CN113801958A

CN113801958A - InDel marker related to cabbage brilliant green character gene CER2 mutation, primer and application

Info

Publication number: CN113801958A
Application number: CN202111232690.XA
Authority: CN
Inventors: 王荣花
Original assignee: Shandong Academy of Agricultural Sciences
Current assignee: Shandong Academy of Agricultural Sciences
Priority date: 2021-10-22
Filing date: 2021-10-22
Publication date: 2021-12-17

Abstract

The invention relates to an InDel mark, a primer and application related to a cabbage brilliant green character gene CER2, wherein a cabbage crop is a common vegetable crop, and the cabbage with brilliant green stems plays an important role in Chinese vegetable supply. The brilliant green character is caused by the deletion of epidermal wax powder, and CER2 is a key functional gene for the formation of epidermal wax. The invention analyzes the genome sequences of Chinese cabbage inbred line '06-247' and 'He 102' CER2, discovers that a plurality of variations exist between the two, develops an InDel marker related to CER2 mutation, detects a derivative group of '06-247' and 'He 102' by utilizing the marker, and defines the genotype of each strain line in the group at the site. The development of the marker is beneficial to efficiently screening the descendants with the brilliant green character, is applied to the auxiliary breeding work of the brilliant green cabbage platform germplasm marker, and has good effect.

Description

InDel marker related to cabbage brilliant green character gene CER2 mutation, primer and application

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to an InDel marker related to a cabbage light green character gene CER2 mutation, a primer sequence for detecting the molecular marker and application of the molecular marker in crop breeding.

Background

Chinese cabbage (Brassica rapa L. ssp. Pekinensis) belongs to Brassica vegetable crops in cruciferae and plays an important role in the production and supply of vegetables in China. The brilliant green character is an epidermal wax-deficient mutant and is caused by the lack of wax in the epidermis of tissues such as stems, leaves and the like. Wax powder is an important commodity property for leaf vegetable crops such as Chinese cabbage, particularly for the flower stalk variety of Chinese cabbage, and for example, flower stalk Chinese cabbage without wax powder and with brilliant green flower stem is preferred in the market.

At present, the research on physiological, biochemical and molecular regulation mechanisms of wax powder formation in plants such as arabidopsis thaliana and the like has made a certain progress. The plant epidermal wax powder is synthesized in epidermal cells, and the process mainly comprises the following steps: the fatty acid is synthesized into C16 and C18 fatty acid in plastid from head, then transported to endoplasmic reticulum to extend into C20-C36 ultra-long chain fatty acid, and further synthesized into different wax powder components through alcohol synthesis path and alkane synthesis path. Genes such as CER1, CER2, CER3, MAH1, KCR1, RST1, WSD1, KCS and CYTB5 are involved in different pathways of Arabidopsis wax powder biosynthesis (ZHao & Kunst, 2016; Ni et al, 2018). After wax powder is synthesized, the wax powder is secreted to the stratum corneum through a series of transporters via cell membranes and cell walls, and the genes such as ACBP1, ABCG11, ABCG12, LTPG1, LTPG2 and GNL1 are mainly involved (Kim, 2012; Xue et al, 2014). In addition, genes like WIN1/SHINE1, SHINE2, SHINE3, MYB30, MYB94, MYB96, DEWAX, WAR6/RDR6, HUB1 regulate wax powder synthesis at the transcriptional, post-transcriptional or translational level (Lee et al, 2016; Park et al, 2016).

