?gcagcgcatt?????660

accgatcatc?tgtgcgagat?attgaaaaaa?tatcatccgg?tctggctgaa?cacccatttt?????720

aacacaagca?tcgaaatgac?agaagaatcc?gttgaggcat?gtgaaaagct?ggtgaacgcg?????780

ggagtgccgg?tcggaaatca?ggctgtcgta?ttagcaggta?ttaatgattc?ggttccaatt?????840

atgaaaaagc?tcatgcatga?cttggtaaaa?atcagagtcc?gtccttatta?tatttaccaa?????900

tgtgatctgt?cagaaggaat?agggcatttc?agagctcctg?tttccaaagg?tttggagatc?????960

attgaagggc?tgagaggtca?tacctcaggc?tatgcggttc?ctacctttgt?cgttgacgca????1020

ccaggcggag?gaggtaaaat?cgccctgcag?ccaaactatg?tcctgtcaca?aagtcctgac????1080

aaagtgatct?taagaaattt?tgaaggtgtg?attacgtcat?atccggaacc?agagaattat????1140

atccccaatc?aggcagacgc?ctattttgag?tccgttttcc?ctgaaaccgc?tgacaaaaag????1200

gagccgatcg?ggctgagtgc?catttttgct?gacaaagaag?tttcgtttac?acctgaaaat????1260

gtagacagaa?tcaaaaggag?agaggcatac?atcgcaaatc?cggagcatga?aacattaaaa????1320

gatcggcgtg?agaaaagaga?tcagctcaaa?gaaaagaaat?ttttggcgca?gcagaaaaaa????1380

cagaaagaga?ctgaatgcgg?aggggattct?tcatga??????????????????????????????1416

<210>4

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>4

tatcaattcg?ttacaggcga?tacatggcac?gcttcggcgc?gtgtaggctg?gagctgcttc?????60

<210>5

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>5

gatgtcgcgg?ctggtgagta?accagccgca?gggataacaa?catatgaata?tcctccttag?????60

<210>6

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>6

ttaccgagca?gcgttcagag?????????????????????????????????????????????????20

<210>7

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>7

cacctggcgg?tgacaaccat?????????????????????????????????????????????????20

<210>8

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>8

gcggcgtgaa?gtttcccaac?ccgttctgcc?tctcttcttc?gtgtaggctg?gagctgcttc?????60

<210>9

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>9

ttacaacgtt?accgggtgtt?ctttctcgcc?tttcttaaac?catatgaata?tcctccttag?????60

<210>10

<211>51

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>10

cacaaaacaa?aatacgatat?ggaagacccg?ctccatgagg?atgaagattc?a??????????????51

<210>11

<211>51

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>11

tgaatcttca?tcctcatgga?gcgggtcttc?catatcgtat?tttgttttgt?g??????????????51

<210>12

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>12

gaatcaatgt?tccgtatact?gccgctac????????????????????????????????????????28

<210>13

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>13

gtagcggcag?tatacggaac?attgattc????????????????????????????????????????28

<210>14

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>14

gttcctacct?ttgttgtaca?cgcaccaggc?g????????????????????????????????????31

<210>15

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>15

cgcctggtgc?gtgtacaaca?aaggtaggaa?c????????????????????????????????????31

<210>16

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<220>

＜221〉misc_ feature

<222>(1)..(23)

＜223〉y is t/u or c; S is g or c; B is g, c or t/u.

<400>16

ttyatyggby?tsggbaayat?ggg?????????????????????????????????????????????23

<210>17

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<220>

＜221〉misc_ feature

<222>(1)..(20)

＜223〉y is t/u or c; S is g or c; B is g, c or t/u; W is a or t/u; N is a, c, g or t/u.

<400>17

gaygcnccng?tbwssggbgg?????????????????????????????????????????????????20

<210>18

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<220>

＜221〉misc_ feature

<222>(1)..(21)

＜223〉y is t/u or c; R is g or a; N is a, c, g or t/u.

<400>18

catrttrttr?caratyttng?c???????????????????????????????????????????????21

<210>19

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>19

ggtttacgag?ggcgagaacg?gcttgct?????????????????????????????????????????27

<210>20

<211>1416

<212>DNA

＜213〉subtilis (Bacillus subtilis)

<220>

<221>CDS

<222>(1)..(1416)

<223>

<400>20

atg?aaa?aac?aaa?tgg?tat?aaa?ccg?aaa?cgg?cat?tgg?aag?gag?atc?gag???????48

Met?Lys?Asn?Lys?Trp?Tyr?Lys?Pro?Lys?Arg?His?Trp?Lys?Glu?Ile?Glu

1???????????????5???????????????????10??????????????????15

tta?tgg?aag?gac?gtt?ccg?gaa?gag?aaa?tgg?aac?gat?tgg?ctt?tgg?cag???????96

Leu?Trp?Lys?Asp?Val?Pro?Glu?Glu?Lys?Trp?Asn?Asp?Trp?Leu?Trp?Gln

20??????????????????25??????????????????30

ctg?aca?cac?act?gta?aga?acg?tta?gat?gat?tta?aag?aaa?gtc?att?aat??????144

Leu?Thr?His?Thr?Val?Arg?Thr?Leu?Asp?Asp?Leu?Lys?Lys?Val?Ile?Asn

35??????????????????40??????????????????45

ctg?acc?gag?gat?gaa?gag?gaa?ggc?gtc?aga?att?tct?acc?aaa?acg?atc??????192

Leu?Thr?Glu?Asp?Glu?Glu?Glu?Gly?Val?Arg?Ile?Ser?Thr?Lys?Thr?Ile

50?????????????????55??????????????????60

ccc?tta?aat?att?aca?cct?tac?tat?gct?tct?tta?atg?gac?ccc?gac?aat??????240

Pro?Leu?Asn?Ile?Thr?Pro?Tyr?Tyr?Ala?Ser?Leu?Met?Asp?Pro?Asp?Asn

65??????????????????70??????????????????75??????????????????80

ccg?aga?tgc?ccg?gta?cgc?atg?cag?tct?gtg?ccg?ctt?tct?gaa?gaa?atg??????288

Pro?Arg?Cys?Pro?Val?Arg?Met?Gln?Ser?Val?Pro?Leu?Ser?Glu?Glu?Met

85??????????????????90??????????????????95

cac?aaa?aca?aaa?tac?gat?atg?gaa?gac?ccg?ctt?cat?gag?gat?gaa?gat??????336

His?Lys?Thr?Lys?Tyr?Asp?Met?Glu?Asp?Pro?Leu?His?Glu?Asp?Glu?Asp

100?????????????????105?????????????????110

tca?ccg?gta?ccc?ggt?ctg?aca?cac?cgc?tat?ccc?gac?cgt?gtg?ctg?ttt??????384

Ser?Pro?Val?Pro?Gly?Leu?Thr?His?Arg?Tyr?Pro?Asp?Arg?Val?Leu?Phe

115?????????????????120?????????????????125

ctt?gtc?acg?aat?caa?tgt?tcc?gtg?tac?tgc?cgc?tac?tgc?aca?aga?agg??????432

Leu?Val?Thr?Asn?Gln?Cys?Ser?Val?Tyr?Cys?Arg?Tyr?Cys?Thr?Arg?Arg

130?????????????????135?????????????????140

cgc?ttt?tcc?gga?caa?atc?gga?atg?ggc?gtc?ccc?aaa?aaa?cag?ctt?gat??????480

Arg?Phe?Ser?Gly?Gln?Ile?Gly?Met?Gly?Val?Pro?Lys?Lys?Gln?Leu?Asp

145?????????????????150?????????????????155?????????????????160

gct?gca?att?gct?tat?atc?cgg?gaa?aca?ccc?gaa?atc?cgc?gat?tgt?tta??????528

Ala?Ala?Ile?Ala?Tyr?Ile?Arg?Glu?Thr?Pro?Glu?Ile?Arg?Asp?Cys?Leu

165?????????????????170?????????????????175

att?tca?ggc?ggt?gat?ggg?ctg?ctc?atc?aac?gac?caa?att?tta?gaa?tat??????576

Ile?Ser?Gly?Gly?Asp?Gly?Leu?Leu?Ile?Asn?Asp?Gln?Ile?Leu?Glu?Tyr

180?????????????????185?????????????????190

att?tta?aaa?gag?ctg?cgc?agc?att?ccg?cat?ctg?gaa?gtc?atc?aga?atc??????624

Ile?Leu?Lys?Glu?Leu?Arg?Ser?Ile?Pro?His?Leu?Glu?Val?Ile?Arg?Ile

195?????????????????200?????????????????205

gga?aca?aga?gct?ccc?gtc?gtc?ttt?ccg?cag?cgc?att?acc?gat?cat?ctg??????672

Gly?Thr?Arg?Ala?Pro?Val?Val?Phe?Pro?Gln?Arg?Ile?Thr?Asp?His?Leu

210?????????????????215?????????????????220

tgc?gag?ata?ttg?aaa?aaa?tat?cat?ccg?gtc?tgg?ctg?aac?acc?cat?ttt??????720

Cys?Glu?Ile?Leu?Lys?Lys?Tyr?His?Pro?Val?Trp?Leu?Asn?Thr?His?Phe

225?????????????????230?????????????????235?????????????????240

aac?aca?agc?atc?gaa?atg?aca?gaa?gaa?tcc?gtt?gag?gca?tgt?gaa?aag??????768

Asn?Thr?Ser?Ile?Glu?Met?Thr?Glu?Glu?Ser?Val?Glu?Ala?Cys?Glu?Lys

245?????????????????250?????????????????255

ctg?gtg?aac?gcg?gga?gtg?ccg?gtc?gga?aat?cag?gct?gtc?gta?tta?gca??????816

Leu?Val?Asn?Ala?Gly?Val?Pro?Val?Gly?Asn?Gln?Ala?Val?Val?Leu?Ala

260?????????????????265?????????????????270

ggt?att?aat?gat?tcg?gtt?cca?att?atg?aaa?aag?ctc?atg?cat?gac?ttg??????864

Gly?Ile?Asn?Asp?Ser?Val?Pro?Ile?Met?Lys?Lys?Leu?Met?His?Asp?Leu

275?????????????????280?????????????????285

gta?aaa?atc?aga?gtc?cgt?cct?tat?tat?att?tac?caa?tgt?gat?ctg?tca??????912

Val?Lys?Ile?Arg?Val?Arg?Pro?Tyr?Tyr?Ile?Tyr?Gln?Cys?Asp?Leu?Ser

290?????????????????295?????????????????300

gaa?gga?ata?ggg?cat?ttc?aga?gct?cct?gtt?tcc?aaa?ggt?ttg?gag?atc??????960

Glu?Gly?Ile?Gly?His?Phe?Arg?Ala?Pro?Val?Ser?Lys?Gly?Leu?Glu?Ile

305?????????????????310?????????????????315?????????????????320

att?gaa?ggg?ctg?aga?ggt?cat?acc?tca?ggc?tat?gcg?gtt?cct?acc?ttt?????1008

Ile?Glu?Gly?Leu?Arg?Gly?His?Thr?Ser?Gly?Tyr?Ala?Val?Pro?Thr?Phe

325?????????????????330?????????????????335

gtc?gtt?cac?gca?cca?ggc?gga?gga?ggt?aaa?atc?gcc?ctg?cag?ccg?aac?????1056

Val?Val?His?Ala?Pro?Gly?Gly?Gly?Gly?Lys?Ile?Ala?Leu?Gln?Pro?Asn

340?????????????????345?????????????????350

tat?gtc?ctg?tca?caa?agt?cct?gac?aaa?gtg?atc?tta?aga?aat?ttt?gaa?????1104

Tyr?Val?Leu?Ser?Gln?Ser?Pro?Asp?Lys?Val?Ile?Leu?Arg?Asn?Phe?Glu

355?????????????????360?????????????????365

ggt?gtg?att?acg?tca?tat?ccg?gaa?cca?gag?aat?tat?atc?ccc?aat?cag?????1152

Gly?Val?Ile?Thr?Ser?Tyr?Pro?Glu?Pro?Glu?Asn?Tyr?Ile?Pro?Asn?Gln

370?????????????????375?????????????????380

gca?gac?gcc?tat?ttt?gag?tcc?gtt?ttc?cct?gaa?acc?gct?gac?aaa?aag?????1200

Ala?Asp?Ala?Tyr?Phe?Glu?Ser?Val?Phe?Pro?Glu?Thr?Ala?Asp?Lys?Lys

385?????????????????390?????????????????395?????????????????400

gag?ccg?atc?ggg?ctg?agt?gcc?att?ttt?gct?gac?aaa?gaa?gtt?tcg?ttt?????1248

Glu?Pro?Ile?Gly?Leu?Ser?Ala?Ile?Phe?Ala?Asp?Lys?Glu?Val?Ser?Phe

405?????????????????410?????????????????415

aca?cct?gaa?aat?gta?gac?aga?atc?aaa?agg?aga?gag?gca?tac?atc?gca?????1296

Thr?Pro?Glu?Asn?Val?Asp?Arg?Ile?Lys?Arg?Arg?Glu?Ala?Tyr?Ile?Ala

420?????????????????425?????????????????430

aat?ccg?gag?cat?gaa?aca?tta?aaa?gat?cgg?cgt?gag?aaa?aga?gat?cag?????1344

Asn?Pro?Glu?His?Glu?Thr?Leu?Lys?Asp?Arg?Arg?Glu?Lys?Arg?Asp?Gln

435?????????????????440?????????????????445

ctc?aaa?gaa?aag?aaa?ttt?ttg?gcg?cag?cag?aaa?aaa?cag?aaa?gag?act?????1392

Leu?Lys?Glu?Lys?Lys?Phe?Leu?Ala?Gln?Gln?Lys?Lys?Gln?Lys?Glu?Thr

450?????????????????455?????????????????460

gaa?tgc?gga?ggg?gat?tct?tca?tga?????????????????????????????????????1416

Glu?Cys?Gly?Gly?Asp?Ser?Ser

465?????????????????470

<210>21

<211>471

<212>PRT

＜213〉subtilis (Bacillus subtilis)

