CN107988213B

CN107988213B - Rice genome recombinant nucleic acid fragment RecCR020428 and detection method thereof

Info

Publication number: CN107988213B
Application number: CN201610932361.9A
Authority: CN
Inventors: 周发松; 喻辉辉; 张学堂; 邱树青; 何宗顺; 雷昉; 姚玥; 冯芳; 李菁; 韦懿; 陈�光; 何予卿; 杨毅
Original assignee: China National Seed Group Co Ltd
Current assignee: China National Seed Group Co Ltd
Priority date: 2016-10-25
Filing date: 2016-10-25
Publication date: 2020-06-26
Anticipated expiration: 2036-10-25
Also published as: CN107988213A

Abstract

The application provides a rice genome recombinant nucleic acid fragment and a detection method thereof. The application also provides a breeding method of the rice plant containing the recombinant nucleic acid segment, and the rice plant containing the recombinant nucleic acid segment is obtained by performing foreground selection and background selection on the recombinant plant by using the molecular marker.

Description

Rice genome recombinant nucleic acid fragment RecCR020428 and detection method thereof

Technical Field

The present application relates to whole genome selection breeding techniques. Specifically, the application relates to a rice plant which utilizes a whole genome selective breeding technology to breed a recombinant nucleic acid segment with a brown planthopper resistance function, the recombinant nucleic acid segment obtained thereby and a detection method thereof.

Background

Nilaparvata lugens, school name

Belonging to the order Homoptera, the family Pediculidae. The brown planthopper is a monophagic pest, only eats rice, and has the characteristics of preference for warmth, weak cold resistance, short growth period, long-distance migration, outbreak property, rampant property and the like. The brown planthopper is a typical piercing-sucking pest, takes the phloem and xylem sap as raw materials, has large food intake and rapid propagation, and can cause no particle harvest in the affected area once the brown planthopper breaks out greatly. In addition, it can also transmit rice virus diseases (such as grass-like bushy stunt and odontoblast disease) and cause serious harm to rice production.

Over 30 sites resistant to brown planthopper have been identified from wild rice and cultivated rice since the 80's of the 20 th century. Due to the complexity of the phenotypic identification of brown planthoppers, the individual genes Bph14, Bph26 and Bph3, etc., have only been cloned in recent years (Du et al, PNAS.2009,106(52): 22163-22168; Tamura et al, Sci Rep.2014,4: 5872; Liu et al, Nature Biotechnology.2015,33: 301-305). In addition, with the continuous utilization of the brown planthopper resistant variety in production, the adaptability of the brown planthopper to the variety is gradually enhanced. Some resistant varieties widely used in production are gradually losing resistance to brown planthopper (Deen et al, Rice Genet Newsl.2010,25: 70-72).

Currently, the control of brown planthopper still depends on chemical pesticide, which not only increases production cost and pollutes environment, but also promotes the drug resistance of brown planthopper to be enhanced. Therefore, the cultivation requirement of the new variety of brown planthopper resistance is very urgent.

Disclosure of Invention

In one aspect, the present application provides rice genomic recombinant nucleic acid fragments comprising or alternatively consisting of:

-a first recombinant nucleic acid fragment selected from the group consisting of: i) comprises the sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2 or fragments thereof or variants thereof or complementary sequences thereof; and/or

-a second recombinant nucleic acid fragment selected from: ii) a sequence comprising nucleotides 1054 to 1078 and 1778 to 1798 of the sequence shown in SEQ ID NO. 3 or a fragment or variant or complement thereof; iii) a sequence comprising nucleotides 1065 to 1786 of the sequence shown in SEQ ID NO. 3 or a fragment or variant thereof or the complement thereof; iv) a sequence comprising nucleotides from positions 1054 to 1078 and 1778 to 1798 of the sequence shown in SEQ ID NO. 3 or a fragment thereof or a variant thereof or a complementary sequence thereof, and at least one of nucleotides from positions 7 to 29, 192 to 216, 727 to 751 and 1868 to 1889 of the sequence shown in SEQ ID NO. 3 or a fragment thereof or a variant thereof or a complementary sequence thereof; or v) comprises the sequence shown in SEQ ID NO. 3 or a fragment thereof or a variant thereof or the complement thereof.

In one embodiment, the rice genomic recombinant nucleic acid fragment provided herein comprises or alternatively consists of the first recombinant nucleic acid fragment selected from i).