The brassica crop wax powder-free brilliant green character genetic law is complex, the difference between different groups is large, and the brassica crop wax powder-free brilliant green character genetic law is controlled by different genes. In the research, Chinese cabbage inbred lines '06-247' (no wax powder material) and 'He 102' (no wax powder material) are used as parents to construct a Recombinant Inbred Line (RILs) group related to wax powder change. The parents of the recombinant inbred line group are wax powder-free materials, the segregation ratio of F2 generation wax powder-free/wax powder single plants is 9/7, the character of the wax powder of the group is controlled to be two pairs of dominant genes, and additive effect analysis shows that the two genes are respectively from different parents. Through the re-sequencing of parents and the simplified genome sequencing of 150 RILs, a large number of InDels markers are developed, a high-density genetic linkage map (Liu et al, 2019) is constructed, and 2 genes with large effect values are identified in total. One of the genes is the same as BrWAX1 located by Zhang et al (2013), namely Bra013809 which is a homologous gene of Arabidopsis wax powder synthesis gene CER 2. The research carries out clone sequencing on wax powder synthetic gene CER2 in parents, finds that the sequences of the wax powder synthetic gene CER2 and the parents have more differences, develops an InDel marker in the gene, and the application of the marker can accelerate the breeding efficiency of new varieties of the brilliant green Chinese cabbage.

Disclosure of Invention

In order to solve the problems in the background art, the invention aims to provide an InDel marker related to the CER2 mutation of a cabbage light green trait gene, a primer and application.

In order to achieve the purpose, the invention provides the following technical scheme:

the invention provides an InDel marker related to a cabbage brilliant green trait gene CER2 mutation, wherein the InDel marker is shown as SEQID NO. 3 and SEQID NO. 4.

The invention provides a detection primer of an InDel marker related to a cabbage brilliant green trait gene CER2 mutation, which comprises the following steps:

a forward primer: CATAGGATTGAACAAATCCAGAAAC, respectively;

reverse primer: CTGATTCTTGATGAACACTGACAAT are provided.

Further, the primers are used for PCR amplification.

In a third aspect of the invention, the InDel marker related to the CER2 mutation of the cabbage light green trait gene in the first aspect and/or the InDel marker related to the CER2 mutation of the cabbage light green trait gene in the second aspect are applied to crop breeding.

Further, the application comprises the step of screening dominant homozygous parent materials of the Chinese cabbage by the detection primer or the molecular marker.

Further, the application comprises the application of the detection primer in preparing a detection kit.

Further, the application comprises the step of carrying out new variety breeding on other brassica crops by using the CER2 mutant with the brilliant green character as a donor material.

Furthermore, the new variety breeding comprises the step of screening dominant brilliant green CER2 mutant Chinese cabbage as a parent material to be hybridized with other brassica crops.

The fourth aspect of the invention provides a breeding method of a dominant brilliant green CER2 mutant variety of Chinese cabbage, which comprises the steps of detecting the genotype of a brilliant green CER2 mutant by using the amplification primer of the second aspect, and screening to obtain a dominant homozygous individual as a parent for breeding.

The beneficial effects of one or more of the above technical solutions are as follows:

(1) the dominant brilliant green mutant CER2 can be used as a donor material with brilliant green character, is used for modifying the flower stem epidermis of other non-brilliant green materials, has particularly important application in breeding of cabbage heart, flowering Chinese cabbage and Chinese cabbage moss, and has obvious economic significance.

(2) The marker is used for detecting different strains in the recombinant inbred line population, the genotypes of the strains at the site are determined, and the expression condition of the functional gene is detected through corresponding molecular markers. The InDel marker can be used for marker-assisted selection of selfed progeny of a population, and greatly accelerates the breeding efficiency of a new variety of the brilliant green Chinese cabbage.

Drawings

FIG. 1 is a schematic diagram showing that ` He102 ` in comparison with ` 06-247 ` in example 1 of the present invention has a deletion mutation in an intron region of CER2 of the gene;

FIG. 2 is a diagram of developed electrophoretic bands of InDel labeling in example 1 of the present invention;

wherein M is a 50bp ladder DNA molecular weight standard; p1: '06-247' amplification product; p2: 'He 102' amplification product.