<400>21

Met?Lys?Asn?Lys?Trp?Tyr?Lys?Pro?Lys?Arg?His?Trp?Lys?Glu?Ile?Glu

1???????????????5???????????????????10??????????????????15

Leu?Trp?Lys?Asp?Val?Pro?Glu?Glu?Lys?Trp?Asn?Asp?Trp?Leu?Trp?Gln

20??????????????????25??????????????????30

Leu?Thr?His?Thr?Val?Arg?Thr?Leu?Asp?Asp?Leu?Lys?Lys?Val?Ile?Asn

35??????????????????40??????????????????45

Leu?Thr?Glu?Asp?Glu?Glu?Glu?Gly?Val?Arg?Ile?Ser?Thr?Lys?Thr?Ile

50??????????????????55??????????????????60

Pro?Leu?Asn?Ile?Thr?Pro?Tyr?Tyr?Ala?Ser?Leu?Met?Asp?Pro?Asp?Asn

65??????????????????70??????????????????75??????????????????80

Pro?Arg?Cys?Pro?Val?Arg?Met?Gln?Ser?Val?Pro?Leu?Ser?Glu?Glu?Met

85??????????????????90???????????????????95

His?Lys?Thr?Lys?Tyr?Asp?Met?Glu?Asp?Pro?Leu?His?Glu?Asp?Glu?Asp

100?????????????????105?????????????????110

Ser?Pro?Val?Pro?Gly?Leu?Thr?His?Arg?Tyr?Pro?Asp?Arg?Val?Leu?Phe

115?????????????????120?????????????????125

Leu?Val?Thr?Ash?Gln?Cys?Ser?Val?Tyr?Cys?Arg?Tyr?Cys?Thr?Arg?Arg

130?????????????????135?????????????????140

Arg?Phe?Ser?Gly?Gln?Ile?Gly?Met?Gly?Val?Pro?Lys?Lys?Gln?Leu?Asp

145?????????????????150?????????????????155?????????????????160

Ala?Ala?Ile?Ala?Tyr?Ile?Arg?Glu?Thr?Pro?Glu?Ile?Arg?Asp?Cys?Leu

165?????????????????170?????????????????175

Ile?Ser?Gly?Gly?Asp?Gly?Leu?Leu?Ile?Asn?Asp?Gln?Ile?Leu?Glu?Tyr

180?????????????????185?????????????????190

Ile?Leu?Lys?Glu?Leu?Arg?Ser?Ile?Pro?His?Leu?Glu?Val?Ile?Arg?Ile

195?????????????????200?????????????????205

Gly?Thr?Arg?Ala?Pro?Val?Val?Phe?Pro?Gln?Arg?Ile?Thr?Asp?His?Leu

210?????????????????215?????????????????220

Cys?Glu?Ile?Leu?Lys?Lys?Tyr?His?Pro?Val?Trp?Leu?Asn?Thr?His?Phe

225?????????????????230?????????????????235?????????????????240

Asn?Thr?Ser?Ile?Glu?Met?Thr?Glu?Glu?Ser?Val?Glu?Ala?Cys?Glu?Lys

245?????????????????250?????????????????255

Leu?Val?Asn?Ala?Gly?Val?Pro?Val?Gly?Asn?Gln?Ala?Val?Val?Leu?Ala

260?????????????????265?????????????????270

Gly?Ile?Asn?Asp?Ser?Val?Pro?Ile?Met?Lys?Lys?Leu?Met?His?Asp?Leu

275?????????????????280?????????????????285

Val?Lys?Ile?Arg?Val?Arg?Pro?Tyr?Tyr?Ile?Tyr?Gln?Cys?Asp?Leu?Ser

290?????????????????295?????????????????300

Glu?Gly?Ile?Gly?His?Phe?Arg?Ala?Pro?Val?Ser?Lys?Gly?Leu?Glu?Ile

305?????????????????310?????????????????315?????????????????320

Ile?Glu?Gly?Leu?Arg?Gly?His?Thr?Ser?Gly?Tyr?Ala?Val?Pro?Thr?Phe

325?????????????????330?????????????????335

Val?Val?His?Ala?Pro?Gly?Gly?Gly?Gly?Lys?Ile?Ala?Leu?Gln?Pro?Ash

340?????????????????345?????????????????350

Tyr?Val?Leu?Ser?Gln?Ser?Pro?Asp?Lys?Val?Ile?Leu?Arg?Asn?Phe?Glu

355?????????????????360?????????????????365

Gly?Val?Ile?Thr?Ser?Tyr?Pro?Glu?Pro?Glu?Asn?Tyr?Ile?Pro?Asn?Gln

370?????????????????375?????????????????380

Ala?Asp?Ala?Tyr?Phe?Glu?Ser?Val?Phe?Pro?Glu?Thr?Ala?Asp?Lys?Lys

385?????????????????390?????????????????395?????????????????400

Glu?Pro?Ile?Gly?Leu?Ser?Ala?Ile?Phe?Ala?Asp?Lys?Glu?Val?Ser?Phe

405?????????????????410?????????????????415

Thr?Pro?Glu?Asn?Val?Asp?Arg?Ile?Lys?Arg?Arg?Glu?Ala?Tyr?Ile?Ala

420?????????????????425?????????????????430

Asn?Pro?Glu?His?Glu?Thr?Leu?Lys?Asp?Arg?Arg?Glu?Lys?Arg?Asp?Gln

435?????????????????440?????????????????445

Leu?Lys?Glu?Lys?Lys?Phe?Leu?Ala?Gln?Gln?Lys?Lys?Gln?Lys?Glu?Thr

450?????????????????455?????????????????460

Glu?Cys?Gly?Gly?Asp?Ser?Ser

465?????????????????470

<210>22

<211>438

<212>DNA

＜213〉clostridium propionicum (Clostridium propionicum)

<220>

<221>CDS

<222>(1)..(438)

<223>

<400>22

atg?gta?ggt?aaa?aag?gtt?gta?cat?cat?tta?atg?atg?agc?gca?aaa?gat???????48

Met?Val?Gly?Lys?Lys?Val?Val?His?His?Leu?Met?Met?Ser?Ala?Lys?Asp

1???????????????5???????????????????10??????????????????15

gct?cac?tat?act?gga?aac?tta?gta?aac?ggc?gct?aga?att?gtg?aat?cag???????96

Ala?His?Tyr?Thr?Gly?Asn?Leu?Val?Asn?Gly?Ala?Arg?Ile?Val?Asn?Gln

20??????????????????25??????????????????30

tgg?ggc?gac?gtt?ggt?aca?gaa?tta?atg?gtt?tat?gtt?gat?ggt?gac?ata??????144

Trp?Gly?Asp?Val?Gly?Thr?Glu?Leu?Met?Val?Tyr?Val?Asp?Gly?Asp?Ile

35??????????????????40??????????????????45

agc?tta?ttc?ttg?ggc?tac?aaa?gat?atc?gaa?ttc?aca?gct?cct?gta?tat??????192

Ser?Leu?Phe?Leu?Gly?Tyr?Lys?Asp?Ile?Glu?Phe?Thr?Ala?Pro?Val?Tyr

50??????????????????55??????????????????60

gtt?ggt?gac?ttt?atg?gaa?tac?cac?ggc?tgg?att?gaa?aaa?gtt?ggt?aac??????240

Val?Gly?Asp?Phe?Met?Glu?Tyr?His?Gly?Trp?Ile?Glu?Lys?Val?Gly?Asn

65??????????????????70??????????????????75??????????????????80

cag?tcc?tat?aca?tgt?aaa?ttt?gaa?gca?tgg?aaa?gtt?gca?aca?atg?gtt??????288

Gln?Ser?Tyr?Thr?Cys?Lys?Phe?Glu?Ala?Trp?Lys?Val?Ala?Thr?Met?Val

85??????????????????90??????????????????95

gat?atc?aca?aat?cct?cag?gat?aca?cgc?gca?aca?gct?tgt?gag?cct?ccg??????336

Asp?Ile?Thr?Asn?Pro?Gln?Asp?Thr?Arg?Ala?Thr?Ala?Cys?Glu?Pro?Pro

100?????????????????105?????????????????110

gta?ttg?tgc?gga?aga?gca?acg?ggt?agt?ttg?ttc?atc?gca?aaa?aaa?gat??????384

Val?Leu?Cys?Gly?Arg?Ala?Thr?Gly?Ser?Leu?Phe?Ile?Ala?Lys?Lys?Asp

115?????????????????120?????????????????125

cag?aga?ggc?cct?cag?gaa?tcc?tct?ttt?aaa?gag?aga?aag?cac?ccc?ggt??????432

Gln?Arg?Gly?Pro?Gln?Glu?Ser?Ser?Phe?Lys?Glu?Arg?Lys?His?Pro?Gly

130?????????????????135?????????????????140

gaa?tga?????????????????????????????????????????????????????????????438

Glu

145

<210>23

<211>145

<212>PRT

＜213〉clostridium propionicum (Clostridium propionicum)

<400>23

Met?Val?Gly?Lys?Lys?Val?Val?His?His?Leu?Met?Met?Ser?Ala?Lys?Asp

1???????????????5???????????????????10??????????????????15

Ala?His?Tyr?Thr?Gly?Asn?Leu?Val?Asn?Gly?Ala?Arg?Ile?Val?Asn?Gln

20??????????????????25??????????????????30

Trp?Gly?Asp?Val?Gly?Thr?Glu?Leu?Met?Val?Tyr?Val?Asp?GIy?Asp?Ile

35??????????????????40??????????????????45

Ser?Leu?Phe?Leu?Gly?Tyr?Lys?Asp?Ile?Glu?Phe?Thr?Ala?Pro?Val?Tyr

50??????????????????55??????????????????60

Val?Gly?Asp?Phe?Met?Glu?Tyr?His?Gly?Trp?Ile?Glu?Lys?Val?Gly?Asn

65??????????????????70??????????????????75??????????????????80

Gln?Ser?Tyr?Thr?Cys?Lys?Phe?Glu?Ala?Trp?Lys?Val?Ala?Thr?Met?Val

85??????????????????90??????????????????95

Asp?Ile?Thr?Asn?Pro?Gln?Asp?Thr?Arg?Ala?Thr?Ala?Cys?Glu?Pro?Pro

100?????????????????105?????????????????110

Val?Leu?Cys?Gly?Arg?Ala?Thr?Gly?Ser?Leu?Phe?Ile?Ala?Lys?Lys?Asp

115?????????????????120?????????????????125

Gln?Arg?Gly?Pro?Gln?Glu?Ser?Ser?Phe?Lys?Glu?Arg?Lys?His?Pro?Gly

130?????????????????135?????????????????140

Glu

145

<210>24

<211>1554

<212>DNA

＜213〉the huge ball-type bacterium of Erichsen (Megasphaera elsdenii)

<220>

<221>CDS

<222>(1)..(1554)