In another embodiment, the rice genomic recombinant nucleic acid fragment provided herein comprises or consists of a second recombinant nucleic acid fragment selected from any one of the sequences ii), iii), iv), v).

In yet another embodiment, the rice genomic recombinant nucleic acid fragments provided herein comprise or consist of a combination of a first recombinant nucleic acid fragment selected from i) and a second recombinant nucleic acid fragment selected from any one of the sequences ii), iii), iv), v).

Further, the present application provides a primer for detecting the recombinant nucleic acid fragment, wherein the primer comprises:

-a primer for detecting the first recombined nucleic acid fragment, selected from the group consisting of: (I) a primer for specifically recognizing the sequences shown as SEQ ID NO. 1 and SEQ ID NO. 2; and/or

-a primer for detecting the second recombinant nucleic acid fragment selected from the group consisting of: (II) a primer that specifically recognizes a sequence of nucleotides 1054 to 1078 of the sequence shown in SEQ ID NO. 3, and a primer that specifically recognizes a sequence of nucleotides 1778 to 1798 of the sequence shown in SEQ ID NO. 3; (III) a primer that specifically recognizes a sequence of nucleotides 1065 to 1786 of the sequence shown in SEQ ID NO. 3; (IV) a primer that specifically recognizes a sequence of nucleotides 1054 to 1078 of the sequence shown in SEQ ID NO. 3, a primer that specifically recognizes a sequence of nucleotides 1778 to 1798 of the sequence shown in SEQ ID NO. 3, and a primer that specifically recognizes at least one of nucleotides 7 to 29, 192 to 216, 727 to 751 and 1868 to 1889 of the sequence shown in SEQ ID NO. 3; or (V) a primer which specifically recognizes the sequence shown in SEQ ID NO. 3.

In one embodiment, the primer pairs used to amplify the first recombinant nucleic acid fragment, e.g., the primer pairs used to amplify the sequence set forth in SEQ ID NO. 1, are, e.g., 5'-GCACGATCTTGAACAGGTAGTCG-3', and 5'-TTGATGGTACTGGTGCAAGGGAT-3'; the primer pairs for amplifying the sequence shown in SEQ ID NO. 2 are, for example, 5'-CCGAAGAAGAAGTTCCCATAAA-3', and 5'-GCTGTACCAAACATACCCATAC-3'. Primers for sequencing the first recombinant nucleic acid fragment, e.g., primers for sequencing the sequence shown in SEQ ID NO. 1 are, e.g., 5'-GCACGATCTTGAACAGGTAGTCG-3'; primers for sequencing the sequence shown as SEQ ID NO. 2 are, for example, 5'-GCTGTACCAAACATACCCATAC-3'

In another embodiment, the primer pairs for amplifying the second recombinant nucleic acid fragment, e.g., the primer pairs for amplifying the sequence shown in SEQ ID NO. 3, are, e.g., 5'-GGAACGAAGTTAGCAGTAGTAGCA-3', and 5'-CGAGACAGTTTTGAGATGGGATAG-3'. Primers for sequencing the second recombinant nucleic acid fragment, e.g., primers for sequencing the sequences shown at positions 7 to 29 and 192 to 216 of SEQ ID NO. 3 are, e.g., 5'-GGAACGAAGTTAGCAGTAGTAGCA-3'; primers for sequencing the sequences shown at positions 727 to 751 and 1054 to 1078 of SEQ ID NO. 3 are, for example, 5'-GTTGCCCACAGTTTCCTCAC-3'; and primers for sequencing the sequences shown at positions 1778 to 1798 and 1868 to 1889 of SEQ ID NO. 3 are, for example, 5'-CGAGACAGTTTTGAGATGGGATAG-3'.