FIG. 3 is an electrophoresis strip chart of the detection of a partial population of the Chinese cabbage recombinant inbred line by using an InDel marker in example 1 of the present invention;

wherein, 1-60 is a partial single plant of a recombinant inbred line, and M is a 50bp ladder DNA molecular weight standard; p1: '06-247' amplification product; p2: 'He 102' amplification product.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

1. Obtaining of mutant strains

The Chinese cabbage inbred lines '06-247' (no wax powder material) and 'He 102' (no wax powder material) are breeding materials of a Chinese cabbage subject group of the Shandong agricultural academy of sciences, and field character investigation is carried out in the core experiment base (Jinan) of the Shandong agricultural academy of sciences for many years.

2. DNA extraction

Extracting with TPS reagent, and grinding with automatic grinding machine. TPS reagent formula: 100mmol/L Tris-HCl, 1mol/LKCl, 10mmol/LEDTA, pH 8.0, autoclaved. Cut 2-3 cm²Placing the young leaves in a 2mL centrifuge tube, adding 800 mu L TPS reagent, adding 2-3 sterilized steel balls (diameter 5mm), placing on an automatic grinding instrument at 5000r/min, shaking for 10s, keeping the temperature in a thermostat at 65 ℃ for 30-60 min, cooling, and centrifuging at 12000r/min for 10min at 4 ℃; the supernatant was transferred to a new centrifuge tube, an equal volume of chloroform was added and mixed by inversion to remove foreign proteins, and then the procedure was the same as CTAB method for DNA extraction. The DNA pellet was dissolved in 100. mu.L of 10mmol/L Tris-HCl (pH 8.0) and stored at-20 ℃ until use.

3. Primer design

Comparing insertion/deletion variation of parent 'He 102' compared to '06-247' at the CER2 segment of gene according to the results of parental sequencing, as shown in figure 1: 'He 102' has 1 deletion mutation of 27bp in the intron region of CER2 of the gene compared with '06-247';

designing primers in conserved regions at two sides of the differential site by using Primer Premier 5.0 software; the forward and reverse primer sequences are shown as SEQ ID NO. 1 and SEQ ID NO. 2:

the detection primers are as follows:

SEQ ID NO:1：CATAGGATTGAACAAATCCAGAAAC

SEQ ID NO:2：CTGATTCTTGATGAACACTGACAAT。

4. PCR amplification and detection

The PCR amplification adopts 2 XTaq PCR Green Mix (PER007-1/PER007-2) of Changsheng biotechnology limited of Beijing Ding.

Preparing a PCR reaction system: 2 XPCR mix 10. mu.l, 10pmol/L forward and reverse primers 1. mu.l each, 20-50. mu.g/L template DNA 1. mu.l, ddH₂O7. mu.l in a total volume of 20. mu.l.

The PCR conditions were 94 ℃ for 5min, 94 ℃ for 20sec, 59 ℃ for 20sec, 72 ℃ for 10sec, 30 cycles, and final extension at 72 ℃ for 5 min. And (3) carrying out electrophoresis on the PCR amplification product on 6% non-denaturing polyacrylamide gel, carrying out silver staining and developing after the electrophoresis is finished, and taking a picture by using a smart phone. The electrophoresis results are shown in FIG. 3. The fragment size of the '06-247' amplification product is 191bp, the sequence is shown as SEQ ID NO:3, the fragment size of the 'He 102' amplification product is 164bp, and the sequence is shown as SEQ ID NO: 4.