<223>

<400>24

atg?aga?aaa?gta?gaa?atc?att?aca?gct?gaa?caa?gca?gct?cag?ctc?gta???????48

Met?Arg?Lys?Val?Glu?Ile?Ile?Thr?Ala?Glu?Gln?Ala?Ala?Gln?Leu?Val

1???????????????5???????????????????10??????????????????15

aaa?gac?aac?gac?acg?att?acg?tct?atc?ggc?ttt?gtc?agc?agc?gcc?cat???????96

Lys?Asp?Asn?Asp?Thr?Ile?Thr?Ser?Ile?Gly?Phe?Val?Ser?Ser?Ala?His

20??????????????????25??????????????????30

ccg?gaa?gca?ctg?acc?aaa?gct?ttg?gaa?aaa?cgg?ttc?ctg?gac?acg?aac??????144

Pro?Glu?Ala?Leu?Thr?Lys?Ala?Leu?Glu?Lys?Arg?Phe?Leu?Asp?Thr?Asn

35??????????????????40??????????????????45

acc?ccg?cag?aac?ttg?acc?tac?atc?tat?gca?ggc?tct?cag?ggc?aaa?cgc??????192

Thr?Pro?Gln?Asn?Leu?Thr?Tyr?Ile?Tyr?Ala?Gly?Ser?Gln?Gly?Lys?Arg

50??????????????????55??????????????????60

gat?ggc?cgt?gcc?gct?gaa?cat?ctg?gca?cac?aca?ggc?ctt?ttg?aaa?cgc??????240

Asp?Gly?Arg?Ala?Ala?Glu?His?Leu?Ala?His?Thr?Gly?Leu?Leu?Lys?Arg

65??????????????????70??????????????????75??????????????????80

gcc?atc?atc?ggt?cac?tgg?cag?act?gta?ccg?gct?atc?ggt?aaa?ctg?gct??????288

Ala?Ile?Ile?Gly?His?Trp?Gln?Thr?Val?Pro?Ala?Ile?Gly?Lys?Leu?Ala

85??????????????????90??????????????????95

gtc?gaa?aac?aag?att?gaa?gct?tac?aac?ttc?tcg?cag?ggc?acg?ttg?gtc??????336

Val?Glu?Ash?Lys?Ile?Glu?Ala?Tyr?Asn?Phe?Ser?Gln?Gly?Thr?Leu?Val

100?????????????????105?????????????????110

cac?tgg?ttc?cgc?gcc?ttg?gca?ggt?cat?aag?ctc?ggc?gtc?ttc?acc?gac??????384

His?Trp?Phe?Arg?Ala?Leu?Ala?Gly?His?Lys?Leu?Gly?Val?Phe?Thr?Asp

115?????????????????120?????????????????125

atc?ggt?ctg?gaa?act?ttc?ctc?gat?ccc?cgt?cag?ctc?ggc?ggc?aag?ctc??????432

Ile?Gly?Leu?Glu?Thr?Phe?Leu?Asp?Pro?Arg?Gln?Leu?Gly?Gly?Lys?Leu

130?????????????????135?????????????????140

aat?gac?gta?acc?aaa?gaa?gac?ctc?gtc?aaa?ctg?atc?gaa?gtc?gat?ggt??????480

Asn?Asp?Val?Thr?Lys?Glu?Asp?Leu?Val?Lys?Leu?Ile?Glu?Val?Asp?Gly

145?????????????????150?????????????????155?????????????????160

cat?gaa?cag?ctt?ttc?tac?ccg?acc?ttc?ccg?gtc?aac?gta?gct?ttc?ctc??????528

His?Glu?Gln?Leu?Phe?Tyr?Pro?Thr?Phe?Pro?Val?Asn?Val?Ala?Phe?Leu

165?????????????????170?????????????????175

cgc?ggt?acg?tat?gct?gat?gaa?tcc?ggc?aat?atc?acc?atg?gac?gaa?gaa??????576

Arg?Gly?Thr?Tyr?Ala?Asp?Glu?Ser?Gly?Asn?Ile?Thr?Met?Asp?Glu?Glu

180?????????????????185?????????????????190

atc?ggg?cct?ttc?gaa?agc?act?tcc?gta?gcc?cag?gcc?gtt?cac?aac?tgt??????624

Ile?Gly?Pro?Phe?Glu?Ser?Thr?Ser?Val?Ala?Gln?Ala?Val?His?Asn?Cys

195?????????????????200?????????????????205

ggc?ggt?aaa?gtc?gtc?gtc?cag?gtc?aaa?gac?gtc?gtc?gct?cac?ggc?agc??????672

Gly?Gly?Lys?Val?Val?Val?Gln?Val?Lys?Asp?Val?Val?Ala?His?Gly?Ser

210?????????????????215?????????????????220

ctc?gac?ccg?cgc?atg?gtc?aag?atc?cct?ggc?atc?tat?gtc?gac?tac?gtc??????720

Leu?Asp?Pro?Arg?Met?Val?Lys?Ile?Pro?Gly?Ile?Tyr?Val?Asp?Tyr?Val

225?????????????????230?????????????????235?????????????????240

gtc?gta?gca?gct?ccg?gaa?gac?cat?cag?cag?acg?tat?gac?tgc?gaa?tac??????768

Val?Val?Ala?Ala?Pro?Glu?Asp?His?Gln?Gln?Thr?Tyr?Asp?Cys?Glu?Tyr

245?????????????????250?????????????????255

gat?ccg?tcc?ctc?agc?ggt?gaa?cat?cgt?gct?cct?gaa?ggc?gct?acc?gat??????816

Asp?Pro?Ser?Leu?Ser?Gly?Glu?His?Arg?Ala?Pro?Glu?Gly?Ala?Thr?Asp

260?????????????????265?????????????????270

gca?gct?ctc?ccc?atg?agc?gct?aag?aaa?atc?atc?ggc?cgc?cgc?ggc?gct??????864

Ala?Ala?Leu?Pro?Met?Ser?Ala?Lys?Lys?Ile?Ile?Gly?Arg?Arg?Gly?Ala

275?????????????????280?????????????????285

ttg?gaa?ttg?act?gaa?aac?gct?gtc?gtc?aac?ctc?ggc?gtc?ggt?gct?ccg??????912

Leu?Glu?Leu?Thr?Glu?Asn?Ala?Val?Val?Asn?Leu?Gly?Val?Gly?Ala?Pro

290?????????????????295?????????????????300

gaa?tac?gtt?gct?tct?gtt?gcc?ggt?gaa?gaa?ggt?atc?gcc?gat?acc?att??????960

Glu?Tyr?Val?Ala?Ser?Val?Ala?Gly?Glu?Glu?Gly?Ile?Ala?Asp?Thr?Ile

305?????????????????310?????????????????315?????????????????320

acc?ctg?acc?gtc?gaa?ggt?ggc?gcc?atc?ggt?ggc?gta?ccg?cag?ggc?ggt?????1008

Thr?Leu?Thr?Val?Glu?Gly?Gly?Ala?Ile?Gly?Gly?Val?Pro?Gln?Gly?Gly

325?????????????????330?????????????????335

gcc?cgc?ttc?ggt?tcg?tcc?cgc?aat?gcc?gat?gcc?atc?atc?gac?cac?acc?????1056

Ala?Arg?Phe?Gly?Ser?Ser?Arg?Asn?Ala?Asp?Ala?Ile?Ile?Asp?His?Thr

340?????????????????345?????????????????350

tat?cag?ttc?gac?ttc?tac?gat?ggc?ggc?ggt?ctg?gac?atc?gct?tac?ctc?????1104

Tyr?Gln?Phe?Asp?Phe?Tyr?Asp?Gly?Gly?Gly?Leu?Asp?Ile?Ala?Tyr?Leu

355?????????????????360?????????????????365

ggc?ctg?gcc?cag?tgc?gat?ggc?tcg?ggc?aac?atc?aac?gtc?agc?aag?ttc?????1152

Gly?Leu?Ala?Gln?Cys?Asp?Gly?Ser?Gly?Asn?Ile?Asn?Val?Ser?Lys?Phe

370?????????????????375?????????????????380

ggt?act?aac?gtt?gcc?ggc?tgc?ggc?ggt?ttc?ccc?aac?att?tcc?cag?cag?????1200

Gly?Thr?Asn?Val?Ala?Gly?Cys?Gly?Gly?Phe?Pro?Asn?Ile?Ser?Gln?Gln

385?????????????????390?????????????????395?????????????????400

aca?ccg?aat?gtt?tac?ttc?tgc?ggc?acc?ttc?acg?gct?ggc?ggc?ttg?aaa?????1248

Thr?Pro?Asn?Val?Tyr?Phe?Cys?Gly?Thr?Phe?Thr?Ala?Gly?Gly?Leu?Lys

405?????????????????410?????????????????415

atc?gct?gtc?gaa?gac?ggc?aaa?gtc?aag?atc?ctc?cag?gaa?ggc?aaa?gcc?????1296

Ile?Ala?Val?Glu?Asp?Gly?Lys?Val?Lys?Ile?Leu?Gln?Glu?Gly?Lys?Ala

420?????????????????425?????????????????430

aag?aag?ttc?atc?aaa?gct?gtc?gac?cag?atc?act?ttc?aac?ggt?tcc?tat?????1344

Lys?Lys?Phe?Ile?Lys?Ala?Val?Asp?Gln?Ile?Thr?Phe?Asn?Gly?Ser?Tyr

435?????????????????440?????????????????445

gca?gcc?cgc?aac?ggc?aaa?cac?gtt?ctc?tac?atc?aca?gaa?cgc?tgc?gta?????1392

Ala?Ala?Arg?Asn?Gly?Lys?His?Val?Leu?Tyr?Ile?Thr?Glu?Arg?Cys?Val

450?????????????????455?????????????????460

ttt?gaa?ctg?acc?aaa?gaa?ggc?ttg?aaa?ctc?atc?gaa?gtc?gca?ccg?ggc?????1440

Phe?Glu?Leu?Thr?Lys?Glu?Gly?Leu?Lys?Leu?Ile?Glu?Val?Ala?Pro?Gly

465?????????????????470?????????????????475?????????????????480

atc?gat?att?gaa?aaa?gat?atc?ctc?gct?cac?atg?gac?ttc?aag?ccg?atc?????1488

Ile?Asp?Ile?Glu?Lys?Asp?Ile?Leu?Ala?His?Met?Asp?Phe?Lys?Pro?lle

485?????????????????490?????????????????495

att?gat?aat?ccg?aaa?ctc?atg?gat?gcc?cgc?ctc?ttc?cag?gac?ggt?ccc?????1536

Ile?Asp?Asn?Pro?Lys?Leu?Met?Asp?Ala?Arg?Leu?Phe?Gln?Asp?Gly?Pro

500?????????????????505?????????????????510

atg?gga?ctg?aaa?aaa?taa?????????????????????????????????????????????1554

Met?Gly?Leu?Lys?Lys

515

<210>25

<211>517

<212>PRT

＜213〉the huge ball-type bacterium of Erichsen (Megasphaera elsdenii)

<400>25

Met?Arg?Lys?Val?Glu?Ile?Ile?Thr?Ala?Glu?Gln?Ala?Ala?Gln?Leu?Val

1???????????????5???????????????????10??????????????????15

Lys?Asp?Asn?Asp?Thr?Ile?Thr?Ser?Ile?Gly?Phe?Val?Ser?Ser?Ala?His

20??????????????????25??????????????????30

Pro?Glu?Ala?Leu?Thr?Lys?Ala?Leu?Glu?Lys?Arg?Phe?Leu?Asp?Thr?Asn

35??????????????????40??????????????????45

Thr?Pro?Gln?Asn?Leu?Thr?Tyr?Ile?Tyr?Ala?Gly?Ser?Gln?Gly?Lys?Arg

50??????????????????55??????????????????60

Asp?Gly?Arg?Ala?Ala?Glu?His?Leu?Ala?His?Thr?Gly?Leu?Leu?Lys?Arg

65??????????????????70??????????????????75??????????????????80

Ala?Ile?Ile?Gly?His?Trp?Gln?Thr?Val?Pro?Ala?Ile?Gly?Lys?Leu?Ala

85??????????????????90??????????????????95

Val?Glu?Asn?Lys?Ile?Glu?Ala?Tyr?Asn?Phe?Ser?Gln?Gly?Thr?Leu?Val

100?????????????????105?????????????????110

His?Trp?Phe?Arg?Ala?Leu?Ala?Gly?His?Lys?Leu?Gly?Val?Phe?Thr?Asp

115?????????????????120?????????????????125

Ile?Gly?Leu?Glu?Thr?Phe?Leu?Asp?Pro?Arg?Gln?Leu?Gly?Gly?Lys?Leu

130?????????????????135?????????????????140

Asn?Asp?Val?Thr?Lys?Glu?Asp?Leu?Val?Lys?Leu?Ile?Glu?Val?Asp?Gly

145?????????????????150?????????????????155?????????????????160

His?Glu?Gln?Leu?Phe?Tyr?Pro?Thr?Phe?Pro?Val?Asn?Val?Ala?Phe?Leu

165?????????????????170?????????????????175

Arg?Gly?Thr?Tyr?Ala?Asp?Glu?Ser?Gly?Asn?Ile?Thr?Met?Asp?Glu?Glu

180?????????????????185?????????????????190

Ile?Gly?Pro?Phe?Glu?Ser?Thr?Ser?Val?Ala?Gln?Ala?Val?His?Asn?Cys

195?????????????????200?????????????????205

Gly?Gly?Lys?Val?Val?Val?Gln?Val?Lys?Asp?Val?Val?Ala?His?Gly?Ser

210?????????????????215?????????????????220

Leu?Asp?Pro?Arg?Met?Val?Lys?Ile?Pro?Gly?Ile?Tyr?Val?Asp?Tyr?Val

225?????????????????230?????????????????235?????????????????240

Val?Val?Ala?Ala?Pro?Glu?Asp?His?Gln?Gln?Thr?Tyr?Asp?Cys?Glu?Tyr

245?????????????????250?????????????????255

Asp?Pro?Ser?Leu?Ser?Gly?Glu?His?Arg?Ala?Pro?Glu?Gly?Ala?Thr?Asp

260?????????????????265?????????????????270

Ala?Ala?Leu?Pro?Met?Ser?Ala?Lys?Lys?Ile?Ile?Gly?Arg?Arg?Gly?Ala

275?????????????????280?????????????????285

Leu?Glu?Leu?Thr?Glu?Asn?Ala?Val?Val?Asn?Leu?Gly?Val?Gly?Ala?Pro

290?????????????????295?????????????????300

Glu?Tyr?Val?Ala?Ser?Val?Ala?Gly?Glu?Glu?Gly?Ile?Ala?Asp?Thr?Ile

305?????????????????310?????????????????315?????????????????320

Thr?Leu?Thr?Val?Glu?Gly?Gly?Ala?Ile?Gly?Gly?Val?Pro?Gln?Gly?Gly

325?????????????????330?????????????????335

Ala?Arg?Phe?Gly?Ser?Ser?Arg?Asn?Ala?Asp?Ala?Ile?Ile?Asp?His?Thr

340?????????????????345?????????????????350

Tyr?Gln?Phe?Asp?Phe?Tyr?Asp?Gly?Gly?Gly?Leu?Asp?Ile?Ala?Tyr?Leu

355?????????????????360?????????????????365

Gly?Leu?Ala?Gln?Cys?Asp?Gly?Ser?Gly?Asn?Ile?Asn?Val?Ser?Lys?Phe

370?????????????????375?????????????????380

Gly?Thr?Asn?Val?Ala?Gly?Cys?Gly?Gly?Phe?Pro?Ash?Ile?Ser?Gln?Gln

385?????????????????390?????????????????395?????????????????400

Thr?Pro?Asn?Val?Tyr?Phe?Cys?Gly?Thr?Phe?Thr?Ala?Gly?Gly?Leu?Lys

405?????????????????410?????????????????415

Ile?Ala?Val?Glu?Asp?Gly?Lys?Val?Lys?Ile?Leu?Gln?Glu?Gly?Lys?Ala

420?????????????????425?????????????????430

Lys?Lys?Phe?Ile?Lys?Ala?Val?Asp?Gln?Ile?Thr?Phe?Asn?Gly?Ser?Tyr

435?????????????????440?????????????????445

Ala?Ala?Arg?Asn?Gly?Lys?His?Val?Leu?Tyr?Ile?Thr?Glu?Arg?Cys?Val

450?????????????????455?????????????????460

Phe?Glu?Leu?Thr?Lys?Glu?Gly?Leu?Lys?Leu?Ile?Glu?Val?Ala?Pro?Gly

465?????????????????470?????????????????475?????????????????480

Ile?Asp?Ile?Glu?Lys?Asp?Ile?Leu?Ala?His?Met?Asp?Phe?Lys?Pro?Ile

485?????????????????490?????????????????495

Ile?Asp?Asn?Pro?Lys?Leu?Met?Asp?Ala?Arg?Leu?Phe?Gln?Asp?Gly?Pro

500?????????????????505?????????????????510

Met?Gly?Leu?Lys?Lys

515

<210>26

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>26

caagctgggt?ctgttcatgc?tggatg??????????????????????????????????????????26

<210>27

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>27

aagcggttct?cgccctcgta?aacctga?????????????????????????????????????????27

<210>28

<211>416

<212>PRT

＜213〉porphyromonas gingivalis (Porphyromonas gingivalis)

