CN110862444A - Maize bm1 gene mutant and molecular marker and application thereof - Google Patents

Abstract

The invention provides a maize bm1 gene mutant and a molecular marker and application of the gene, belonging to the technical field of genetic engineering. The invention discovers that the natural mutant Rb243 of corn brown midrib has the lignin content of the midrib which is obviously lower than that of the normal corn B73. Sequence analysis found that the bm1 gene in Rb243 has 2101bp insertion mutation in the first exon compared with B73. Mutant allelic testing confirmed that mutation of the bm1 gene resulted in the brown midrib phenotype of Rb 243. The invention develops a PCR functional molecular marker based on bm1 gene mutation sites in Rb243, utilizes the functional molecular marker to carry out molecular auxiliary selection, has great effect in genetic improvement breeding of corn germplasm resources, and can ensure that the improved corn obtains brown midrib traits.

Description

Maize bm1 gene mutant and molecular marker and application thereof

Technical Field

The invention belongs to the field of plant molecular biology, and particularly relates to a maize bm1 gene mutant, a molecular marker of the gene and application of the gene.

Background

The silage corn is a corn which is obtained by harvesting overground green plants including fruit clusters at the early stage of corn wax ripening and using a microbial anaerobic fermentation method to prepare silage for herbivorous livestock to eat. With the development of agricultural structure adjustment, the proportion of herbivorous livestock is greatly improved, and the planting area of silage corns is also rapidly increased. However, the high and low digestibility of cellulose in the stalks and leaves has a great influence on the nutritional value of the silage corn. Researches find that the silage corn contains brown midrib genes, so that the cellulose component in corn tissues is changed, the lignin content is reduced, the cellulose digestibility is improved, and the nutritional value of the silage feed is obviously improved.

Brown midrib maize is typically characterized by the onset of brown pigmentation in the maize midrib at the growth stage of V4 to V6. So far, 6 brown natural leaf vein mutants are discovered, the brown natural leaf vein character control genes are bm1, bm2, bm3, bm4, bm5 and bm6, all belong to recessive monogenic inheritance, and have the function of reducing the lignin content. In 1931, the bm1 mutant was first discovered by Jorgenson; in 1972, in vivo digestibility analysis of brown midrib bm1 gene mutant maize by Lechtenberg et al found that maize lignin content was reduced by 9.1% and feed digestibility was increased by 1.3% in bm1 mutant plants compared to wild type (Lechtenberg et al, 1972, Agronomy Journal 64: 657-. Halpin maps the bm1 gene on chromosome 5 and was found to encode a cinnamyl alcohol dehydrogenase, with a significant decrease in cinnamyl alcohol dehydrogenase activity in the bm1 mutant maize (Halpin et al, 1998, the Plant Journal, 14 (5): 545. sup. 553).

In conclusion, brown midrib maize has great utility, but it does not appear brown pigmentation until V4 to V6. The bm1 gene has great influence on the nutritive value of silage corn feed, and the development of the bm1 functional molecular marker can quickly identify the brown leaf vein character of the corn at early stage, and has important significance on the early identification of the brown leaf vein corn and the improvement of the brown leaf vein character of the corn by using the molecular marker-assisted selection.

Disclosure of Invention

The invention aims to provide a maize bm1 gene mutant, a molecular marker of the gene and application of the gene.

The technical scheme of the invention is mainly as follows: in the corn planting process, a corn brown vein natural mutant Rb243 with a vein lignin content remarkably lower than that of normal corn B73 is found. Leaf vein samples are collected from F2 obtained by selfing after Rb243 and B73 hybridization, a brown leaf vein pool and a normal leaf vein pool are constructed, BSR-seq analysis is carried out on the two mixed pools, the brown leaf vein control gene is positioned in a chromosome 5 chromosome 56,390,000-190,790,000bp interval, and reported bm1 genes (GRMZM5G844562, 99,030,278-99,034,633bp) for controlling the brown leaf vein character of corn are found to be positioned in the interval, and the expression level of the bm1 gene is obviously different between Rb243 and B73. Sequence analysis found that the bm1 gene in Rb243 has 2101bp insertion mutation in the first exon compared with B73. Mutant allelic testing confirmed that mutation of the bm1 gene resulted in the brown midrib phenotype of Rb 243. Based on the mutation site of bm1 gene in Rb243, PCR functional molecular marker PCR-Zmbm1 is developed, the amplified fragment of the marker in the Rb243 mutant is 588bp, the amplified fragment in normal maize B73 is 254bp, and the amplified fragment in the Rb243 xB 73 hybrid is 254bp and 588 bp. The functional molecular marker is used for auxiliary selection, and the excellent corn hybrid species Jingke 968 is improved, so that the brown leaf vein character is obtained.

The invention firstly provides a maize bm1 gene mutant Rb243, which is a gene fragment with insertion mutation of a 2101bp fragment from the 133 th base of SEQ ID NO.1 on the first exon of a maize bm1 gene coding region, wherein the nucleotide sequence of the 2101bp fragment is shown as SEQ ID NO. 2.

Specifically, the nucleotide sequence of the maize bm1 gene mutant Rb243 is shown as SEQ ID No. 3.

The biological material containing the corn bm1 gene mutant Rb243 belongs to the protection scope of the invention, and the biological material is an expression cassette, an expression vector, engineering bacteria or host cells.

The invention provides a molecular marker for detecting a maize bm1 gene, which can be obtained by PCR amplification of the following primer combination, wherein the nucleotide sequence of the primer combination is as follows:

the upstream primer F1: GAATCGAATGGGGAGCCTGG the flow of the air in the air conditioner,

the upstream primer F1: TCGGCTTCTCAAACTTGTGCT the flow of the air in the air conditioner,

a downstream primer R: AGAACTACTGGAGGAGGCGC are provided.

The invention provides a primer combination containing a primer sequence shown in SEQ ID NO. 4-6.

The invention further provides the application of the maize bm1 gene mutant Rb243, or biological materials containing the mutant gene, or the molecular marker, or the primer combination in maize molecular assisted selective breeding or improved seed production.

The invention further provides application of the corn bm1 gene mutant Rb243, or biological materials containing the mutant gene, or the molecular marker, or the primer combination in screening or preparing corn with brown midrib traits.