In another aspect, the present application provides a method of breeding a rice plant comprising the recombinant nucleic acid fragment, wherein the recombinant nucleic acid fragment has a brown planthopper resistance function, and the method comprises the steps of: 1) hybridizing 'Zhonghui 629' of recurrent parent rice with 'Hua 130B' of donor rice, backcrossing the obtained hybrid with recurrent parent to obtain a backcross generation, screening single-side homologous recombination fragments of brown planthopper resistant genome fragments by using a positive selection marker BphC03ID03 and negative selection markers BphC03S20 and BphC03S88, and performing background selection by using a rice whole genome breeding chip; 2) selecting a recombinant single plant with better background reversion and recurrent parents for backcross again to obtain a second backcross generation, detecting the second backcross generation by using a forward selection marker BphC03ID03, selecting the recombinant single plant containing the brown planthopper resistant genome segment, and then selecting the background of the recombinant single plant by using a rice whole genome breeding chip; 3) carrying out backcross again on the recombinant single plant with the recovered background and recurrent parents to obtain three backcross generations, carrying out screening on homologous recombination fragments on the other side of the brown planthopper resistant genome fragment by utilizing a positive selection marker BphC03ID03 and negative selection markers BphC03S20 and BphC03S88, and carrying out background selection on the recombinant single plant by utilizing a rice whole genome breeding chip; and 4) selecting a recombinant single plant with small introduced segment and good background recovery, selfing the selected recombinant single plant once to obtain a selfed seed, detecting the selfed seed by using a forward selection marker BphC03ID03, and performing background selection on the selfed seed by using a rice whole genome breeding chip to finally obtain a rice plant containing the homozygous genome recombinant nucleic acid segment and with the background recovery.

In one embodiment, the amplification primers used in the foreground selection of recombinant plants using molecular markers include a primer pair for amplifying the molecular marker BphC03ID03, wherein the forward primer is 5'-GCAAGAATCCGACGCCATAA-3' and the reverse primer is 5'-CTCTGCTCCTTGCTCTAATCCTCT-3'; a primer pair for amplifying a molecular marker BphC03S20, wherein the forward primer is 5'-TGGCAGCATTTTGTTGTAG-3', and the reverse primer is 5'-TTCCAGCCGTGTCTATTT-3'; and a primer pair for amplifying the molecular marker BphC03S88, wherein the forward primer is 5'-GTGATGCATGCTTTACCACC-3', and the reverse primer is 5'-ATACCGTAAACTTTGCACGC-3'.

In another aspect, the present application provides a method for detecting the recombinant nucleic acid fragment, which comprises the steps of performing a PCR reaction using the primer provided herein and the genome to be detected as a template, and analyzing the PCR product. Specifically, the method takes the genome DNA of a sample to be detected as a template, utilizes the amplification primer to carry out PCR amplification, then utilizes the sequencing primer to sequence the obtained amplification product, and if the sequencing result is consistent with or complementary to the sequence shown by SEQ ID NO. 1-2 and/or SEQ ID NO. 3 or the segment thereof, the sample to be detected contains the homologous recombination nucleic acid segment of the sequence shown by SEQ ID NO. 1-2 and/or SEQ ID NO. 3.

The recombinant nucleic acid fragment containing the sequence shown by SEQ ID NO 1-2 and/or SEQ ID NO 3 or the segment thereof in the sample to be detected is determined through detection, so that the recombinant nucleic acid fragment with the brown planthopper resistance function in the sample to be detected can be determined.

In addition, the present application also provides a kit for detecting a recombinant nucleic acid fragment, which comprises the primer as described above.

Further, the present application also provides a method for screening rice plants or seeds containing the recombinant nucleic acid fragment, which comprises the step of detecting whether the genome of the rice plant to be detected contains the recombinant nucleic acid fragment as described above.

In one embodiment, the primers described above are used to detect whether the genome of the rice plant to be tested contains the recombinant nucleic acid fragment as described above. In another embodiment, the method for detecting the recombinant nucleic acid fragment as described above is used to detect whether the genome of the rice plant to be detected contains the recombinant nucleic acid fragment as described above. In yet another embodiment, the kit as described above is used to detect whether the genome of the rice plant to be tested contains the recombinant nucleic acid fragment as described above.

In yet another aspect, the present application provides rice plants or seeds thereof selected by the methods comprising the recombinant nucleic acid fragments disclosed herein.

The method for breeding the rice plant containing the brown planthopper resistant genome recombinant nucleic acid fragment based on the whole genome selective breeding technology has the advantages of rapidness, accuracy and stability. Only through the transformation of five generations, only the target genome segment can be introduced into the acceptor material, and the reversion of the background can be realized at the same time. The improved receptor material is 'Zhongzhonghui 629', which is a high-yield, high-quality, strong-quality and broad-spectrum restorer. By using the method, the resistance of the brown planthopper can be greatly improved under the condition of keeping the original advantages of the Zhongzhonghui 629'. Meanwhile, the recombinant nucleic acid fragment provided by the application is closely related to the resistance of the brown planthopper, and can be used as a resistance resource to be applied to the cultivation of other varieties.