<400>28

Met?Ala?Glu?Ser?Arg?Arg?Lys?Tyr?Tyr?Phe?Pro?Asp?Val?Thr?Asp?Glu

1???????????????5???????????????????10??????????????????15

Gln?Trp?Asn?Asp?Trp?His?Trp?Gln?Val?Leu?Asn?Arg?Ile?Glu?Thr?Leu

20??????????????????25??????????????????30

Asp?Gln?Leu?Lys?Lys?Tyr?Val?Thr?Leu?Thr?Ala?Glu?Glu?Glu?Glu?Gly

35??????????????????40??????????????????45

Val?Lys?Glu?Ser?Leu?Lys?Val?Leu?Arg?Met?Ala?Ile?Thr?Pro?Tyr?Tyr

50??????????????????55??????????????????60

Leu?Ser?Leu?Ile?Asp?Pro?Glu?Asn?Pro?Asn?Cys?Pro?Ile?Arg?Lys?Gln

65??????????????????70??????????????????75??????????????????80

Ala?Ile?Pro?Thr?His?Gln?Glu?Leu?Val?Arg?Ala?Pro?Glu?Asp?Gln?Val

85??????????????????90??????????????????95

Asp?Pro?Leu?Ser?Glu?Asp?Glu?Asp?Ser?Pro?Val?Pro?Gly?Leu?Thr?His

100?????????????????105?????????????????110

Arg?Tyr?Pro?Asp?Arg?Val?Leu?Phe?Leu?Ile?Thr?Asp?Lys?Cys?Ser?Met

115?????????????????120?????????????????125

Tyr?Cys?Arg?His?Cys?Thr?Arg?Arg?Arg?Phe?Ala?Gly?Gln?Lys?Asp?Ala

130?????????????????135?????????????????140

Ser?Ser?Pro?Ser?Glu?Arg?Ile?Asp?Arg?Cys?Ile?Asp?Tyr?Ile?Ala?Asn

145?????????????????150?????????????????155?????????????????160

Thr?Pro?Thr?Val?Arg?Asp?Val?Leu?Leu?Ser?Gly?Gly?Asp?Ala?Leu?Leu

165?????????????????170?????????????????175

Val?Ser?Asp?Glu?Arg?Leu?Glu?Tyr?Ile?Leu?Lys?Arg?Leu?Arg?Glu?Ile

180?????????????????185?????????????????190

Pro?His?Val?Glu?Ile?Val?Arg?Ile?Gly?Ser?Arg?Thr?Pro?Val?Val?Leu

195?????????????????200?????????????????205

Pro?Gln?Arg?Ile?Thr?Pro?Gln?Leu?Val?Asp?Met?Leu?Lys?Lys?Tyr?His

210?????????????????215?????????????????220

Pro?Val?Trp?Leu?Asn?Thr?His?Phe?Asn?His?Pro?Asn?Glu?Val?Thr?Glu

225?????????????????230?????????????????235?????????????????240

Glu?Ala?Val?Glu?Ala?Cys?Glu?Arg?Met?Ala?Asn?Ala?Gly?Ile?Pro?Leu

245?????????????????250?????????????????255

Gly?Asn?Gln?Thr?Val?Leu?Leu?Arg?Gly?Ile?Asn?Asp?Cys?Thr?His?Val

260?????????????????265?????????????????270

Met?Lys?Arg?Leu?Val?His?Leu?Leu?Val?Lys?Met?Arg?Val?Arg?Pro?Tyr

275?????????????????280?????????????????285

Tyr?Ile?Tyr?Val?Cys?Asp?Leu?Ser?Leu?Gly?Ile?Gly?His?Phe?Arg?Thr

290?????????????????295?????????????????300

Pro?Val?Ser?Lys?Gly?Ile?Glu?Ile?Ile?Glu?Asn?Leu?Arg?Gly?His?Thr

305?????????????????310?????????????????315?????????????????320

Ser?Gly?Tyr?Ala?Val?Pro?Thr?Phe?Val?Val?Asp?Ala?Pro?Gly?Gly?Gly

325?????????????????330?????????????????335

Gly?Lys?Ile?Pro?Val?Met?Pro?Asn?Tyr?Val?Val?Ser?Gln?Ser?Pro?Arg

340?????????????????345?????????????????350

His?Val?Val?Leu?Arg?Asn?Tyr?Glu?Gly?Val?Ile?Thr?Thr?Tyr?Thr?Glu

355?????????????????360?????????????????365

Pro?Glu?Asn?Tyr?His?Glu?Glu?Cys?Asp?Cys?Glu?Asp?Cys?Arg?Ala?Gly

370?????????????????375?????????????????380

Lys?His?Lys?Glu?Gly?Val?Ala?Ala?Leu?Ser?Gly?Gly?Gln?Gln?Leu?Ala

385?????????????????390?????????????????395?????????????????400

Ile?Glu?Pro?Ser?Asp?Leu?Ala?Arg?Lys?Lys?Arg?Lys?Phe?Asp?Lys?Asn

405?????????????????410?????????????????415

<210>29

<211>1251

<212>DNA

＜213〉porphyromonas gingivalis (Porphyromonas gingivalis)

<220>

<221>CDS

<222>(1)..(1251)

<223>

<400>29

atg?gca?gaa?agt?cgt?aga?aag?tat?tat?ttc?cct?gat?gtc?acc?gat?gag???????48

Met?Ala?Glu?Ser?Arg?Arg?Lys?Tyr?Tyr?Phe?Pro?Asp?Val?Thr?Asp?Glu

1???????????????5???????????????????10??????????????????15

caa?tgg?tac?gac?tgg?cat?tgg?cag?gtc?ctc?aat?cga?att?gag?acg?ctc???????96

Gln?Trp?Tyr?Asp?Trp?His?Trp?Gln?Val?Leu?Asn?Arg?Ile?Glu?Thr?Leu

20??????????????????25??????????????????30

gac?cag?ctg?aaa?aag?tac?gtt?aca?ctc?acc?gct?gaa?gaa?gaa?gag?gga??????144

Asp?Gln?Leu?Lys?Lys?Tyr?Val?Thr?Leu?Thr?Ala?Glu?Glu?Glu?Glu?Gly

35??????????????????40??????????????????45

gta?aaa?gaa?tcg?ccc?aaa?gta?ctc?cga?atg?gct?atc?aca?cct?tat?tat??????192

Val?Lys?Glu?Ser?Pro?Lys?Val?Leu?Arg?Met?Ala?Ile?Thr?Pro?Tyr?Tyr

50??????????????????55??????????????????60

ttg?agt?ttg?ata?gac?ccc?gag?aat?cct?aat?tgt?ccg?att?cgt?aaa?caa??????240

Leu?Ser?Leu?lle?Asp?Pro?Glu?Asn?Pro?Asn?Cys?Pro?Ile?Arg?Lys?Gln

65??????????????????70??????????????????75??????????????????80

gcc?att?cct?act?caa?cag?gaa?ctg?gta?cgt?gct?cct?gaa?gat?cag?gta??????288

Ala?Ile?Pro?Thr?Gln?Gln?Glu?Leu?Val?Arg?Ala?Pro?Glu?Asp?Gln?Val

85??????????????????90??????????????????95

gac?cca?ctt?agt?gaa?gat?gaa?gat?tcg?ccc?gta?ccc?gga?ctg?act?cat??????336

Asp?Pro?Leu?Ser?Glu?Asp?Glu?Asp?Ser?Pro?Val?Pro?Gly?Leu?Thr?His

100?????????????????105?????????????????110

cgt?tat?ccg?gat?cgt?gta?ttg?ttc?ctt?atc?acg?gac?aaa?tgt?tcg?atg??????384

Arg?Tyr?Pro?Asp?Arg?Val?Leu?Phe?Leu?Ile?Thr?Asp?Lys?Cys?Ser?Met

115?????????????????120?????????????????125

tac?tgt?cgt?cat?tgt?act?cgc?cgt?cgc?ttc?gca?gga?cag?aaa?gat?gct??????432

Tyr?Cys?Arg?His?Cys?Thr?Arg?Arg?Arg?Phe?Ala?Gly?Gln?Lys?Asp?Ala

130?????????????????135?????????????????140

tct?tct?cct?tct?gag?cgc?atc?gat?cga?tgc?att?gac?tat?ata?gcc?aat??????480

Ser?Ser?Pro?Ser?Glu?Arg?Ile?Asp?Arg?Cys?Ile?Asp?Tyr?Ile?Ala?Asn

145?????????????????150?????????????????155?????????????????160

aca?ccg?aca?gtc?cgc?gat?gtt?ttg?cta?tcg?gga?ggc?gat?gcc?ctc?ctt??????528

Thr?Pro?Thr?Val?Arg?Asp?Val?Leu?Leu?Ser?Gly?Gly?Asp?Ala?Leu?Leu

165?????????????????170?????????????????175

gtc?agc?gac?gaa?cgc?ttg?gaa?tac?ata?ttg?aag?cgt?ctg?cgc?gaa?ata??????576

Val?Ser?Asp?Glu?Arg?Leu?Glu?Tyr?Ile?Leu?Lys?Arg?Leu?Arg?Glu?Ile

180?????????????????185?????????????????190

cct?cat?gtg?gag?att?gtt?cgt?ata?gga?agc?cgt?acg?ccg?gta?gtc?ctc??????624

Pro?His?Val?Glu?Ile?Val?Arg?Ile?Gly?Ser?Arg?Thr?Pro?Val?Val?Leu

195?????????????????200?????????????????205

cct?cag?cgt?ata?acg?cct?caa?ttg?gtg?gat?atg?ctc?aaa?aaa?tat?cat??????672

Pro?Gln?Arg?Ile?Thr?Pro?Gln?Leu?Val?Asp?Met?Leu?Lys?Lys?Tyr?His

210?????????????????215?????????????????220

ccg?gtg?tgg?ctg?aac?act?cac?ttc?aac?cac?ccg?aat?gaa?gtt?acc?gaa??????720

Pro?Val?Trp?Leu?Asn?Thr?His?Phe?Asn?His?Pro?Asn?Glu?Val?Thr?Glu

225?????????????????230?????????????????235?????????????????240

gaa?gca?gta?gag?gct?tgt?gaa?aga?atg?gcc?aat?gcc?ggt?att?ccg?ttg??????768

Glu?Ala?Val?Glu?Ala?Cys?Glu?Arg?Met?Ala?Asn?Ala?Gly?Ile?Pro?Leu

245?????????????????250?????????????????255

ggt?aac?caa?acg?gtt?tta?ttg?cgt?gga?atc?aat?gat?tgt?aca?cat?gtg??????816

Gly?Asn?Gln?Thr?Val?Leu?Leu?Arg?Gly?Ile?Asn?Asp?Cys?Thr?His?Val

260?????????????????265?????????????????270

atg?aag?aga?ttg?gta?cat?ttg?ctg?gta?aag?atg?cgt?gtg?cgt?cct?tac??????864

Met?Lys?Arg?Leu?Val?His?Leu?Leu?Val?Lys?Met?Arg?Val?Arg?Pro?Tyr

275?????????????????280?????????????????285

tat?ata?tat?gta?tgc?gat?ctt?tcg?ctt?gga?ata?ggt?cat?ttc?cgc?acg??????912

Tyr?Ile?Tyr?Val?Cys?Asp?Leu?Ser?Leu?Gly?Ile?Gly?His?Phe?Arg?Thr

290?????????????????295?????????????????300

ccg?gta?tct?aaa?gga?atc?gaa?att?atc?gaa?aat?ttg?cgc?gga?cac?acc??????960

Pro?Val?Ser?Lys?Gly?Ile?Glu?Ile?Ile?Glu?Asn?Leu?Arg?Gly?His?Thr

305?????????????????310?????????????????315?????????????????????????????????????320