The invention further provides an application of the corn bm1 gene mutant Rb243, or a biological material containing the mutant gene, or the molecular marker, or the primer combination in detecting the brown midrib phenotype or genotype of the corn, wherein the application comprises the following steps:

the molecular marker or the primer combination is used for carrying out PCR amplification on a corn genome to be detected, if an amplification product electrophoresis detection only has a 588bp band, the result shows that the corn to be detected carries bm1 mutant genes, is an Rb243 mutant homozygous genotype and has a brown vein phenotype;

if the electrophoresis detection of the amplification product only has a 254bp band, the result shows that the corn to be detected carries bm1 wild gene, is a homozygous genotype and does not have a brown vein phenotype;

if the electrophoresis detection result of the amplification product has two bands of 254bp and 588bp, the fact that the corn to be detected carries bm1 wild gene and Rb243 mutant is heterozygous genotype and does not have brown vein phenotype is shown.

The invention also provides a method for detecting the corn bm1 gene mutant Rb243, which comprises the step of carrying out PCR amplification on the corn to be detected by using the molecular marker or the primer combination, wherein the corn to be detected contains the corn bm1 gene mutant Rb243 if an amplification product electrophoresis detection only has a 588bp band.

The invention also provides a method for detecting the maize bm1 gene, the molecular marker or the primer combination is used for carrying out PCR amplification on the maize to be detected, if the electrophoresis detection of the amplification product has 254bp or 254bp and 588bp bands, the maize to be detected contains maize bm1 wild gene.

The maize bm1 gene mutant Rb243 provided by the invention has the following advantages:

(1) the invention provides a new maize recessive brown midrib mutant, which lays a material foundation for developing a new brown midrib maize seed production method.

(2) The mutant only affects the brown leaf vein character of the corn, but has no effect on other agronomic characters of the corn.

(3) The mutant is an intragenic mutation and does not affect the functions of adjacent genes on both sides of bm 1.

(4) Compared with wild type, the insertion of 2101bp bases is caused by natural mutation, and the molecular detection can be carried out by adopting agarose electrophoresis commonly used in laboratories, namely the identification can be realized without special detection technology and method.

(5) The maize bm1 gene mutant Rb243 can be directly used for hybrid maize identification and breeding and maize germplasm resource improvement, and has great economic value.

Drawings

FIG. 1 is a photograph of a comparison of brown midrib mutant Rb243 (left) with normal maize B73 (right) phenotype.

Fig. 2 is a graphical representation of H, G, S comparison of the content of three lignin types in leaf vein Cell Wall Residue (CWR): vein cell wall residue, H, G, S lignin type contents from left to right in the figure.

FIG. 3 is a graph showing the result of localization of the brown midrib gene BSR-seq.

FIG. 4 results of DNA amplification of the first exon of the bm1 gene in maize mutant Rb243 and normal maize B73. The PCR product was detected by electrophoresis on a 1% agarose gel. And M is DL5000 DNA marker.

FIG. 5 results of amplification of the full-length cDNA of bm1 gene in maize mutant Rb243 and normal maize B73. The PCR product was detected by electrophoresis on a 1% agarose gel. And M is DL5000 DNA marker.

Fig. 6 shows photographs of leaf phenotype of mutant Rb243 (right), bm1 mutant (left) and two hybrids (middle), with the scale being 10 cm.

FIG. 7 shows the results of genotyping and detecting the maize mutants Rb243, normal maize B73 and hybrid species Rb243 XB 73 by the functional molecular marker PCR-Zmbm1, and the PCR products are detected by 2% agarose gel electrophoresis. R × B: rb243 × B73. And R is Rb 243. B, B73. The DNA marker is a 100bp DNA ladder marker.

FIG. 8 shows the results of genotyping detection of normal maize inbred lines Jing 724, C92, Chang 7-2 and MC01 by functional molecular marker PCR-Zmbm 1. The PCR product was detected by electrophoresis on a 2% agarose gel. 1, 2, 3 and 4 respectively represent inbred lines of maize, namely Jing 724, C92, Chang 7-2 and MC 01. M100 bp DNA ladder (DNA ladder same as FIG. 7).

Fig. 9 is a representation of the improved kyoto 968 leaf profile with brown vein-like character using molecular marker assisted breeding, showing that the improved kyoto 968 (left) scale of kyoto 968 (right) is 4 cm.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

The corn germplasm resources used in the embodiment of the invention are from a corn germplasm resource library of the corn research center of the agriculture and forestry academy of sciences of Beijing.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1 identification of maize Brown midrib mutant Gene

1. Maize brown midrib mutant gene BSR-seq localization

During the corn planting process, the inventor finds a corn brown vein natural mutant Rb243 (figure 1), wherein the contents of H, G, S three lignin types in vein Cell Wall Residues (CWR) are respectively 2.54 +/-0.12, 43.21 +/-1.84 and 45.50 +/-1.30 mu mol/g and are significantly lower than that of normal corn B73 (the contents of H, G, S lignin types are respectively 4.37 +/-0.02, 82.49 +/-1.41 and 142.42 +/-3.39 mu mol/g) (figure 2). After the corn brown vein mutant Rb243 is hybridized with the normal corn B73, the F1 hybrid is a normal vein, and 152 brown vein individuals and 439 normal vein individuals in 591F 2 individuals meet the conditions that 1: 3 separation (X)² _1:30.16 and P0.69), indicating that the maize brown midrib trait is controlled by a recessive single gene.

The method for measuring the lignin monomer comprises the following steps: after grinding corn leaf vein into powder in liquid nitrogen, extraction was carried out successively with chloroform/methanol (2:1v/v), methanol and water at room temperature, and after freeze-drying of the remaining cell wall residue, the total lignin content was determined by the AcBr method (Hatfield et al, 1999, Journal of Agricultural and Food Chemistry 47: 628-.

2. Gene screening for brown leaf pulse candidate

The brown nervus leaf vein mutant Rb243 is hybridized with normal corn B73 and then selfed, the obtained F2 plant grows to the V6 stage, 30 veins of brown nervus leaf vein plants and veins of normal nervus leaf vein plants are respectively taken from the plant, a pool of brown nervus leaf veins and normal nervus leaf veins is constructed, and BSR-seq analysis is carried out on the two mixed pools. BSR-seq was performed according to standard experimental procedures of the company Data2 Bio. The results of the analysis located the brown leaf midvein control gene within the 56,390,000-190,790,000bp interval on chromosome 5 (FIG. 3).

The MaizeGDB database (https:// www.maizegdb.org/; B73 RefGen _ v3) was searched and 37 differentially expressed genes were found in this region, including the reported bm1 gene (GRMZM5G844562, 99,030,278-99,034,633bp) that controls the brown midrib trait in maize. The expression level of bm1 gene in B73 veins was 3.68 times higher than that of mutant Rb243 veins (FDR ═ 2.07E-121).