Drawings

FIG. 1 shows the results of the PCR 020428 RICE RICE60K whole genome breeding chip in example 1 of the present application; wherein, the boxes indicated by the abscissa number sequentially represent 12 rice chromosomes, the ordinate number is the physical position [ in megabases (Mb) ] on the rice genome, the gray line represents the genotype of the recipient parent 'Zhonghui 629', the black line represents the genotype of the donor parent 'Hua 130B', and the white line represents the same genotype of the two parents, i.e. no polymorphic segment. The black line of chromosome 3 shows that the segment is the introduced genome recombinant nucleic acid fragment RecCR020428 for resisting brown planthopper.

FIG. 2 shows the results of indoor identification of resistance to CR020428 brown planthopper in example 3 of the present application; the blades shown in the figure are in the order: (A) high-susceptibility brown planthopper variety 'taizhongzhongyuan No. 1'; (B) improved new strain CR 020428; (C) original variety 'Zhonghui 629'; (D) the donor parent, Hua 130B'.

Detailed Description

The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be understood in accordance with their ordinary usage by those of ordinary skill in the relevant art.

As used herein, "nucleotide sequence" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, nucleotide sequences are written in the 5 'to 3' direction from left to right, and include known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides.

In some embodiments, changes may be made to the nucleotide sequences of the present application to make conservative amino acid substitutions. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made according to monocot codon preferences, e.g., codons encoding the same amino acid sequence can be substituted with monocot preferred codons without altering the amino acid sequence encoded by the nucleotide sequence.

In particular, the application relates to further optimizing the resulting nucleotide sequences for SEQ ID NO 1-2 and/or SEQ ID NO 3. More details of this method are described in Murray et al (1989) Nucleic Acids Res.17: 477-498. The optimized nucleotide sequence can be used for improving the expression of the brown planthopper resistant genome recombinant nucleic acid segment in rice.

In some embodiments, the present application also relates to variants of the sequences shown in SEQ ID NO 1-2 and/or SEQ ID NO 3. Generally, a variant of a particular nucleotide sequence will have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more sequence identity, or the complement thereof, to the particular nucleotide sequence. Such variant sequences include additions, deletions or substitutions of one or more nucleic acid residues, which may result in the addition, removal or substitution of the corresponding amino acid residue. Sequence identity is determined by sequence alignment programs known in the art, including hybridization techniques. Nucleotide sequence variants of the embodiments may differ from the sequences of the present application by as little as 1-15 nucleotides, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2, or even 1 nucleotide.

The application also relates to sequences comprising specific positions in the sequences shown in SEQ ID NO 1-2 and/or SEQ ID NO 3 or fragments thereof or variants thereof or complements thereof, e.g.sequences shown in SEQ ID NO 1 and SEQ ID NO 2 or fragments thereof or variants thereof or complements thereof (border SNP/Indel sites comprising upstream homologous recombination segments). Or a sequence comprising nucleotides 1054 to 1078 and 1778 to 1798 of the sequence shown in SEQ ID NO. 3 or a fragment or variant thereof or a complementary sequence thereof (border SNP/Indel site comprising a downstream homologous recombination region); a sequence comprising nucleotides 1065 to 1786 of the sequence shown in SEQ ID NO. 3 or a fragment or variant thereof or the complement thereof (comprising the downstream homologous recombination segment and its border SNP/Indel site); a sequence comprising nucleotides 1054 to 1078 and 1778 to 1798 of the sequence shown in SEQ ID No. 3 or a fragment or variant or complement thereof, and any one or more of: 3 or a fragment thereof or a variant thereof or the complement thereof (comprising the border SNP/Indel sites of the downstream homologous recombination region and the SNP/Indel sites derived from the donor fragment and/or the acceptor fragment, respectively).

Based on the fragment or segment containing the specific site, the corresponding sequence shown in SEQ ID NO 1-2 and/or SEQ ID NO 3 can be specifically identified. Furthermore, the recombinant nucleic acid fragment with the brown planthopper resistance function in the sample to be detected can be determined by identifying the recombinant nucleic acid fragment containing the sequence shown in SEQ ID NO. 1-2 and/or SEQ ID NO. 3.

As used herein, "rice" is any rice plant and includes all plant varieties that can be bred with rice. As used herein, "plant" or "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like.