tcg?ggc?tat?gca?gtt?cct?acc?ttt?gtg?gta?ggt?gct?ccg?ggg?ggt?ggt?????1008

Ser?Gly?Tyr?Ala?Val?Pro?Thr?Phe?Val?Val?Gly?Ala?Pro?Gly?Gly?Gly

325?????????????????330?????????????????335

ggt?aag?ata?cct?gta?acg?ccg?aac?tat?gtt?gta?tct?cag?tcc?cca?cga?????1056

Gly?Lys?Ile?Pro?Val?Thr?Pro?Asn?Tyr?Val?Val?Ser?Gln?Ser?Pro?Arg

340?????????????????345?????????????????350

cat?gtg?gtt?ctt?cgc?aat?tat?gaa?ggt?gtt?atc?aca?acc?tat?acg?gag?????1104

His?Val?Val?Leu?Arg?Asn?Tyr?Glu?Gly?Val?Ile?Thr?Thr?Tyr?Thr?Glu

355?????????????????360?????????????????365

ccg?gag?aat?tat?cat?gag?gag?tgc?gat?tgt?gag?gac?tgt?cga?gcc?ggt?????1152

Pro?Glu?Asn?Tyr?His?Glu?Glu?Cys?Asp?Cys?Glu?Asp?Cys?Arg?Ala?Gly

370?????????????????375?????????????????380

aag?cat?aaa?gag?ggt?gta?gct?gca?ctt?tcc?gga?ggt?cag?cag?ttg?gct?????1200

Lys?His?Lys?Glu?Gly?Val?Ala?Ala?Leu?Ser?Gly?Gly?Gln?Gln?Leu?Ala

385?????????????????390?????????????????395?????????????????400

atc?gag?cct?tcc?gac?tta?gct?cgc?aaa?aaa?cgc?aag?ttt?gat?aag?aac?????1248

Ile?Glu?Pro?Ser?Asp?Leu?Ala?Arg?Lys?Lys?Arg?Lys?Phe?Asp?Lys?Ash

405?????????????????410?????????????????415

tga?????????????????????????????????????????????????????????????????1251

<210>30

<211>416

<212>PRT

＜213〉porphyromonas gingivalis (Porphyromonas gingivalis)

<400>30

Met?Ala?Glu?Ser?Arg?Arg?Lys?Tyr?Tyr?Phe?Pro?Asp?Val?Thr?Asp?Glu

1???????????????5???????????????????10??????????????????15

Gln?Trp?Tyr?Asp?Trp?His?Trp?Gln?Val?Leu?Asn?Arg?Ile?Glu?Thr?Leu

20??????????????????25??????????????????30

Asp?Gln?Leu?Lys?Lys?Tyr?Val?Thr?Leu?Thr?Ala?Glu?Glu?Glu?Glu?Gly

35??????????????????40??????????????????45

Val?Lys?Glu?Ser?Pro?Lys?Val?Leu?Arg?Met?Ala?Ile?Thr?Pro?Tyr?Tyr

50??????????????????55??????????????????60

Leu?Ser?Leu?Ile?Asp?Pro?Glu?Asn?Pro?Asn?Cys?Pro?Ile?Arg?Lys?Gln

65??????????????????70??????????????????75??????????????????80

Ala?Ile?Pro?Thr?Gln?Gln?Glu?Leu?Val?Arg?Ala?Pro?Glu?Asp?Gln?Val

85??????????????????90??????????????????95

Asp?Pro?Leu?Ser?Glu?Asp?Glu?Asp?Ser?Pro?Val?Pro?Gly?Leu?Thr?His

100?????????????????105?????????????????110

Arg?Tyr?Pro?Asp?Arg?Val?Leu?Phe?Leu?Ile?Thr?Asp?Lys?Cys?Ser?Met

115?????????????????120?????????????????125

Tyr?Cys?Arg?His?Cys?Thr?Arg?Arg?Arg?Phe?Ala?Gly?Gln?Lys?Asp?Ala

130?????????????????135?????????????????140

Ser?Ser?Pro?Ser?Glu?Arg?Ile?Asp?Arg?Cys?Ile?Asp?Tyr?Ile?Ala?Asn

145?????????????????150?????????????????155?????????????????160

Thr?Pro?Thr?Val?Arg?Asp?Val?Leu?Leu?Ser?Gly?Gly?Asp?Ala?Leu?Leu

165?????????????????170?????????????????175

Val?Ser?Asp?Glu?Arg?Leu?Glu?Tyr?Ile?Leu?Lys?Arg?Leu?Arg?Glu?Ile

180?????????????????185?????????????????190

Pro?His?Val?Glu?Ile?Val?Arg?Ile?Gly?Ser?Arg?Thr?Pro?Val?Val?Leu

195?????????????????200?????????????????205

Pro?Gln?Arg?Ile?Thr?Pro?Gln?Leu?Val?Asp?Met?Leu?Lys?Lys?Tyr?His

210?????????????????215?????????????????220

Pro?Val?Trp?Leu?Asn?Thr?His?Phe?Asn?His?Pro?Asn?Glu?Val?Thr?Glu

225?????????????????230?????????????????235?????????????????240

Glu?Ala?Val?Glu?Ala?Cys?Glu?Arg?Met?Ala?Asn?Ala?Gly?Ile?Pro?Leu

245?????????????????250?????????????????255

Gly?Asn?Gln?Thr?Val?Leu?Leu?Arg?Gly?Ile?Asn?Asp?Cys?Thr?His?Val

260?????????????????265?????????????????270

Met?Lys?Arg?Leu?Val?His?Leu?Leu?Val?Lys?Met?Arg?Val?Arg?Pro?Tyr

275?????????????????280?????????????????285

Tyr?Ile?Tyr?Val?Cys?Asp?Leu?Ser?Leu?Gly?Ile?Gly?His?Phe?Arg?Thr

290?????????????????295?????????????????300

Pro?Val?Ser?Lys?Gly?Ile?Glu?Ile?Ile?Glu?Asn?Leu?Arg?Gly?His?Thr

305?????????????????310?????????????????315?????????????????320

Ser?Gly?Tyr?Ala?Val?Pro?Thr?Phe?Val?Val?Gly?Ala?Pro?Gly?Gly?Gly

325?????????????????330?????????????????335

Gly?Lys?Ile?Pro?Val?Thr?Pro?Asn?Tyr?Val?Val?Ser?Gln?Ser?Pro?Arg

340?????????????????345?????????????????350

His?Val?Val?Leu?Arg?Asn?Tyr?Glu?Gly?Val?Ile?Thr?Thr?Tyr?Thr?Glu

355?????????????????360?????????????????365

Pro?Glu?Asn?Tyr?His?Glu?Glu?Cys?Asp?Cys?Glu?Asp?Cys?Arg?Ala?Gly

370?????????????????375?????????????????380

Lys?His?Lys?Glu?Gly?Val?Ala?Ala?Leu?Ser?Gly?Gly?Gln?Gln?Leu?Ala

385?????????????????390?????????????????395?????????????????400

Ile?Glu?Pro?Ser?Asp?Leu?Ala?Arg?Lys?Lys?Arg?Lys?Phe?Asp?Lys?Asn

405?????????????????410?????????????????415

<210>31

<211>471

<212>PRT

＜213〉subtilis (Bacillus subtilis)

<400>31

Met?Lys?Asn?Lys?Trp?Tyr?Lys?Pro?Lys?Arg?His?Trp?Lys?Glu?Ile?Glu

1???????????????5???????????????????10??????????????????15

Leu?Trp?Lys?Asp?Val?Pro?Glu?Glu?Lys?Trp?Asn?Asp?Trp?Leu?Trp?Gln

20??????????????????25??????????????????30

Leu?Thr?His?Thr?Val?Arg?Thr?Leu?Asp?Asp?Leu?Lys?Lys?Val?Ile?Asn

35??????????????????40??????????????????45

Leu?Thr?Glu?Asp?Glu?Glu?Glu?Gly?Val?Arg?Ile?Ser?Thr?Lys?Thr?Ile

50??????????????????55??????????????????60

Pro?Leu?Asn?Ile?Thr?Pro?Tyr?Tyr?Ala?Ser?Leu?Met?Asp?Pro?Asp?Asn

65??????????????????70??????????????????75??????????????????80

Pro?Arg?Cys?Pro?Val?Arg?Met?Gln?Ser?Val?Pro?Leu?Ser?Glu?Glu?Met

85??????????????????90??????????????????95

His?Lys?Thr?Lys?Tyr?Asp?Leu?Glu?Asp?Pro?Leu?His?Glu?Asp?Glu?Asp

100?????????????????105?????????????????110

Ser?Pro?Val?Pro?Gly?Leu?Thr?His?Arg?Tyr?Pro?Asp?Arg?Val?Leu?Phe

115?????????????????120?????????????????125

Leu?Val?Thr?Asn?Gln?Cys?Ser?Met?Tyr?Cys?Arg?Tyr?Cys?Thr?Arg?Arg

130?????????????????135?????????????????140

Arg?Phe?Ser?Gly?Gln?Ile?Gly?Met?Gly?Val?Pro?Lys?Lys?Gln?Leu?Asp

145?????????????????150?????????????????155?????????????????160

Ala?Ala?Ile?Ala?Tyr?Ile?Arg?Glu?Thr?Pro?Glu?Ile?Arg?Asp?Cys?Leu

165?????????????????170?????????????????175

Ile?Ser?Gly?Gly?Asp?Gly?Leu?Leu?Ile?Asn?Asp?Gln?Ile?Leu?Glu?Tyr

180?????????????????185?????????????????190

Ile?Leu?Lys?Glu?Leu?Arg?Ser?Ile?Pro?His?Leu?Glu?Val?Ile?Arg?Ile

195?????????????????200?????????????????205

Gly?Thr?Arg?Ala?Pro?Val?Val?Phe?Pro?Gln?Arg?Ile?Thr?Asp?His?Leu

210?????????????????215?????????????????220

Cys?Glu?Ile?Leu?Lys?Lys?Tyr?His?Pro?Val?Trp?Leu?Asn?Thr?His?Phe

225?????????????????230?????????????????235?????????????????240

Asn?Thr?Ser?Ile?Glu?Met?Thr?Glu?Glu?Ser?Val?Glu?Ala?Cys?Glu?Lys

245?????????????????250?????????????????255

Leu?Val?Asn?Ala?Gly?Val?Pro?Val?Gly?Asn?Gln?Ala?Val?Val?Leu?Ala

260?????????????????265?????????????????270

Gly?Ile?Asn?Asp?Ser?Val?Pro?Ile?Met?Lys?Lys?Leu?Met?His?Asp?Leu

275?????????????????280?????????????????285

Val?Lys?Ile?Arg?Val?Arg?Pro?Tyr?Tyr?Ile?Tyr?Gln?Cys?Asp?Leu?Ser

290?????????????????295?????????????????300

Glu?Gly?Ile?Gly?His?Phe?Arg?Ala?Pro?Val?Ser?Lys?Gly?Leu?Glu?Ile

305?????????????????310?????????????????315?????????????????320

Ile?Glu?Gly?Leu?Arg?Gly?His?Thr?Ser?Gly?Tyr?Ala?Val?Pro?Thr?Phe

325?????????????????330?????????????????335

Val?Val?Asp?Ala?Pro?Gly?Gly?Gly?Gly?Lys?Ile?Ala?Leu?Gln?Pro?Asn

340?????????????????345?????????????????350

Tyr?Val?Leu?Ser?Gln?Ser?Pro?Asp?Lys?Val?Ile?Leu?Arg?Asn?Phe?Glu

355?????????????????360?????????????????365

Gly?Val?Ile?Thr?Ser?Tyr?Pro?Glu?Pro?Glu?Asn?Tyr?Ile?Pro?Asn?Gln

370?????????????????375?????????????????380

Ala?Asp?Ala?Tyr?Phe?Glu?Ser?Val?Phe?Pro?Glu?Thr?Ala?Asp?Lys?Lys

385?????????????????390?????????????????395?????????????????400

Glu?Pro?Ile?Gly?Leu?Ser?Ala?Ile?Phe?Ala?Asp?Lys?Glu?Val?Ser?Phe

405?????????????????410?????????????????415

Thr?Pro?Glu?Asn?Val?Asp?Arg?Ile?Lys?Arg?Arg?Glu?Ala?Tyr?Ile?Ala

420?????????????????425?????????????????430

Asn?Pro?Glu?His?Glu?Thr?Leu?Lys?Asp?Arg?Arg?Glu?Lys?Arg?Asp?Gln

435?????????????????440?????????????????445

Leu?Lys?Glu?Lys?Lys?Phe?Leu?Ala?Gln?Gln?Lys?Lys?Gln?Lys?Glu?Thr

450?????????????????455?????????????????460

Glu?Cys?Gly?Gly?Asp?Ser?Ser

465?????????????????470

<210>32

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>32

cgcattcaag?tcaaagacgt?tcaggcta????????????????????????????????????????28

<210>33

<211>1387

<212>DNA

＜213〉Alcaligenes faecalis (Alcaligenes faecalis)

<220>

<221>CDS

<222>(408)..(1304)