The bm1 gene was amplified by PCR using DNA of Rb243 and B73 as templates, and the PCR amplification program was as follows using 141F/q287R (table 1): pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 2min, and 34 cycles; the extension was carried out at 72 ℃ for 10min, and the amplified fragment size was 3406bp in Rb243 and 1305bp in B73 (FIG. 4). Sequence alignment analysis shows that mutant Rb243 has insertion mutation of 2101bp (SEQ ID NO.2) in the first exon of bm1 gene compared with B73, and CENSOR software (https:// www.girinst.org/CENSOR/index. php) analysis shows that the insertion sequence belongs to hAT transposon.

In the brown vein mutant Rb243 and normal vein B73 materials, the full length bm1 gene was amplified by PCR using cDNA as a template. The amplification primers are shown as cDNA amplification primers in Table 1, and the amplification procedure is as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 2min, and 34 cycles; extension at 72 ℃ for 10 min. In mutant Rb243, the amplified fragment size was 2700bp (cDNA sequence shown in SEQ ID NO. 12) and 1228bp (cDNA sequence of bm1 gene shown in SEQ ID NO. 11) in normal vein B73 (FIG. 5), indicating that insertion mutation of the first exon of bm1 gene results in alteration of the bm1 gene transcript information in maize mutant Rb 243.

TABLE 1 primer information List

In combination with the expression level difference and sequence difference of the bm1 gene in the mutant Rb243 and normal corn material and the functional annotation thereof, the bm1 gene is considered to be a brown midrib trait control gene in the corn mutant Rb 243. The bm1 gene in Rb243 has 2101bp insertion mutation in the first exon, and this mutation site has not been reported before, and is a new allelic variation of the bm1 gene.

3. Gene function verification of brown leaf pulse candidate

Allelic assays were performed using known bm1 maize mutants with brown leaf midrib (Halpin et al, 1998, the plant journal, 14 (5): 545. sup. 553) hybridized to Rb 243. The veins of bm1 maize mutant hybridized with Rb 243F 1 had a brown vein phenotype (fig. 6), which further confirms that bm1 is the brown vein trait control gene for Rb 243.

Example 2 corn Brown midrib mutant bm1 mutant Gene functional molecular marker development

Based on the sequence difference of the brown midrib mutant Rb243 and the normal corn B73 in the first exon of the bm1 gene, the invention develops a PCR functional molecular marker PCR-Zmbm1 for detecting the mutant. The functional molecular marker PCR-Zmbm1 shows the functional marker primers in Table 1, and the PCR amplification procedure is as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 20s, annealing at 60 ℃ for 20s, and extension at 72 ℃ for 20s, for 34 cycles; extension at 72 ℃ for 10 min. The primer 141F, -193F and 394R are used for amplifying the bm1 gene, the amplification product is detected by agarose electrophoresis, the size of the amplification fragment in the brown midrib mutant Rb243 is 588bp, the size of the amplification fragment in the normal maize B73 is 254bp, and the size of the amplification fragment in the hybrid Rb243 xB 73 is 254bp and 588bp (figure 7). The molecular marker developed by the invention is adopted to carry out PCR detection on the normal maize inbred lines Jing 724, C92, Chang 7-2 and MC01, and the detection result shows that the fragment sizes of the amplified products are all 254bp (figure 8). Since maize is a diploid crop, hybrids of the mutant and ordinary maize carry the bm1 mutant gene, but do not exhibit the brown vein phenotype, since the gene mutation is a recessive mutation; the marker can screen out plants carrying the mutation, and pure and recessive mutant materials can be separated after the plants are selfed, and the plants have brown vein phenotypes. Rb243 xb 73 has no brown vein phenotype, but carries the bm1 mutant gene. The molecular marker developed by the invention can be used for identifying the brown midrib mutant Rb243 and other corn varieties without brown midrib phenotype.

Example 3 application of functional molecular marker PCR-Zmbm1 in molecular marker assisted breeding kyoto 968 is a maize hybrid widely popularized in china, the female parent of which is kyoto 724 and the male parent of which is C92, and none of these materials has brown leaf vein phenotype. PCR-Zmbm1 functional molecular marker-assisted selection is used for improving the vein traits of Jing 724 and C92, and further obtaining improved Jingke 968 with a brown vein phenotype (figure 9).

The specific implementation method comprises the following steps: the brown midrib maize mutant Rb243 is used as a non-recurrent parent, and Jing 724 and C92 are used as recurrent parents. Rb243 is respectively hybridized with Jing 724 and C92, then is respectively backcrossed with Jing 724 and C92 for 5 times, and finally is selfed once, namely BC5F2, and single plants with brown leaf vein phenotype are selected from BC5F2 generations, wherein the corn single plants are improved Jing 724 and C92 with brown leaf vein property, not only carry bm1 mutant genes in mutant Rb243, but also have genetic background consistent with recurrent parent. In the backcross process, from the BC1 generation, the functional molecular marker PCR-Zmbm1 developed by the invention is used for detecting individual plants of BC1, BC2, BC3, BC4 and BC5 generation, the individual plant which can simultaneously amplify fragments of 254bp and 588bp, namely the individual plant carrying the maize brown vein midrib mutant bm1 mutant gene is reserved, and the reserved individual plant is used for the next round of backcross.

Since maize is a diploid crop, hybrids of the mutant and ordinary maize carry the bm1 mutant gene, but do not exhibit the brown vein phenotype, since the gene mutation is a recessive mutation; the marker can screen out plants carrying the mutation, and pure and recessive mutant materials can be separated after the plants are selfed, and the plants have brown vein phenotypes. The BC1, BC2, BC3, BC4 and BC5 individuals did not have a brown vein phenotype, but carried the bm1 mutant gene. Therefore, in molecular marker-assisted breeding, individuals carrying the maize brown midrib mutant bm1 mutant gene can be screened by using the molecular marker of the invention, and the remained individuals are used for the next round of backcross.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