The method can be applied to any rice variety needing breeding. That is, any elite variety lacking a favorable trait (i.e., a variety having a good comprehensive trait and expected to have a future development) can be used as a recurrent parent. Another variety having the advantageous trait lacking in the recipient is used as the donor parent and the advantageous trait provided is preferably dominantly monogenically controlled. In an embodiment of the present application, rice 'Zhonghui 629' was used as a recurrent parent, and rice 'Hua 130B' that has been confirmed to have good resistance to brown planthopper was used as a donor.

In the breeding method of the recombinant plant provided by the application, the molecular marker is used for carrying out prospect selection on the recombinant plant. The reliability of the foreground selection mainly depends on the closeness degree of linkage between the markers and the target gene, and in order to improve the accuracy of selection, the target gene is generally tracked and selected by two adjacent markers on two sides at the same time.

In embodiments of the present application, the foreground selection markers employed include positive selection markers and negative selection markers. In a specific embodiment, the positive foreground selection marker used in the optimized screening is the marker BphC03ID03 that is closely linked to the target genomic fragment, the negative selection marker is the marker BphC03S20 located upstream of the target fragment, and the marker BphC03S88 located downstream of the target fragment.

In the present embodiment, when the detection of homologous recombination is carried out using the above-mentioned foreground selection marker, the criteria for judging one-sided or one-sided homologous recombination are that BphC03ID03 detects the same band type as ` Hua 130B ` and BphC03S20 or BphC03S88 detects the same band type as ` Zhongzhonghui 629 `; the criteria for judging the bilateral or bilateral homologous recombination are that BphC03ID03 detects the same band type as 'Hua 130B', and BphC03S20 and BphC03S88 detect the same band type as 'Zhongzhonghui 629'.

In the present application, any available chip can be used for background selection in the breeding method provided in the present application. In a preferred embodiment, the RICE whole genome breeding chip RICE6K disclosed in the present applicant's Chinese patent application CN102747138A, or the RICE whole genome breeding chip RICE60K disclosed in PCT international application WO/2014/121419, can be used. The entire contents of both of these applications are incorporated herein by reference in their entirety.

The following examples are for the purpose of illustration only and are not intended to limit the scope of the present application. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the molecular cloning Manual, Sambrook et al (Sambrook J & Russell DW, molecular cloning: a laboratory Manual,2001), or the conditions suggested by the manufacturer's instructions.

The rice plant material information used in the application can be seen in Chinese rice varieties and pedigree databases thereof (http:// www.ricedata.cn/variety/index. htm).

The physical location of the rice genome referred to in this application is referred to the rice Nipponbare genome MSU/TIGR annotation, version 6.1 (http:// rice plant. MSU. edu /).

Example 1Breeding recombinant plant with brown planthopper resistant genome segment

The materials used in this example were rice 'Zhonghui 629' and rice 'Hua 130B'.

The rice 'Hua 130B' has good resistance to brown planthopper, and presumably the gene cluster regions of QBPH3(Hu et al, Molecular Breeding.2015,35:3) and Bph14(Du et al, PNAS.2009,106(52):22163-22168) of the No. 3 chromosome play a key role in the resistance to brown planthopper of the material.

In the process of breeding the recombinant plants, the molecular markers are used for carrying out prospect selection on the recombinant plants, and the adopted prospect selection molecular markers are screened. The molecular marker used is partially derived from the website http:// www.gramene.org/, and partially designed by self. The design method is to download the segment DNA sequence with reference to the rice Nipponbare genome MSU/TIGR annotation version 6.1. SSR sites in the above sequences were scanned using SSRLOCATOR software. Primers are designed for the found SSR loci by using Primer Premier 3.0 software, and 128 pairs of primers are designed in total. The polymorphism of the primer pair in ` Hua 130B ` and ` Zhonghui 629 ` is screened by a PCR method, and finally the foreground selective molecular markers with polymorphism and high amplification efficiency in two materials are selected, namely a positive selective marker BphC03ID03, a negative selective marker BphC03S20 and a negative selective marker BphC03S 88. The specific primer information for PCR amplification of the above molecular markers is shown in Table 1.

TABLE 1 Foreground selection of molecular marker primer information

The genome segment of the gene in the rice 'Hua 130B' is introduced into the rice 'Zhonghui 629', and the specific process is as follows:

taking 'Zhonghui 629' as a recurrent parent and 'Hua 130B' as a donor parent to carry out hybridization, and carrying out backcross on the obtained hybrid and the 'Zhonghui 629' of the recurrent parent to obtain BC₁F₁After seed breeding, recombinant individual selection was carried out using positive selection marker BphC03ID03 and negative selection markers BphC03S20 and BphC03S88, 7 individuals which were homologously recombined on the side of the target genomic DNA fragment, that is, BphC03ID03 detected the same band type as ` Hua 130B ` and BphC03S20 or BphC03S88 detected the same band type as ` Zhongzhonghui ` were selected and background-selected using RICE whole genome breeding chip RICE6K (CN102747138A) (Yu et al, Plant Biotechnology journal.2014,12: 28-37).