<223>

<400>33

cattacacag?gctctgcagc?agtggcaggg?cagtgccgac?ccctggttgt?cccgtgccgc?????60

gcaaaccttc?gccaaaggtg?cgcctggttc?ggctcgtttg?tcctttgagc?tgctggagag????120

ggtgcatcac?ctgtctttgg?ccgatgtttt?ccgtctggaa?tacattgtgt?cgctgcaatg????180

tggcgtacag?ggcgacttcc?aggaaggcat?acgggcactg?ctgattgata?aagacaaaca????240

gccgcgctgg?aatcctgcct?cgctggaaca?ggcggatgca?cgctgggtgg?aacgtttttt????300

tgttcctgcc?tggccggcag?aaacgactca?tcccttggct?gacctgtaac?ccaggcagac????360

cgctgcggcg?ccagacggcg?ccgctttcat?aatgacgagg?agacaaa?atg?agt?aac??????416

Met?Ser?Asn

1

acg?att?gca?ttt?atc?ggg?ctg?ggc?cat?atg?ggt?aaa?ccc?atg?gcg?ctg??????464

Thr?Ile?Ala?Phe?Ile?Gly?Leu?Gly?His?Met?Gly?Lys?Pro?Met?Ala?Leu

5???????????????????l0??????????????????15

aat?ctg?ctc?aaa?gcc?ggt?cat?agc?ctg?aac?gtc?ttt?gac?ttg?aat?gcg??????512

Asn?Leu?Leu?Lys?Ala?Gly?His?Ser?Leu?Asn?Val?Phe?Asp?Leu?Asn?Ala

20??????????????????25??????????????????30??????????????????35

caa?gcc?atg?cag?gaa?ctg?cag?gca?gca?ggg?gca?cag?gtg?ggg?gaa?tcg??????560

Gln?Ala?Met?Gln?Glu?Leu?Gln?Ala?Ala?Gly?Ala?Gln?Val?Gly?Glu?Ser

40??????????????????45??????????????????50

gcg?gtg?caa?atc?gcc?caa?gac?gcg?cag?atg?gtc?ttt?acc?atg?ctg?cct??????608

Ala?Val?Gln?Ile?Ala?Gln?Asp?Ala?Gln?Met?Val?Phe?Thr?Met?Leu?Pro

55??????????????????60??????????????????65

gct?ggc?cgc?cat?gtt?cgt?cag?gtt?tac?gag?ggc?gag?aac?ggc?ttg?ctg??????656

Ala?Gly?Arg?His?Val?Arg?Gln?Val?Tyr?Glu?Gly?Glu?Asn?Gly?Leu?Leu

70??????????????????75??????????????????80

cag?act?gtg?gcc?ccc?ggt?acg?gtg?ctg?gtc?gat?tgc?agc?acc?att?gat??????704

Gln?Thr?Val?Ala?Pro?Gly?Thr?Val?Leu?Val?Asp?Cys?Ser?Thr?Ile?Asp

85??????????????????90??????????????????95

gcg?caa?acc?agc?cag?gat?ctg?gcg?gcc?aaa?gcc?agc?aag?ctg?ggt?ctg??????752

Ala?Gln?Thr?Ser?Gln?Asp?Leu?Ala?Ala?Lys?Ala?Ser?Lys?Leu?Gly?Leu

100?????????????????105?????????????????110?????????????????115

ttc?atg?ctg?gat?gcg?ccg?gtc?tcc?ggt?ggg?acc?ggt?ggc?gcc?att?gct??????800

Phe?Met?Leu?Asp?Ala?Pro?Val?Ser?Gly?Gly?Thr?Gly?Gly?Ala?Ile?Ala

120?????????????????125?????????????????130

ggc?acc?ttg?acc?ttt?atg?gtc?ggg?ggc?gag?gat?cag?gcc?ctg?gaa?aag??????848

Gly?Thr?Leu?Thr?Phe?Met?Val?Gly?Gly?Glu?Asp?Gln?Ala?Leu?Glu?Lys

135?????????????????140?????????????????145

gcg?cgc?cct?tac?ttg?gat?gcc?atg?ggc?aag?aac?att?ttc?cac?gcg?ggt??????896

Ala?Arg?Pro?Tyr?Leu?Asp?Ala?Met?Gly?Lys?Asn?Ile?Phe?His?Ala?Gly

150?????????????????155?????????????????160

aaa?gcc?ggt?gcg?ggt?cag?gtt?gcc?aag?att?tgc?aac?aat?atg?ctc?ttg??????944

Lys?Ala?Gly?Ala?Gly?Gln?Val?Ala?Lys?Ile?Cys?Asn?Asn?Met?Leu?Leu

165?????????????????170?????????????????175

ggg?att?ttg?atg?gcg?ggt?act?gct?gaa?gcc?ttg?gct?ttg?ggc?gtt?gcc??????992

Gly?Ile?Leu?Met?Ala?Gly?Thr?Ala?Glu?Ala?Leu?Ala?Leu?Gly?Val?Ala

180?????????????????185?????????????????190?????????????????195

cac?ggt?ctg?gac?cct?gcc?gtg?ctg?tcg?acc?atc?atg?gcg?cgc?agt?tcc?????1040

His?Gly?Leu?Asp?Pro?Ala?Val?Leu?Ser?Thr?Ile?Met?Ala?Arg?Ser?Ser

200?????????????????205?????????????????210

ggt?cga?aac?tgg?gca?acc?gag?ctg?tac?aac?ccc?tgg?cct?ggg?gtg?atg?????1088

Gly?Arg?Asn?Trp?Ala?Thr?Glu?Leu?Tyr?Asn?Pro?Trp?Pro?Gly?Val?Met

215?????????????????220?????????????????225

ccg?gat?gta?ccg?gct?tcg?cgt?gat?tat?cag?ggc?ggt?ttt?gcg?acg?ggc?????1136

Pro?Asp?Val?Pro?Ala?Ser?Arg?Asp?Tyr?Gln?Gly?Gly?Phe?Ala?Thr?Gly

230?????????????????235?????????????????240

ctg?atg?ctc?aaa?gac?ctg?ggt?ctg?gca?gcc?gat?gcg?gct?gtc?agc?cag?????1184

Leu?Met?Leu?Lys?Asp?Leu?Gly?Leu?Ala?Ala?Asp?Ala?Ala?Val?Ser?Gln

245?????????????????250?????????????????255

aac?agc?gcg?acg?cct?ttg?ggc?gaa?ctg?gca?cgt?aac?ctg?ttc?gcc?ttg?????1232

Asn?Ser?Ala?Thr?Pro?Leu?Gly?Glu?Leu?Ala?Arg?Asn?Leu?Phe?Ala?Leu

260?????????????????265?????????????????270?????????????????275

cac?gcc?gca?caa?ggt?cag?aat?gca?ggg?ctg?gat?ttc?tcc?agc?att?ctt?????1280

His?Ala?Ala?Gln?Gly?Gln?Asn?Ala?Gly?Leu?Asp?Phe?Ser?Ser?Ile?Leu

280?????????????????285?????????????????290

aat?ttg?tac?cgt?cag?aag?cac?taa?gttctggcag?tgcgtagggc?aggggctgca????1334

Asn?Leu?Tyr?Arg?Gln?Lys?His

295

gttccagcgc?ctgtccttgc?tccaattgaa?actggccttg?ttccaggtcc?gcc??????????1387

<210>34

<211>298

<212>PRT

＜213〉Alcaligenes faecalis (Alcaligenes faecalis)

<400>34

Met?Ser?Asn?Thr?Ile?Ala?Phe?Ile?Gly?Leu?Gly?His?Met?Gly?Lys?Pro

1???????????????5???????????????????10??????????????????15

Met?Ala?Leu?Asn?Leu?Leu?Lys?Ala?Gly?His?Ser?Leu?Asn?Val?Phe?Asp

20??????????????????25??????????????????30

Leu?Asn?Ala?Gln?Ala?Met?Gln?Glu?Leu?Gln?Ala?Ala?Gly?Ala?Gln?Val

35??????????????????40??????????????????45

Gly?Glu?Ser?Ala?Val?Gln?Ile?Ala?Gln?Asp?Ala?Gln?Met?Val?Phe?Thr

50??????????????????55??????????????????60

Met?Leu?Pro?Ala?Gly?Arg?His?Val?Arg?Gln?Val?Tyr?Glu?Gly?Glu?Asn

65??????????????????70??????????????????75??????????????????80

Gly?Leu?Leu?Gln?Thr?Val?Ala?Pro?Gly?Thr?Val?Leu?Val?Asp?Cys?Ser

85??????????????????90??????????????????95

Thr?Ile?Asp?Ala?Gln?Thr?Ser?Gln?Asp?Leu?Ala?Ala?Lys?Ala?Ser?Lys

100?????????????????105?????????????????110

Leu?Gly?Leu?Phe?Met?Leu?Asp?Ala?Pro?Val?Ser?Gly?Gly?Thr?Gly?Gly

115?????????????????120?????????????????125

Ala?Ile?Ala?Gly?Thr?Leu?Thr?Phe?Met?Val?Gly?Gly?Glu?Asp?Gln?Ala

130?????????????????135?????????????????140

Leu?Glu?Lys?Ala?Arg?Pro?Tyr?Leu?Asp?Ala?Met?Gly?Lys?Asn?Ile?Phe

145?????????????????150?????????????????155?????????????????160

His?Ala?Gly?Lys?Ala?Gly?Ala?Gly?Gln?Val?Ala?Lys?Ile?Cys?Asn?Asn

165?????????????????170?????????????????175

Met?Leu?Leu?Gly?Ile?Leu?Met?Ala?Gly?Thr?Ala?Glu?Ala?Leu?Ala?Leu

180?????????????????185?????????????????190

Gly?Val?Ala?His?Gly?Leu?Asp?Pro?Ala?Val?Leu?Ser?Thr?Ile?Met?Ala

195?????????????????200?????????????????205

Arg?Ser?Ser?Gly?Arg?Asn?Trp?Ala?Thr?Glu?Leu?Tyr?Asn?Pro?Trp?Pro

210?????????????????215?????????????????220

Gly?Val?Met?Pro?Asp?Val?Pro?Ala?Ser?Arg?Asp?Tyr?Gln?Gly?Gly?Phe

225?????????????????230?????????????????235?????????????????240

Ala?Thr?Gly?Leu?Met?Leu?Lys?Asp?Leu?Gly?Leu?Ala?Ala?Asp?Ala?Ala

245?????????????????250?????????????????255

Val?Ser?Gln?Asn?Ser?Ala?Thr?Pro?Leu?Gly?Glu?Leu?Ala?Arg?Asn?Leu

260?????????????????265?????????????????270

Phe?Ala?Leu?His?Ala?Ala?Gln?Gly?Gln?Asn?Ala?Gly?Leu?Asp?Phe?Ser

275?????????????????280?????????????????285

Ser?Ile?Leu?Asn?Leu?Tyr?Arg?Gln?Lys?His

290?????????????????295

<210>35

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>35

gggaattcca?tatggtaggt?aaaaaggttg?tacatc??????????????????????????????36

<210>36

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>36

cgacggatcc?attcgtccgc?ttgaataact?aaag????????????????????????????????34

<210>37

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>37

cgacggatcc?cgaaaatgtc?accaaaaatt?attgag??????????????????????????????36

<210>38

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>38

agagagcata?tgtcttttca?ccttcggc???????????????????????????????????????28

<210>39

<211>35

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>39

agagagggat?ccgcggctcc?cacaatgttg?aaatg???????????????????????????????35

<210>40

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>40

agagagcata?tgacaaataa?tgaaagcaaa?gg??????????????????????????????????32

<210>41

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>41

gggaattcca?tatgagaaaa?gtagaaatca?ttacagctg???????????????????????????39

<210>42

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>42

acgttgatct?ccttctacat?tattttttca?gtcccatg????????????????????????????38

<210>43

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>43

catgggactg?aaaaaataat?gtagaaggag?atcaacgt????????????????????????????38

<210>44

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>44

cgacggatcc?tcaacgacca?ctgaagttgg?????????????????????????????????????30

<210>45

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>45

ctagtctaga?gctttctaag?aaacgatttc?cg??????????????????????????????????32

<210>46

<211>53

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>46

gggaattcca?tatgcgtaac?ttcctcctgc?tatcattcac?cggggtgctt?tct????????????53

<210>47

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>47

ctagtctaga?ggaaaccgct?taacgaactc??????????????????????????????????????30

<210>48

<211>54

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>48

gggaattcca?tatgcgtaac?ttcctcctgc?tattattgag?ggtgctttgc?atcc???????????54

<210>49

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>49

ccggaattct?ttaatatgcg?atttggagga?g????????????????????????????????????31

<210>50

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>50

gtccgtctcc?ctttcagctt?aaatcgctat?tcttatagc????????????????????????????39

<210>51

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>51

gctataagaa?tagcgattta?agctgaaagg?gagacggac????????????????????????????39

<210>52

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>52

cgacggatcc?gcagtgagtg?agccttggag??????????????????????????????????????30

<210>53

<211>435

<212>DNA

＜213〉clostridium propionicum (Clostridium propionicum)

<220>

<221>CDS

<222>(1)..(435)