SEQ ID NO:3

CATAGGATTGAACAAATCCAGAAACATTCTGTGGAAGAGTTAGGTGAGAGAAATTCTGTGGAAGAGTTAGGTGATCTCTTTAACAAATCCACAGTATTTTTTTGTTTGTTAGAGTTTAGTATGTTCTTGATAGTAACCGACAATTCAAGATCAGTGAAAGAAAAAAATTGTCAGTGTTCATCAAGAATCAG

SEQ ID NO:4

CATAGGATTGAACAAATCCAGAAACATTCTGTGGAAGAGTTAGGTGATCTCTTTAACAAATCCACAGTATTTTTTTGTTTGTTAGAGTTTAGTATGTTCTTGATAGTAACCGACAATTCAAGATCAGTGAAAGAAAAAAATTGTCAGTGTTCATCAAGAATCAG

5. Recombinant inbred line group construction and recombinant inbred line verification

Taking 06-247 as female parent and He102 as male parent, artificially picking buds and emasculating female parent in full-bloom period, taking pollen of male parent for pollination, bagging to form pods, and harvesting F1 seeds. The obtained F1 generation is artificially pollinated in the bud stage so as to obtain F2 seeds by selfing and fructifying. And (3) transferring the single seed from the F2 generation to the F7 generation, respectively breeding 5 seedlings in each F7 strain, extracting DNA on an automatic grinding instrument by using a Tris alkali and potassium chloride (TPS) reagent, detecting by using a screened InDels marker, and recording the heterozygous site and the number of the related single plant for subsequent research. An electrophoresis strip chart of the group of the recombinant inbred line part of the Chinese cabbage detected by using the InDel marker is shown in figure 3.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Shandong province academy of agricultural sciences

<120> InDel marker related to cabbage brilliant green trait gene CER2 mutation, primer and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cataggattg aacaaatcca gaaac 25

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctgattcttg atgaacactg acaat 25

<210> 3

<211> 191

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cataggattg aacaaatcca gaaacattct gtggaagagt taggtgagag aaattctgtg 60

gaagagttag gtgatctctt taacaaatcc acagtatttt tttgtttgtt agagtttagt 120

atgttcttga tagtaaccga caattcaaga tcagtgaaag aaaaaaattg tcagtgttca 180

tcaagaatca g 191

<210> 4

<211> 164

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cataggattg aacaaatcca gaaacattct gtggaagagt taggtgatct ctttaacaaa 60

tccacagtat ttttttgttt gttagagttt agtatgttct tgatagtaac cgacaattca 120

agatcagtga aagaaaaaaa ttgtcagtgt tcatcaagaa tcag 164

Claims

1. An InDel marker related to the CER2 mutation of a cabbage light green trait gene is characterized in that the InDel marker is shown as SEQ ID NO. 3 and SEQ ID NO. 4.

2. A detection primer related to a cabbage brilliant green trait gene CER2 mutation InDel mark is characterized by comprising the following steps:

a forward primer: CATAGGATTGAACAAATCCAGAAAC, respectively;

reverse primer: CTGATTCTTGATGAACACTGACAAT are provided.

3. The detection primer of the InDel marker related to the CER2 mutation of the Chinese cabbage light green trait gene, according to claim 2, wherein the primer is used for PCR amplification.

4. The application of the detection primer of the InDel marker related to the CER2 mutation of the Chinese cabbage light green trait gene in the claim 1 and/or the InDel marker related to the CER2 mutation of the Chinese cabbage light green trait gene in the aspect of crop breeding in the claim 2.

5. The use of claim 4 in crop breeding, wherein the use comprises screening dominant homozygous parent material of Chinese cabbage by the detection primer or molecular marker.

6. The use of claim 4 in the selective breeding of crops, wherein the use comprises the use of the detection primer in the preparation of a detection kit.

7. The use of claim 4 in crop breeding, wherein the use comprises breeding new varieties of brassica crops of other brassicaceae using the bright green CER2 mutant as donor material.

8. The use of claim 7 in crop breeding, wherein the new variety breeding comprises screening the dominant brilliant green CER2 mutant Chinese cabbage as a parent material to be crossed with other Brassica crops.

9. A breeding method of a dominant brilliant green CER2 mutant variety of Chinese cabbage is characterized in that the breeding method comprises the steps of detecting the genotype of a brilliant green CER2 mutant by using the amplification primer of claim 3, and screening to obtain a dominant homozygous individual as a parent for breeding.