<120> corn bm1 gene mutant and molecular marker and application of gene

<130>KHP191117294.5

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>4001

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gccacccgct ccgtcgtcgt cgtccccgcc gcgccgatcc cgaatcgaat ggggagcctg 60

gcgtccgaga ggaaggtggt cgggtgggcc gccagggacg ccaccggaca cctctccccc 120

tactcctaca ccctcaggta ctacgccgcg ccggcgccct cgtgtttgtc ctctcctcca 180

gtccctcccg tctgtatatg tccgactgtc tccgcccttt tgcaaacacg caaatggatg 240

gatccaggag gacgagagac ggttagtttc tgcacgcgcc tcctccagta gttctccgag 300

ttctcgggaa gaacagaaaa tttgattgat gttttttttg atgaaaaata aaaagggact 360

tggggcatat tttcgatcaa cttgcaacgg aagatgacta ggagtacgta cgtagcgtag 420

cggcggcggg ttttaatttg ggggagcact ctgttagtct gttgcatata tgggagtacc 480

tgattcgttg cagttattat tatctatacg cgtacgatat gttttagggg gtgtttggtt 540

gctcctgcta aagtttagtc cgggtcacat caagcgtttt acttttaaat aggagtatga 600

aatatagacc caaccaacta gactagattc gtctcgtctt ttaatcttcg gctgacaaat 660

tagttttata atccgactac atttaatacc cggaacagag gttcaaacat tcgatgggac 720

agagactaaa ttttagcagg gtgtaaccaa acaccccctt agtccacaac aagagcatta 780

tgcgctgtgt tgcatcatgc atatatgata cgtcttcaac ttcttgcggt ccaactctag 840

atagtgcaca tgcatatgcc aaatacggat actggacaag atagcacaca agcagagcag 900

gttgggcgag cgtacactgc acgtatgctt ctcttctaca tggcattttg tttcgaacat 960

taatatatgg gtactgctcc tgcacagcac tgcacgtgct tgacgtctcg tacagaccca 1020

gcagcgtgtg aacttgtagg taagatacgt aactactgat atctgcagct acctaccgcc 1080

tgtcgcgatc accatccatt tgtactcgca gtaataatac cgattaccct tttattatta 1140

tttctcatgc catcgacgac tactagcact atccaacgta caactgtggc gcgattcata 1200

tatgcataat tctacatggt gctagtcttc ggcaagaaaa aaaaactaac acttgtctct 1260

ttttcatatg ggatgtgttg tggtggtgac aacaggaaca caggccctga agatgtggtg 1320

gtgaaggtgc tctactgcgg gatctgccac acggacatcc accaggccaa gaaccacctc 1380

ggggcttcaa agtatcctat ggtccctggg tgagcacaaa cggttaacac acacacgcac 1440

ccagcgattt ttcaggaccc ttggggatcc agtatatata tatatgctcc gtgtacggtc 1500

cagaatatac gtactgaatt tccaagtgtc ctattattca atttgtctca aaactataaa 1560

ggatatatat agtgacatgc agtttcagcg ttttcatgag aaaattacac atgcagacaa 1620

attcaggtat aattatttga ttcatgacga ccagcatata gattggtaga tagagtgcac 1680

atttgtcaac cacaaacgtt agcatcccag tccggagcta tcccctgggt tacaggtggc 1740

aaatacacac caaccacaat aataagctaa tactcttacg tctgtagttg gttgccaatt 1800

actgatcaga ttacttgaat cacaagagct tgttgtgtct aatttgtaca ggctatttat 1860

atcatgatag ctaaagagct gctgaaatga gtagcaagga aacctcaccg gccgtcctat 1920

acttttctct gacatgacga caggacaacc actccaccac cgtgaactga tacaataaca 1980

ataaagtcct ttagtcccag taaattagaa taggctagaa actaaaatcc aacagagaga 2040

cgaaatcatg gctttggttt gataataact gatacttttg caggcacgag gtggtcggcg 2100

aggtggtgga ggtcgggccc gaggtggcca agtacggcgt cggcgacgtg gtaggcgtcg 2160

gggtgatcgt tgggtgctgc cgcgagtgca gcccctgcaa ggccaacgtt gagcagtact 2220

gcaacaagaa gatctggtca tacaacgacg tctacactga tggacggccc acgcagggtg 2280

gattcgcctc caccatggtc gtcgaccaga agtgagttct tgagactgaa aactaatctt 2340

ttcactggtt taattatttt cagcgttatc ttgcatgcag tgttgtagag ataataatct 2400

ctttttttat taaaaaaatg tttggtctga aaaaagctag aaatatatag ttgaacttca 2460

attatatttc aacttttgcg agaagtggac gagataaggt ccaatccttc tagaaaaggt 2520

gcaggaaagt atatatatat atatatatat atatatatat atatatatat atatatatat 2580

atatatatat atatatatat atatatatat atggggataa aatatgatcg agaaagtcca 2640

tcatcatcta gctgcaagtc gttgtatgga tgtcttatgg tgaccaggca agagtgttga 2700

tgtggaaagt acggtatgat ttggtgtgct ttacttgctt gactttgtga ggttgaacca 2760

ccaccacaga agccgaatcc tcacctactc ttgattgaag attggccacc caaaccatca 2820

ccggttgttg ggagaaatga ggataacttt ctccatcgtt cgctccaaaa cctgtctaca 2880

ctttagtgta ctgtcttttt cagtcagtgc gcaaaccaca ccacctacct ccaacaacat 2940

tttgagatag cgatttcttt tttctttttt taaaggcact ccgtgtgtga attatgatag 3000

aacagtaact tttcaagcaa ttttctttgc tgccagtcaa ttttggaaga aaaaaaaagg 3060