<223>

<400>53

atg?gta?ggt?aaa?aag?gtt?gta?cat?cat?tta?atg?atg?agc?gca?aaa?gac???????48

Met?Val?Gly?Lys?Lys?Val?Val?His?His?Leu?Met?Met?Ser?Ala?Lys?Asp

1???????????????5???????????????????10??????????????????15

gct?cac?tat?act?gga?aac?tta?gta?aac?ggc?gct?aga?atc?gtg?aat?cag???????96

Ala?His?Tyr?Thr?Gly?Asn?Leu?Val?Asn?Gly?Ala?Arg?Ile?Val?Asn?Gln

20??????????????????25??????????????????30

tgg?ggc?gac?gta?ggt?aca?gaa?tta?atg?gtt?tat?gtt?gat?ggt?gac?atc??????144

Trp?Gly?Asp?Val?Gly?Thr?Glu?Leu?Met?Val?Tyr?Val?Asp?Gly?Asp?Ile

35??????????????????40??????????????????45

agc?tta?ttc?ttg?ggc?tac?aaa?gat?atc?gaa?ttc?aca?gct?cct?gta?tat??????192

Ser?Leu?Phe?Leu?Gly?Tyr?Lys?Asp?Ile?Glu?Phe?Thr?Ala?Pro?Val?Tyr

50??????????????????55??????????????????60

gtt?ggt?gat?ttt?atg?gaa?tac?cac?ggc?tgg?att?gaa?aaa?gtt?ggc?aac??????240

Val?Gly?Asp?Phe?Met?Glu?Tyr?His?Gly?Trp?Ile?Glu?Lys?Val?Gly?Asn

65??????????????????70??????????????????75??????????????????80

cag?tcc?tat?aca?tgt?aaa?ttt?gaa?gca?tgg?aaa?gta?gca?aag?atg?gtt??????288

Gln?Ser?Tyr?Thr?Cys?Lys?Phe?Glu?Ala?Trp?Lys?Val?Ala?Lys?Met?Val

85??????????????????90??????????????????95

gat?atc?aca?aat?cca?cag?gat?aca?cgt?gca?aca?gct?tgt?gaa?cct?ccg??????336

Asp?Ile?Thr?Asn?Pro?Gln?Asp?Thr?Arg?Ala?Thr?Ala?Cys?Glu?Pro?Pro

100?????????????????105?????????????????110

gta?ctt?tgt?ggt?act?gca?aca?ggc?agc?ctt?ttc?atc?gca?aag?gat?aat??????384

Val?Leu?Cys?Gly?Thr?Ala?Thr?Gly?Ser?Leu?Phe?Ile?Ala?Lys?Asp?Asn

115?????????????????120?????????????????125

cag?aga?ggt?cct?cag?gaa?tct?tcc?ttc?aag?gat?gca?aag?cac?cct?caa??????432

Gln?Arg?Gly?Pro?Gln?Glu?Ser?Ser?Phe?Lys?Asp?Ala?Lys?His?Pro?Gln

130?????????????????135?????????????????140

taa??????????????????????????????????????????????????????????????????435

<210>54

<211>144

<212>PRT

＜213〉clostridium propionicum (Clostridium propionicum)

<400>54

Met?Val?Gly?Lys?Lys?Val?Val?His?His?Leu?Met?Met?Ser?Ala?Lys?Asp

1???????????????5???????????????????10??????????????????15

Ala?His?Tyr?Thr?Gly?Asn?Leu?Val?Asn?Gly?Ala?Arg?Ile?Val?Asn?Gln

20??????????????????25??????????????????30

Trp?Gly?Asp?Val?Gly?Thr?Glu?Leu?Met?Val?Tyr?Val?Asp?Gly?Asp?Ile

35??????????????????40??????????????????45

Ser?Leu?Phe?Leu?Gly?Tyr?Lys?Asp?Ile?Glu?Phe?Thr?Ala?Pro?Val?Tyr

50??????????????????55??????????????????60

Val?Gly?Asp?Phe?Met?Glu?Tyr?His?Gly?Trp?Ile?Glu?Lys?Val?Gly?Asn

65??????????????????70??????????????????75??????????????????80

Gln?Ser?Tyr?Thr?Cys?Lys?Phe?Glu?Ala?Trp?Lys?Val?Ala?Lys?Met?Val

85??????????????????90??????????????????95

Asp?Ile?Thr?Asn?Pro?Gln?Asp?Thr?Arg?Ala?Thr?Ala?Cys?Glu?Pro?Pro

100?????????????????105?????????????????110

Val?Leu?Cys?Gly?Thr?Ala?Thr?Gly?Ser?Leu?Phe?Ile?Ala?Lys?Asp?Asn

115?????????????????120?????????????????125

Gln?Arg?Gly?Pro?Gln?Glu?Ser?Ser?Phe?Lys?Asp?Ala?Lys?His?Pro?Gln

130?????????????????135?????????????????140

<210>55

<211>43

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>55

aaggaaaaaa?gcggccgcag?attaaaggag?gaattctcaa?tgg???????????????????????43

<210>56

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>56

ctagtctaga?tcaacgacca?ctgaagttgg??????????????????????????????????????30

<210>57

<211>40

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>57

aaggaaaaaa?gcggccgctt?taatatgcga?tttggaggag???????????????????????????40

<210>58

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>58

ctagtctaga?gcagtgagtg?agccttggag?????????????????????????????????????30

<210>59

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>59

cacacagaat?tcattaaaga?ggag???????????????????????????????????????????24

<210>60

<211>62

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>60

cataatcaaa?ctcaaagtca?accatataag?atctcctcct?tacttcatga?agaatcccct????60

cc???????????????????????????????????????????????????????????????????62

<210>61

<211>62

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PRC primer

<400>61

ggaggggatt?cttcatgaag?taaggaggag?atcttatatg?gttgactttg?agtttgatta????60

tg???????????????????????????????????????????????????????????????????62

<210>62

<211>51

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>62

cgtgttactc?attttgtctc?ctcgtcattt?acttgaagtc?tgctaagata?c?????????????51

<210>63

<211>51

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>63

gtatcttagc?agacttcaag?taaatgacga?ggagacaaaa?tgagtaacac?g?????????????51

<210>64

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>64

tcattcaccc?gtgaggccat?gaatatatct?ccttcttaag?cttagtgctt?ctgacggtac????60

<210>65

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>65

gtaccgtcag?aagcactaag?cttaagaagg?agatatattc?atggcctcac?gggtgaatga????60

<210>66

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉PCR primer

<400>66

gactagatat?ctcaggagta?ctcatgggtg?aa???????????????????????????????????32

Claims (107)

1. one kind contains L-Ala 2, the active cell of 3-aminomutase, and wherein said cell produces Beta-alanine by α-Bing Ansuan.

2. according to the cell of claim 1, wherein said cell is a cell transformed.

3. according to the cell of claim 2, described cell comprises at least a exogenous nucleic acid molecule, and wherein said nucleic acid molecule comprises coding L-Ala 2, the nucleotide sequence of 3-aminomutase.

4. according to the cell of claim 3, exogenous nucleic acid molecule wherein is the Methionin 2 of sudden change, the 3-aminomutase.

5. according to the cell of claim 3, exogenous nucleic acid molecule wherein is the leucine 2 of sudden change, the 3-aminomutase.

6. according to the cell of claim 3, exogenous nucleic acid molecule wherein is the Methionin 5 of sudden change, the 6-aminomutase.

7. according to the cell of claim 3, the L-Ala 2 of wherein encoding, the nucleotide sequence of 3-aminomutase comprise the Nucleotide 55-1026 shown in Nucleotide 307-1017 shown in the SEQ ID NO:20 or the SEQ ID NO:29.

8. according to the cell of claim 7, the nucleic acid that wherein comprises the Nucleotide 55-1026 of the Nucleotide 307-1017 of SEQ ID NO:20 or SEQ ID NO:29 comprises and produces one or more replacement that one or more conserved amino acid replaces.

9. according to the cell of claim 7, the nucleic acid that wherein comprises the Nucleotide 55-1026 of the Nucleotide 307-1017 of SEQ ID NO:20 or SEQ ID NO:29 comprises and produces one or more replacement that no more than 10 conserved amino acids replace.

10. according to the cell of claim 3, the L-Ala 2 of wherein encoding, the nucleotide sequence of 3-aminomutase comprise the sequence that has at least 90% identity with SEQ ID NO:20 or SEQ ID NO:29.

11. according to the cell of claim 10, the L-Ala 2 of wherein encoding, the nucleotide sequence of 3-aminomutase comprise the sequence that has at least 95% identity with SEQ ID NO:20 or SEQ ID NO:29.

12. according to the cell of claim 10, the L-Ala 2 of wherein encoding, the nucleotide sequence of 3-aminomutase comprise SEQ ID NO:20 or SEQ ID NO:29.

13. according to the cell of claim 4, Tu Bian Methionin 2 wherein, 3-aminomutase are the procaryotic Methionin 2 of sudden change, the 3-aminomutase.

14. cell according to claim 13, Tu Bian procaryotic Methionin 2 wherein, the 3-aminomutase is subtilis (Bacillus subtilis), the abnormal cocci of anti-radiation the (Deinococcus radiodurans), clostridium subterminale (Clostridium subterminale), porphyromonas gingivalis (Porphyromonas gingivalis) or intestinal bacteria (Escherichiacoli) Methionin 2 of sudden change, the 3-aminomutase.

15. according to the cell of claim 14, Tu Bian Methionin 2 wherein, 3-aminomutase are the subtilis Methionin 2 of sudden change, the 3-aminomutase.

16. according to the cell of claim 15, Tu Bian subtilis Methionin 2 wherein, 3-aminomutase comprise L103M, L103K, L103R, L103E or L103S and replace.

17. according to the cell of claim 15, Tu Bian subtilis Methionin 2 wherein, 3-aminomutase comprise that L103M, M136V replace, D339H replaces or it makes up arbitrarily.

18. according to the cell of claim 15, Tu Bian subtilis Methionin 2 wherein, 3-aminomutase comprise D339H, D339Q, D339T or D339N and replace.

19. according to the cell of claim 14, Tu Bian Methionin 2 wherein, 3-aminomutase are the porphyromonas gingivalis Methionin 2 of sudden change, the 3-aminomutase.

20. according to the cell of claim 19, Tu Bian porphyromonas gingivalis Methionin 2 wherein, 3-aminomutase comprise that N19Y replaces, L53P replaces, H85Q replaces, D331G replaces, M342T replaces or it makes up arbitrarily.

21. according to the cell of claim 6, Tu Bian Methionin 5 wherein, 6-aminomutase are Si Shi clostridium (C.sticklandii) Methionin 5 of sudden change, the 6-aminomutase.

22. according to the cell of claim 1, wherein cell is a protokaryon.

23. according to the cell of claim 22, wherein prokaryotic cell prokaryocyte is lactobacillus (Lactobacillus), galactococcus (Lactococcus), genus bacillus (Bacillus) or Escherichia (Escherichia) cell.

24. according to the cell of claim 22, wherein prokaryotic cell prokaryocyte is intestinal bacteria or Bacillus licheniformis (Bacillus licheniformis) cell.

25. according to the cell of claim 1, wherein cell is a yeast cell.

26. according to the cell of claim 1, wherein said cell produces 3-hydroxypropionate (3-HP).

27. according to the cell of claim 26, wherein cell further contains:

CoA transferring enzyme or CoA synthase activity;

β-alanyl-CoA ammonia lyase activity; With

3HP-CoA dehydratase activity.

28. according to the cell of claim 27, wherein cell further comprises 3-hydroxy propionyl group-CoA lytic enzyme, and/or 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities.

29. according to the cell of claim 26, wherein cell further comprises

4-aminobutyric acid and/or Beta-alanine-2-oxoglutarate transamination enzymic activity; With

3-HP dehydrogenase activity or 3-hydroxy-isobutyrate dehydrogenase activity.

30. according to the cell of claim 1, wherein cell further comprises:

CoA transferring enzyme or CoA synthase activity;

β-alanyl-CoA ammonia lyase activity;

3-hydroxy propionyl group-CoA dehydratase activity;

3-hydroxy propionyl group-CoA lytic enzyme, and/or 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities; With

Lipase and/or esterase activity.

31. according to the cell of claim 30, wherein cell produces the ester of 3-HP.

32. according to the cell of claim 31, wherein the ester of 3-HP is 3-hydroxypropionate methyl esters, 3-hydroxypropionate ethyl ester, 3-hydroxypropionate propyl ester, 3-hydroxypropionate butyl ester or 3-hydroxypropionate 2-ethylhexyl.

33. according to the cell of claim 1, wherein said cell further comprises:

The CoA transferase active;

β-alanyl-CoA ammonia lyase activity;

3-hydroxy propionyl group-CoA dehydratase activity; With

Poly-hydroxy acid synthase activity.

34. according to the cell of claim 33, wherein said cell produces polymeric 3-HP.

35. according to the cell of claim 1, wherein said cell further comprises:

The CoA transferase active;

β-alanyl-CoA ammonia lyase activity; With

Poly-hydroxy acid synthase activity.

36. according to the cell of claim 35, wherein said cell produces polymeric vinylformic acid.

37. according to the cell of claim 1, wherein said cell further comprises:

The CoA transferase active;

β-alanyl-CoA ammonia lyase activity; With

Lipase and/or esterase activity.

38. according to the cell of claim 37, the acrylic acid ester of wherein said cells produce.

39. according to the cell of claim 38, wherein acrylic acid ester is methyl acrylate, ethyl propenoate, propyl acrylate or butyl acrylate.

40. according to the cell of claim 1, wherein said cell produces 1, ammediol.

41. according to the cell of claim 40, wherein said cell further comprises:

CoA transferring enzyme or CoA synthase activity;

β-alanyl-CoA ammonia lyase activity;

3-hydroxy propionyl group-CoA dehydratase activity;

Acetylize aldehyde: NAD (+) oxidoreductase activity; With

Alcohol: NAD (+) oxidoreductase activity.

42. according to the cell of claim 40, wherein said cell further comprises:

The CoA transferase active;

β-alanyl-CoA ammonia lyase activity;

3-hydroxy propionyl group-CoA dehydratase activity;

3-hydroxy propionyl group-CoA lytic enzyme, and/or 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities;

Aldehyde dehydrogenase (NAD (P)+) activity; With

The alcoholdehydrogenase activity.

43. according to the cell of claim 1, wherein said cell produces pantothenic acid.

44., further comprise α-ketone pantothenic acid hydroxymethyl transferases, α-ketone pantothenic acid reductase enzyme and pantothenic acid synthase activity according to the cell of claim 43.

45. according to the cell of claim 43, wherein said cell produces coenzyme A (CoA).

46., further comprise Pantothen kinase, 4 '-phosphoric acid hydroxyl pantoyl base-1-cysteine synthase, 4 '-phosphopantothenoylcysteine decarboxylase, ATP:4 '-sweet acyltransferase of phosphopantetheine gland and dephosphorization acidic group-CoA kinase activity according to the cell of claim 45.

47. one kind comprises L-Ala 2, the active polypeptide of 3-aminomutase.

48. according to the polypeptide of claim 47, wherein said polypeptide comprises the Methionin 2 of sudden change, 3-aminomutase aminoacid sequence.

49. polypeptide according to claim 48, Tu Bian Methionin 2 wherein, the aminoacid sequence of 3-aminomutase is subtilis, the abnormal cocci of anti-radiation the, clostridium subterminale, porphyromonas gingivalis or the intestinal bacteria Methionin 2 of sudden change, the 3-aminomutase.

50. according to the polypeptide of claim 49, Tu Bian Methionin 2 wherein, the aminoacid sequence of 3-aminomutase are the subtilis of sudden change or the porphyromonas gingivalis Methionin 2 of sudden change, the 3-aminomutase.

51. according to the polypeptide of claim 47, wherein said polypeptide comprises the amino acid/11 5-390 shown in amino acid 50-390 shown in the SEQ ID NO:21 or the SEQ ID NO:30.

52. according to the polypeptide of claim 47, wherein said polypeptide comprises the sequence that has at least 90% sequence identity with SEQ ID NO:21 or 30.

53. according to the polypeptide of claim 52, wherein said polypeptide comprises the sequence that has at least 95% sequence identity with SEQ ID NO:21 or 30.

54. the polypeptide of claim 52, wherein said polypeptide comprises SEQ ID NO:21 or 30.

55. the polypeptide of claim 52, wherein said polypeptide comprise one or more conservative aminoacid replacement.

56. the polypeptide of claim 52, wherein said polypeptide comprise no more than 10 conserved amino acid and replace.

57. isolating nucleic acid that comprises the nucleotide sequence of coding claim 47 polypeptide.

58. the isolating nucleic acid of claim 57 is operably connected to promoter sequence.

59. according to the isolating nucleic acid of claim 57, wherein said nucleic acid comprises the Nucleotide 307-1017 of SEQ IDNO:20 or the Nucleotide 55-1026 of SEQ ID NO:29.

60. according to the isolating nucleic acid of claim 57, wherein said nucleic acid comprises the sequence that has at least 90% identity with SEQ IDNO:20 or SEQ ID NO:29.

61. according to the isolating nucleic acid of claim 57, wherein said nucleic acid comprises the sequence that has at least 95% identity with SEQ IDNO:20 or SEQ ID NO:29.

62. according to the isolating nucleic acid of claim 60, wherein said nucleotide sequence comprises one or more replacement that causes one or more conservative aminoacid replacement.

63. according to the isolating nucleic acid of claim 60, wherein said nucleotide sequence comprises one or more replacement that causes no more than 10 conserved amino acids to replace.

64. according to the isolating nucleic acid of claim 61, wherein said nucleic acid comprises SEQ IDNO:20 or 29.

65. carrier that comprises claim 57 moral isolating nucleic acid.

66. recombinant nucleic acid that comprises claim 57 moral isolating nucleic acid.

67. recombinant nucleic acid cell transformed with claim 66.

68. non-human transgenic Mammals that comprises claim 57 moral recombinant nucleic acid.

69. comprise the transformant of at least a exogenous nucleic acid molecule, wherein said at least a exogenous nucleic acid molecule comprises the nucleotide sequence of coding claim 47 moral polypeptide.

70. according to the transformant of claim 69, wherein said cell produces Beta-alanine by α-Bing Ansuan.

71. according to the cell of claim 70, wherein said cells produce 3-HP.

72. according to the cell of claim 71, wherein said cell produces 1, ammediol.

73. according to the cell of claim 70, wherein said cell produces pantothenic acid.

74. according to the cell of claim 73, wherein said cell produces CoA.

75. a specific specificity is in conjunction with the specific-binding agent of claim 47 moral polypeptide.

76. a production contains by L-Ala 2, the method for the active polypeptide of 3-aminomutase is included in and cell is produced contain L-Ala 2, to cultivate the cell of claim 67 under the condition of the active polypeptide of 3-aminomutase.

77. one kind prepares the method for Beta-alanine by α-Bing Ansuan, is included in to make cell be produced the cell of cultivating claim 1 under the condition of Beta-alanine by α-Bing Ansuan.

78. according to the method for claim 77, wherein said cell comprises at least a coding L-Ala 2, the exogenous nucleic acid molecule of 3-aminomutase, and wherein said L-Ala 2, the 3-aminomutase can produce Beta-alanine by α-Bing Ansuan.

79. according to the method for claim 78, wherein said cell is a prokaryotic cell prokaryocyte.

80. according to the method for claim 78, wherein said cell is yeast, lactobacillus, galactococcus, genus bacillus or Escherichia cell.

81. according to the method for claim 78, wherein said cell comprises the functional deficiency of panD.

82. an evaluation contains L-Ala 2, the method for the active cell of 3-aminomutase comprises:

In the substratum that does not contain Beta-alanine and pantothenic acid, cultivate the cell of functional deficiency panD; With

The cell that evaluation can be grown in substratum, wherein the growth table clear-cells of cell produces Beta-alanine by α-Bing Ansuan, this shows that cell comprises L-Ala 2,3-aminomutase activity, and the growth that wherein lacks cell shows that then cell does not produce Beta-alanine by α-Bing Ansuan, this shows that cell does not comprise L-Ala 2,3-aminomutase activity.

83. 2 method according to Claim 8 further is included in before the step of culturing cell the Methionin 2 with one or more sudden changes, 3-aminomutase transfectional cell.

84. 3 method according to Claim 8, the procaryotic Methionin 2 of one or more sudden changes wherein, the 3-aminomutase is subtilis, the abnormal cocci of anti-radiation the, clostridium subterminale, thermophilic production fluid bacterium (Aquifex aeolicus), Haemophilus influenzae (Haemophilusinfluenza), intestinal bacteria and/or the porphyromonas gingivalis Methionin 2 of sudden change, the 3-aminomutase.

85. 3 method according to Claim 8, the Methionin 2 of wherein one or more sudden changes, 3-aminomutase are the subtilis Methionin 2 of sudden change, the 3-aminomutase.

86. 3 method according to Claim 8 further is included in after the cell that evaluation grows in substratum, identifies that one or more give cell L-Ala 2, the active sudden change Methionin 2 of 3-aminomutase, the sudden change in the 3-aminomutase.

87. 6 method according to Claim 8, to one or more sudden change Methionin 2, the Methionin 2 that comprises one or more sudden changes is identified in the sudden change in the 3-aminomutase, and the 3-aminomutase checks order.

88. 2 method according to Claim 8, wherein cell is a prokaryotic cell prokaryocyte.

89. a method for preparing 3-HP is included in cell and produces the cell of cultivating claim 1 under the condition of 3-HP.

90. 9 method according to Claim 8, wherein cell comprises at least a coding L-Ala 2, and the exogenous nucleic acid of 3-aminomutase is so that 3-HP produces from Beta-alanine, and wherein L-Ala 2, and the 3-aminomutase produces Beta-alanine by α-Bing Ansuan.

91. 9 method according to Claim 8, wherein cell further comprises:

CoA transferring enzyme or CoA synthase activity;

β-alanyl-CoA ammonia lyase activity;

3-HP-CoA dehydratase activity; With,

3-hydroxy propionyl group-CoA lytic enzyme, and/or 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities.

92. 9 method according to Claim 8, wherein cell further comprises:

4-aminobutyric acid and/or Beta-alanine-2-oxoglutarate transamination enzymic activity; With

3-HP dehydrogenase activity and/or 3-hydroxybutyrate dehydrogenase activity.

93. one kind prepares 1, the method for ammediol is included in wherein cell generation 1, cultivates the cell of claim 40 under the condition of ammediol.

94. a method for preparing pantothenic acid is included in cell wherein and produces the cell of cultivating claim 43 under the condition of pantothenic acid.

95. a method for preparing CoA is included in cell wherein and produces the cell of cultivating claim 45 under the condition of CoA.

96. a method for preparing 3-HP comprises:

Accessory Right requires 1 cell purification Beta-alanine;

Beta-alanine is contacted with the polypeptide that comprises the CoA transferase active to form β-alanyl-CoA;

With β-alanyl-CoA with comprise the active polypeptide of beta-Alanyl-CoA ammonia-lyase and contact to form acryl-CoA;

With acryl-CoA with comprise the active polypeptide of 3HP-CoA dehydratase and contact to form 3-HP-CoA; With

With 3-HP-CoA with comprise CoA transferase active, 3-hydroxy propionyl group-CoA lytic enzyme, and/or the polypeptide of 3-hydroxy-isobutyryl-CoA hydrolytic enzyme activities contact is to produce 3-HP.

97. a method for preparing 3-HP comprises:

Accessory Right requires 1 cell purification Beta-alanine;

With Beta-alanine with comprise 4-Aminobutyrate aminotransferase and/or Beta-alanine-active polypeptide of 2-oxoglutarate transaminase and contact to form malonic semialdehyde; With

With malonic semialdehyde with comprise 3-HP desaturase and/or the active polypeptide of 3-hydroxy-isobutyrate dehydrogenase and contact to produce 3-HP.

98. a method for preparing 3-HP comprises:

The nucleic acid that comprises the polypeptide of CoA transferase active with coding, comprise the nucleic acid of β-alanyl-active polypeptide of CoA ammonia lyase with coding, and coding comprises CoA transferase active, 3-hydroxy propionyl group-CoA lytic enzyme, and/or the cell of the nucleic acid transfection claim 1 of the polypeptide of 3-hydroxyl isobutyryl-CoA hydrolytic enzyme activities; With

Cultivate cells transfected so that transfectional cell produces 3-HP.

99. a method for preparing 3-HP comprises:

Comprise the nucleic acid of 4-Aminobutyrate aminotransferase and/or Beta-alanine-active polypeptide of 2-oxoglutarate transaminase and the cell that coding comprises the nucleic acid transfection claim 1 of 3-HP desaturase and/or the active polypeptide of 3-Hydroxyisobutyrate dehydrogenase with coding; With

Cultivate cells transfected so that described cells transfected produces 3-HP.

100. one kind by 3-HP preparation 1, the method for ammediol comprises:

Method with claim 97 prepares 3-HP;

With 3-HP and the polypeptide that comprises acetylize aldehyde: NAD (+) oxidoreductase activity with comprise alcohol: the polypeptide of NAD (+) oxidoreductase activity contacts.

101. one kind prepares 1, the method for ammediol comprises:

The nucleic acid that comprises the polypeptide of CoA transferring enzyme or CoA synthase activity with coding; Coding comprises the nucleic acid of the active polypeptide of beta-Alanyl-CoA ammonia-lyase; Coding comprises 3-hydroxyl propionyl-CoA lytic enzyme, and/or the nucleic acid of the polypeptide of 3-hydroxyl isobutyryl-CoA hydrolytic enzyme activities; Coding comprises the nucleic acid of the polypeptide of acetylize aldehyde: NAD (+) oxidoreductase activity; Comprise alcohol with coding: the cell of the nucleic acid transfection claim 1 of the polypeptide of NAD (+) oxidoreductase activity; And

Cultivate transfectional cell so that described transfectional cell produces 1, ammediol.

102. one kind prepares 1, the method for ammediol comprises:

The nucleic acid that comprises the polypeptide of CoA transferring enzyme or CoA synthase activity with coding; Coding comprises the nucleic acid of the active polypeptide of beta-Alanyl-CoA ammonia-lyase; Coding comprises the nucleic acid of the active polypeptide of 3-hydroxyl propionyl-CoA dehydratase; Coding comprises 3-hydroxyl propionyl-CoA lytic enzyme, and/or the nucleic acid of the polypeptide of 3-hydroxyl isobutyryl-CoA hydrolytic enzyme activities; Coding comprises the nucleic acid of the active polypeptide of aldehyde dehydrogenase (NAD (P)+); Coding comprises the cell of the nucleic acid transfection claim 1 of the active polypeptide of alcoholdehydrogenase; And

Cultivate cells transfected so that described transfectional cell produces 1, ammediol.

103. a method for preparing pantothenic acid comprises:

Cell purification Beta-alanine by claim 1; With

Beta-alanine and α-ketone pantothenic acid hydroxymethyl transferases, α-ketone pantothenic acid reductase enzyme are contacted with the pantothenic acid synthase with preparation pantothenic acid.

104. prepare the method for pantothenic acid, comprising:

Comprise the nucleic acid of α-active polypeptide of ketone pantothenic acid hydroxymethyl transferases with coding, coding comprises the cell of the nucleic acid transfection claim 1 of the nucleic acid of polypeptide of α-ketone pantothenic acid reductase activity and the polypeptide that coding comprises the pantothenic acid synthase activity; With

Cultivate transfectional cell so that transfectional cell produces pantothenic acid.

105. according to the cell of claim 1, wherein said cell is a vegetable cell.

106. contain the plant of the cell of claim 104.

106. transgenic plant that comprise the recombinant nucleic acid of claim 57.

Images