caacctcggt aacacgaatt taggttccta ttttgttctt ggtaaaaaaa aactaaatac 3120

ctagttccac gtaagttgat agttaatgca ttttgtttca ggtttgtggt gaagatcccg 3180

gcgggtctgg ctccggagca agcggcgccg ctgctgtgcg ctggcgtgac ggtgtacagc 3240

ccgctgaagc actttgggct gacgaccccg ggcctccgtg gcggcatcct gggcctcggc 3300

ggcgtgggcc acatgggcgt gaaggtagcc aaggccatgg gccaccacgt gacggtgatc 3360

agctcgtcgt ccaagaagcg cgcggaggca atggaccacc tcggcgcgga cgcgtaccta 3420

gtgagctcgg acgccgcggc catggcggcg gccgccgact cgctggacta catcatcgac 3480

acggtgcccg tgcaccaccc gctggagccg tacctggcgc tgctgaagct ggacggcaag 3540

ctcgtgctgc tgggcgtcat cggcgagccc ctgagcttcg tgtcgcccat ggtgatgctg 3600

gggcggaagg ccatcacggg gagcttcatc ggcagcatcg acgagaccgc tgaggtgctt 3660

cagttctgcg tcgacaaggg actcacctcc cagatcgagg tggtcaagat ggggtacgtg 3720

aacgaggcgc tggagcggct ggagcgcaac gacgtccgct accgcttcgt cgtcgacgtc 3780

gccggtagca acgtcgaggc ggaggcggcg gcggcggatg cggccagcaa ctgatggcac 3840

cgcgtcgtcg agtcgaacca cgtctgtgcg ccgcgtgcaa cgttcgttcg ggtcgagtct 3900

gcgtgcaacg ttctgcttcc tttactagtt gttgtctttc cgccttcttg ccgttctgtt 3960

ctgggctttg agatgagacg atggatggtc agtttttaat g 4001

<210>2

<211>2101

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

caggggcgat tctatgtgga gtcatcggtg tcggctgaca ccaacgattt tggcaaaatc 60

acttataccc catgtttttt caccatggtt gaccccaata aaaaaatgca ttgaccccgg 120

cggctggtgc taatcactct atagactata gttaatcagc ccagcagata gcaagcgcga 180

gcgccgagcg ccgagcggcc cagcttgccc agttgattag tccttgcgtg tcttgcgata 240

gcccacagcc cagcagtagt ccaccaacga agcgtcgatc tgtcttcatt tctgacggct 300

cgcggacggc gcggcgccac caccaaagcg tcgatccatc ttctcgtttc tcagggctcg 360

cggacggcgc agcacagttt tatcttcctt tcctcgccct cgccaggccg gcaccggtag 420

gctgcaaggt atcgcgccgc cgcgttggac ctcctccaag tctccaactc acgttatgcc 480

aggttagaca aagattttga tttttgactc acgtttgcat ctcatgctta tatcatatat 540

cctttagtat tttaattttg ttcaatgttc acgaatttga tagggaacca aagtttgatg 600

gaacggtttt tgaaaagaaa attgcctcca gctagtgact ctaatgatcc tggtgccgat 660

ggagagacat caagaagggg agcaaatgca tcaaacacta accttgaccg tacagcgagt 720

catcgtcctt tgcgagtttc acgaaaccag gtaaactttg atgagcttcc ttacgatcca 780

gcagatagaa gaagcatatc tgattacata ggacaaaagc tccaagatga aattagaaag 840

aagtatttga tcagaggtcc ttttagacca cctgttggct ttaaatatcc acagaagatc 900

atagcaggtc atgcacgttg gtcgtctcat tttaaaaccc ttcagaggtt aagcagtttg 960

ttccctgatg taattgaagt tctccaatac gttgaaaaag aaggtccaaa tgatgccaag 1020

agacgccaag cacgtggtct catggactat ttgatggatt ttgactttgt gtttcacttg 1080

cagttaatgt tgcttatttt gggccatgca aatgctttgt cattgtcatt acaaaggaaa 1140

gataaagaca ttttagaggc catggtagag gtgaagttaa caaagcagag atttcagcaa 1200

attagggatg atggttggga ttctctatta gaggatgtgt tatccttttg tgaaaaacat 1260

ggtattccga agttggacat ggatcatgag tacattaatc gccacaagcc taggcaaaga 1320

accaaccgaa ctaactatca acactataga tatgattgct tgaaccctgt tattgactta 1380

cagcttatag agttcaatga tcgtttcaat gaggtgaatt ctgaattgct tacccacatg 1440

gctgctttta gtcccaataa ttcttttggt gcctttaaac atgagagttt gatggaattg 1500

gctaaggcat accctgatga tttcagccca gtggaactag atgatctcag tagtgaactt 1560

cattgttaca ttgataatgt gagagctgat gcaagatttg ctcaattggg tactatttct 1620

gagcacggta aactaatggt ggatacaaaa aaacatcttg ctttttcatt ggtctatcgg 1680

cttctcaaac ttgtgctagt tctccctatt gcaactgcat cagtagagag atcattttca 1740

gcaatgaaaa ttgtgaagac ggtcctacga aaccggatcg gtgatgactt tatgaatgat 1800

tgtgtcatta gcttcatgga acaagaactt cttgatacaa tttcaaataa tgatgtgata 1860

gttcgattcc agaagatgga tggacacaat cgtagagtga aattataaaa ggtacacttg 1920

taaaagctta ttttatcatg ttatgttttt gctaattttg tctttttatt atacgtgtta 1980

aattttatca ttatattatc aatattcgtt atgtcaccct attatgcata gggtttgata 2040

attatgagtc gtaagtccga ccccggtgga gatttatcct agattcgccc ctgcctacac 2100

c 2101

<210>3

<211>6102

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gccacccgct ccgtcgtcgt cgtccccgcc gcgccgatcc cgaatcgaat ggggagcctg 60

gcgtccgaga ggaaggtggt cgggtgggcc gccagggacg ccaccggaca cctctccccc 120

tactcctaca cccaggggcg attctatgtg gagtcatcgg tgtcggctga caccaacgat 180

tttggcaaaa tcacttatac cccatgtttt ttcaccatgg ttgaccccaa taaaaaaatg 240

cattgacccc ggcggctggt gctaatcact ctatagacta tagttaatca gcccagcaga 300

tagcaagcgc gagcgccgag cgccgagcgg cccagcttgc ccagttgatt agtccttgcg 360

tgtcttgcga tagcccacag cccagcagta gtccaccaac gaagcgtcga tctgtcttca 420

tttctgacgg ctcgcggacg gcgcggcgcc accaccaaag cgtcgatcca tcttctcgtt 480

tctcagggct cgcggacggc gcagcacagt tttatcttcc tttcctcgcc ctcgccaggc 540

cggcaccggt aggctgcaag gtatcgcgcc gccgcgttgg acctcctcca agtctccaac 600

tcacgttatg ccaggttaga caaagatttt gatttttgac tcacgtttgc atctcatgct 660

tatatcatat atcctttagt attttaattt tgttcaatgt tcacgaattt gatagggaac 720

caaagtttga tggaacggtt tttgaaaaga aaattgcctc cagctagtga ctctaatgat 780

cctggtgccg atggagagac atcaagaagg ggagcaaatg catcaaacac taaccttgac 840

cgtacagcga gtcatcgtcc tttgcgagtt tcacgaaacc aggtaaactt tgatgagctt 900

ccttacgatc cagcagatag aagaagcata tctgattaca taggacaaaa gctccaagat 960

gaaattagaa agaagtattt gatcagaggt ccttttagac cacctgttgg ctttaaatat 1020

ccacagaaga tcatagcagg tcatgcacgt tggtcgtctc attttaaaac ccttcagagg 1080

ttaagcagtt tgttccctga tgtaattgaa gttctccaat acgttgaaaa agaaggtcca 1140

aatgatgcca agagacgcca agcacgtggt ctcatggact atttgatgga ttttgacttt 1200

gtgtttcact tgcagttaat gttgcttatt ttgggccatg caaatgcttt gtcattgtca 1260

ttacaaagga aagataaaga cattttagag gccatggtag aggtgaagtt aacaaagcag 1320

agatttcagc aaattaggga tgatggttgg gattctctat tagaggatgt gttatccttt 1380

tgtgaaaaac atggtattcc gaagttggac atggatcatg agtacattaa tcgccacaag 1440

cctaggcaaa gaaccaaccg aactaactat caacactata gatatgattg cttgaaccct 1500

gttattgact tacagcttat agagttcaat gatcgtttca atgaggtgaa ttctgaattg 1560

cttacccaca tggctgcttt tagtcccaat aattcttttg gtgcctttaa acatgagagt 1620

ttgatggaat tggctaaggc ataccctgat gatttcagcc cagtggaact agatgatctc 1680

agtagtgaac ttcattgtta cattgataat gtgagagctg atgcaagatt tgctcaattg 1740

ggtactattt ctgagcacgg taaactaatg gtggatacaa aaaaacatct tgctttttca 1800

ttggtctatc ggcttctcaa acttgtgcta gttctcccta ttgcaactgc atcagtagag 1860

agatcatttt cagcaatgaa aattgtgaag acggtcctac gaaaccggat cggtgatgac 1920

tttatgaatg attgtgtcat tagcttcatg gaacaagaac ttcttgatac aatttcaaat 1980

aatgatgtga tagttcgatt ccagaagatg gatggacaca atcgtagagt gaaattataa 2040

aaggtacact tgtaaaagct tattttatca tgttatgttt ttgctaattt tgtcttttta 2100

ttatacgtgt taaattttat cattatatta tcaatattcg ttatgtcacc ctattatgca 2160

tagggtttga taattatgag tcgtaagtcc gaccccggtg gagatttatc ctagattcgc 2220

ccctgcctac accctcaggt actacgccgc gccggcgccc tcgtgtttgt cctctcctcc 2280

agtccctccc gtctgtatat gtccgactgt ctccgccctt ttgcaaacac gcaaatggat 2340

ggatccagga ggacgagaga cggttagttt ctgcacgcgc ctcctccagt agttctccga 2400

gttctcggga agaacagaaa atttgattga tgtttttttt gatgaaaaat aaaaagggac 2460

ttggggcata ttttcgatca acttgcaacg gaagatgact aggagtacgt acgtagcgta 2520

gcggcggcgg gttttaattt gggggagcac tctgttagtc tgttgcatat atgggagtac 2580

ctgattcgtt gcagttatta ttatctatac gcgtacgata tgttttaggg ggtgtttggt 2640

tgctcctgct aaagtttagt ccgggtcaca tcaagcgttt tacttttaaa taggagtatg 2700

aaatatagac ccaaccaact agactagatt cgtctcgtct tttaatcttc ggctgacaaa 2760

ttagttttat aatccgacta catttaatac ccggaacaga ggttcaaaca ttcgatggga 2820

cagagactaa attttagcag ggtgtaacca aacaccccct tagtccacaa caagagcatt 2880

atgcgctgtg ttgcatcatg catatatgat acgtcttcaa cttcttgcgg tccaactcta 2940

gatagtgcac atgcatatgc caaatacgga tactggacaa gatagcacac aagcagagca 3000

ggttgggcga gcgtacactg cacgtatgct tctcttctac atggcatttt gtttcgaaca 3060

ttaatatatg ggtactgctc ctgcacagca ctgcacgtgc ttgacgtctc gtacagaccc 3120

agcagcgtgt gaacttgtag gtaagatacg taactactga tatctgcagc tacctaccgc 3180

ctgtcgcgat caccatccat ttgtactcgc agtaataata ccgattaccc ttttattatt 3240

atttctcatg ccatcgacga ctactagcac tatccaacgt acaactgtgg cgcgattcat 3300

atatgcataa ttctacatgg tgctagtctt cggcaagaaa aaaaaactaa cacttgtctc 3360

tttttcatat gggatgtgtt gtggtggtga caacaggaac acaggccctg aagatgtggt 3420

ggtgaaggtg ctctactgcg ggatctgcca cacggacatc caccaggcca agaaccacct 3480

cggggcttca aagtatccta tggtccctgg gtgagcacaa acggttaaca cacacacgca 3540

cccagcgatt tttcaggacc cttggggatc cagtatatat atatatgctc cgtgtacggt 3600

ccagaatata cgtactgaat ttccaagtgt cctattattc aatttgtctc aaaactataa 3660

aggatatata tagtgacatg cagtttcagc gttttcatga gaaaattaca catgcagaca 3720

aattcaggta taattatttg attcatgacg accagcatat agattggtag atagagtgca 3780

catttgtcaa ccacaaacgt tagcatccca gtccggagct atcccctggg ttacaggtgg 3840

caaatacaca ccaaccacaa taataagcta atactcttac gtctgtagtt ggttgccaat 3900

tactgatcag attacttgaa tcacaagagc ttgttgtgtc taatttgtac aggctattta 3960

tatcatgata gctaaagagc tgctgaaatg agtagcaagg aaacctcacc ggccgtccta 4020

tacttttctc tgacatgacg acaggacaac cactccacca ccgtgaactg atacaataac 4080

aataaagtcc tttagtccca gtaaattaga ataggctaga aactaaaatc caacagagag 4140

acgaaatcat ggctttggtt tgataataac tgatactttt gcaggcacga ggtggtcggc 4200

gaggtggtgg aggtcgggcc cgaggtggcc aagtacggcg tcggcgacgt ggtaggcgtc 4260

ggggtgatcg ttgggtgctg ccgcgagtgc agcccctgca aggccaacgt tgagcagtac 4320

tgcaacaaga agatctggtc atacaacgac gtctacactg atggacggcc cacgcagggt 4380

ggattcgcct ccaccatggt cgtcgaccag aagtgagttc ttgagactga aaactaatct 4440

tttcactggt ttaattattt tcagcgttat cttgcatgca gtgttgtaga gataataatc 4500

tcttttttta ttaaaaaaat gtttggtctg aaaaaagcta gaaatatata gttgaacttc 4560

aattatattt caacttttgc gagaagtgga cgagataagg tccaatcctt ctagaaaagg 4620

tgcaggaaag tatatatata tatatatata tatatatata tatatatata tatatatata 4680

tatatatata tatatatata tatatatata tatggggata aaatatgatc gagaaagtcc 4740

atcatcatct agctgcaagt cgttgtatgg atgtcttatg gtgaccaggc aagagtgttg 4800

atgtggaaag tacggtatga tttggtgtgc tttacttgct tgactttgtg aggttgaacc 4860

accaccacag aagccgaatc ctcacctact cttgattgaa gattggccac ccaaaccatc 4920

accggttgtt gggagaaatg aggataactt tctccatcgt tcgctccaaa acctgtctac 4980

actttagtgt actgtctttt tcagtcagtg cgcaaaccac accacctacc tccaacaaca 5040

ttttgagata gcgatttctt ttttcttttt ttaaaggcac tccgtgtgtg aattatgata 5100

gaacagtaac ttttcaagca attttctttg ctgccagtca attttggaag aaaaaaaaag 5160

gcaacctcgg taacacgaat ttaggttcct attttgttct tggtaaaaaa aaactaaata 5220

cctagttcca cgtaagttga tagttaatgc attttgtttc aggtttgtgg tgaagatccc 5280

ggcgggtctg gctccggagc aagcggcgcc gctgctgtgc gctggcgtga cggtgtacag 5340

cccgctgaag cactttgggc tgacgacccc gggcctccgt ggcggcatcc tgggcctcgg 5400

cggcgtgggc cacatgggcg tgaaggtagc caaggccatg ggccaccacg tgacggtgat 5460

cagctcgtcg tccaagaagc gcgcggaggc aatggaccac ctcggcgcgg acgcgtacct 5520

agtgagctcg gacgccgcgg ccatggcggc ggccgccgac tcgctggact acatcatcga 5580

cacggtgccc gtgcaccacc cgctggagcc gtacctggcg ctgctgaagc tggacggcaa 5640

gctcgtgctg ctgggcgtca tcggcgagcc cctgagcttc gtgtcgccca tggtgatgct 5700

ggggcggaag gccatcacgg ggagcttcat cggcagcatc gacgagaccg ctgaggtgct 5760

tcagttctgc gtcgacaagg gactcacctc ccagatcgag gtggtcaaga tggggtacgt 5820

gaacgaggcg ctggagcggc tggagcgcaa cgacgtccgc taccgcttcg tcgtcgacgt 5880

cgccggtagc aacgtcgagg cggaggcggc ggcggcggat gcggccagca actgatggca 5940

ccgcgtcgtc gagtcgaacc acgtctgtgc gccgcgtgca acgttcgttc gggtcgagtc 6000

tgcgtgcaac gttctgcttc ctttactagt tgttgtcttt ccgccttctt gccgttctgt 6060

tctgggcttt gagatgagac gatggatggt cagtttttaa tg 6102

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gaatcgaatg gggagcctgg 20

<210>5

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

tcggcttctc aaacttgtgc t 21

<210>6

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

agaactactg gaggaggcgc 20

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gaatcgaatg gggagcctgg 20

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gcaagaaggc ggaaagacaa 20

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gaatcgaatg gggagcctgg 20

<210>10

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

cagatcccgc agtagagcac 20

<210>11

<211>1228

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gaatcgaatg gggagcctgg cgtccgagag gaaggtggtc gggtgggccg ccagggacgc 60

caccggacac ctctccccct actcctacac cctcaggaac acaggccctg aagatgtggt 120

ggtgaaggtg ctctactgcg ggatctgcca cacggacatc caccaggcca agaaccacct 180

cggggcttca aagtatccta tggtccctgg gcacgaggtg gtcggcgagg tggtggaggt 240

cgggcccgag gtggccaagt acggcgtcgg cgacgtggta ggcgtcgggg tgatcgttgg 300

gtgctgccgc gagtgcagcc cctgcaaggc caacgttgag cagtactgca acaagaagat 360

ctggtcatac aacgacgtct acactgatgg acggcccacg cagggtggat tcgcctccac 420

catggtcgtc gaccagaagt ttgtggtgaa gatcccggcg ggtctggctc cggagcaagc 480

ggcgccgctg ctgtgcgctg gcgtgacggt gtacagcccg ctgaagcact ttgggctgac 540

gaccccgggc ctccgtggcg gcatcctggg cctcggcggc gtgggccaca tgggcgtgaa 600

ggtagccaag gccatgggcc accacgtgac ggtgatcagc tcgtcgtcca agaagcgcgc 660

ggaggcaatg gaccacctcg gcgcggacgc gtacctagtg agctcggacg ccgcggccat 720

ggcggcggcc gccgactcgc tggactacat catcgacacg gtgcccgtgc accacccgct 780

ggagccgtac ctggcgctgc tgaagctgga cggcaagctc gtgctgctgg gcgtcatcgg 840

cgagcccctg agcttcgtgt cgcccatggt gatgctgggg cggaaggcca tcacggggag 900

cttcatcggc agcatcgacg agaccgctga ggtgcttcag ttctgcgtcg acaagggact 960

cacctcccag atcgaggtgg tcaagatggg gtacgtgaac gaggcgctgg agcggctgga 1020

gcgcaacgac gtccgctacc gcttcgtcgt cgacgtcgcc ggtagcaacg tcgaggcgga 1080

ggcggcggcg gcggatgcgg ccagcaactg atggcaccgc gtcgtcgagt cgaaccacgt 1140

ctgtgcgccg cgtgcaacgt tcgttcgggt cgagtctgcg tgcaacgttc tgcttccttt 1200

actagttgtt gtctttccgc cttcttgc 1228

<210>12

<211>2700

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gaatcgaatg gggagcctgg cgtccgagag gaaggtggtc gggtgggccg ccagggacgc 60

caccggacac ctctccccct actcctacac ccaggggcga ttctatgtgg agtcatcggt 120

gtcggctgac accaacgatt ttggcaaaat cacttatacc ccatgttttt tcaccatggt 180

tgaccccaat aaaaaaatgc attgaccccg gcggctggtg ctaatcactc tatagactat 240

agttaatcag cccagcagat agcaagcgcg agcgccgagc gccgagcggc ccagcttgcc 300

cagttgatta gtccttgcgt gtcttgcgat agcccacagc ccagcagtag tccaccaacg 360

aagcgtcgat ctgtcttcat ttctgacggc tcgcggacgg cgcggcgcca ccaccaaagc 420

gtcgatccat cttctcgttt ctcagggctc gcggacggcg cagcacagtt ttatcttcct 480

ttcctcgccc tcgccaggcc ggcaccggta ggctgcaagg tatcgcgccg ccgcgttgga 540

cctcctccaa gtctccaact cacgttatgc cagggaacca aagtttgatg gaacggtttt 600

tgaaaagaaa attgcctcca gctagtgact ctaatgatcc tggtgccgat ggagagacat 660

caagaagggg agcaaatgca tcaaacacta accttgaccg tacagcgagt catcgtcctt 720

tgcgagtttc acgaaaccag ttaatgttgc ttattttggg ccatgcaaat gctttgtcat 780

tgtcattaca aaggaaagat aaagacattt tagaggccat ggtagaggtg aagttaacaa 840

agcagagatt tcagcaaatt agggatgatg gttgggattc tctattagag gatgtgttat 900

ccttttgtga aaaacatggt attccgaagt tggacatgga tcatgagtac attaatcgcc 960

acaagcctag gcaaagaacc aaccgaacta actatcaaca ctatagatat gattgcttga 1020

accctgttat tgacttacag cttatagagt tcaatgatcg tttcaatgag gtgaattctg 1080

aattgcttac ccacatggct gcttttagtc ccaataattc ttttggtgcc tttaaacatg 1140

agagtttgat ggaattggct aaggcatacc ctgatgattt cagcccagtg gaactagatg 1200

atctcagtag tgaacttcat tgttacattg ataatgtgag agctgatgca agatttgctc 1260

aattgggtac tatttctgag cacggtaaac taatggtgga tacaaaaaaa catcttgctt 1320

tttcattggt ctatcggctt ctcaaacttg tgctagttct ccctattgca actgcatcag 1380

tagagagatc attttcagca atgaaaattg tgaagacggt cctacgaaac cggatcggtg 1440

atgactttat gaatgattgt gtcattagct tcatggaaca agaacttctt gatacaattt 1500

caaataatga tgtgatagtt cgattccaga agatggatgg acacaatcgt agagtgaaat 1560

tataaaagga acacaggccc tgaagatgtg gtggtgaagg tgctctactg cgggatctgc 1620

cacacggaca tccaccaggc caagaaccac ctcggggctt caaagtatcc tatggtccct 1680

gggcacgagg tggtcggcga ggtggtggag gtcgggcccg aggtggccaa gtacggcgtc 1740

ggcgacgtgg taggcgtcgg ggtgatcgtt gggtgctgcc gcgagtgcag cccctgcaag 1800

gccaacgttg agcagtactg caacaagaag atctggtcat acaacgacgt ctacactgat 1860

ggacggccca cgcagggtgg attcgcctcc accatggtcg tcgaccagaa gtttgtggtg 1920

aagatcccgg cgggtctggc tccggagcaa gcggcgccgc tgctgtgcgc tggcgtgacg 1980

gtgtacagcc cgctgaagca ctttgggctg acgaccccgg gcctccgtgg cggcatcctg 2040

ggcctcggcg gcgtgggcca catgggcgtg aaggtagcca aggccatggg ccaccacgtg 2100

acggtgatca gctcgtcgtc caagaagcgc gcggaggcaa tggaccacct cggcgcggac 2160

gcgtacctag tgagctcgga cgccgcggcc atggcggcgg ccgccgactc gctggactac 2220

atcatcgaca cggtgcccgt gcaccacccg ctggagccgt acctggcgct gctgaagctg 2280

gacggcaagc tcgtgctgct gggcgtcatc ggcgagcccc tgagcttcgt gtcgcccatg 2340

gtgatgctgg ggcggaaggc catcacgggg agcttcatcg gcagcatcga cgagaccgct 2400

gaggtgcttc agttctgcgt cgacaaggga ctcacctccc agatcgaggt ggtcaagatg 2460

gggtacgtga acgaggcgct ggagcggctg gagcgcaacg acgtccgcta ccgcttcgtc 2520

gtcgacgtcg ccggtagcaa cgtcgaggcg gaggcggcgg cggcggatgc ggccagcaac 2580

tgatggcacc gcgtcgtcga gtcgaaccac gtctgtgcgc cgcgtgcaac gttcgttcgg 2640

gtcgagtctg cgtgcaacgt tctgcttcct ttactagttg ttgtctttcc gccttcttgc 2700

Claims (10)

1. A maize bm1 gene mutant Rb243 is a gene with insertion mutation of 2101bp fragments starting from the 133 th base of SEQ ID NO.1 on the first exon of a maize bm1 gene coding region, and the nucleotide sequence of the 2101bp fragments is shown as SEQ ID NO. 2.

2. The maize bm1 gene mutant Rb243 of claim 1, having a nucleotide sequence shown in SEQ ID No. 3.

3. Biological material containing the maize bm1 gene mutant Rb243 of claim 1 or 2, which is an expression cassette, an expression vector, an engineered bacterium or a host cell.

4. The molecular marker for detecting the maize bm1 gene is characterized in that the molecular marker can be obtained by PCR amplification of the following primer combination, and the nucleotide sequence of the primer combination is as follows:

the upstream primer F1: GAATCGAATGGGGAGCCTGG the flow of the air in the air conditioner,

the upstream primer F1: TCGGCTTCTCAAACTTGTGCT the flow of the air in the air conditioner,

a downstream primer R: AGAACTACTGGAGGAGGCGC are provided.

5. A primer combination is characterized by comprising a primer sequence shown as SEQ ID NO. 4-6.

6. Use of the maize bm1 gene mutant Rb243 of claim 1 or 2, or the biological material of claim 3, or the molecular marker of claim 4, or the primer combination of claim 5 in maize molecular assisted selective breeding or improved seed production.

7. Use of the maize bm1 gene mutant Rb243 of claim 1 or 2, or the biological material of claim 3, or the molecular marker of claim 4, or the primer combination of claim 5 in screening or preparing maize with a brown midrib trait.

8. Use of the maize bm1 gene mutant Rb243 of claim 1 or 2, or the biological material of claim 3, or the molecular marker of claim 4, or the primer combination of claim 5, for detecting maize brown midrib phenotype or genotype, said use comprising:

carrying out PCR amplification on a corn genome to be detected by using the molecular marker of claim 4 or the primer combination of claim 5, wherein if an amplification product electrophoresis detection shows that only a 588bp band exists, the corn to be detected carries a bm1 mutant gene, is an Rb243 mutant homozygous genotype and has a brown vein phenotype;

if the electrophoresis detection of the amplification product only has a 254bp band, the result shows that the corn to be detected carries bm1 wild gene, is a wild homozygous genotype and does not have a brown vein phenotype;

if the electrophoresis detection result of the amplification product has two bands of 254bp and 588bp, the fact that the corn to be detected carries bm1 gene and Rb243 mutant is a heterozygous genotype and does not have a brown vein phenotype is shown.

9. The method for detecting the maize bm1 gene mutant Rb243 is characterized in that the molecular marker of claim 4 or the primer combination of claim 5 is used for carrying out PCR amplification on maize to be detected, and if the electrophoresis detection of an amplification product only has a 588bp band, the maize to be detected contains the maize bm1 gene mutant Rb 243.

10. A method for detecting a maize bm1 gene is characterized in that the molecular marker of claim 4 or the primer combination of claim 5 is used for carrying out PCR amplification on a maize to be detected, and if the electrophoresis detection of an amplification product shows that 254bp or 254bp and 588bp bands exist, the maize to be detected contains a maize bm1 wild gene.

Images