Comparing the chip results in 7 selected unilateral homologous recombinant individuals, selecting the recombinant individual with best background recovery (the background recovery value of the generation exceeds 75%), backcrossing the recombinant individual with the recurrent parent 'Zhonghui 629', and obtaining BC₂F₁After the seeds are raised, the positive selection marker BphC03ID03 is used for detecting the seeds, a recombinant single plant containing a target genome fragment, namely BphC03ID03 is selected, the same banding pattern as 'Hua 130B' is detected, and the RICE whole genome breeding chip RICE6K is used for carrying out background selection on the recombinant single plant.

Selecting the single plant with better background recovery (the background recovery value of the generation exceeds 87.5 percent), and backcrossing the single plant with the recurrent parent 'Zhonghui 629' again to obtain BC₃F₁After seedling raising, the harvested seeds are screened for homologous recombination fragments on the other side of a target genome fragment by using a positive selection marker BphC03ID03 and negative selection markers BphC03S20 and BphC03S88, and 11 individuals recombined on two sides of the target fragment are obtained, namely BphC03ID03 detects the same band type as 'Hua 130B', and BphC03S20 and BphC03S88 detect the same band type as 'Zhonghui 629'.

The 9 double-sided cross-over individuals were subjected to background and target fragment selection using a RICE whole genome breeding chip RICE60K (WO/2014/121419) (Chen et al, Molecular plant 2014,7: 541) 553, and one target individual with a smaller introduced target fragment and a good background was selected (the generation background recovery value was more than 93.75%).

Selfing the selected single plant once to obtain BC₃F₂After seedling raising, the positive selection marker BphC03ID03 was used to detect it, and a single plant containing the target genome fragment, BphC03ID03, was selected to detect the same banding pattern as ` Hua 130B `, and was subjected to background selection using RICE whole genome breeding chip RICE 60K.

Finally, one strain which is homozygous for the target fragment and has a background recovery value (the background recovery value exceeds 99%) is obtained and named as CR 020428. The chip detection results are shown in FIG. 1.

Example 2Determination of homologous recombination fragment after introduction of brown planthopper resistant genome fragment

To determine the size of the introduced brown planthopper resistant genomic fragment, the homozygous individual for the introduced segment of 'Zhonghui 629' was subjected to sequencing of homologous recombination fragments flanking the genomic fragment of interest. The brown planthopper resistant genome recombinant nucleic acid fragment contained in CR020428 is named RecCR 020428.

As preliminarily determined by the detection result of a RICE whole genome breeding chip RICE60K, the upstream homologous recombination fragment of RecCR020428 is positioned between markers R0335402302GT and F0335657380GA, and the downstream homologous recombination fragment is positioned between markers F0335749323TC and R0335762925 CT.

Meanwhile, Miseq sequencing technology was used to perform whole genome sequencing on three samples of 'zhongzhonghui 629', 'hua 130B' and CR 020428. Library construction was performed using TruSeq Nano DNA LT Kit (illumina) Kit, quantification was performed using LibraryQuantification Kit-Universal (KAPA biosystems) Kit, and sequencing was performed using MiSeqV2Reagent Kit (illumina) Kit. Detection was performed using Miseq bench top sequencer (illumina). The specific steps and methods are shown in each kit and the instruction manual of the sequencer.

According to the SNP chip and the Miseq sequencing result, the upstream homologous recombination fragment of RecCR020428 is further determined to be in the interval of 35420807bp to 35467580bp on the 3 rd chromosome, and the downstream homologous recombination fragment is positioned in the interval of 35758124bp to 35762279bp on the 3 rd chromosome.

On the basis, the DNA sequences of the corresponding segments were downloaded with reference to the rice Nipponbare genome MSU/TIGR annotation, version 6.1. Amplification and sequencing primers were designed using Primer Premier 5.0 software, with the design requirements being around 22nt Primer length, 40-60% GC content and no mismatches.

By taking the recipient parent 'Zhonghui 629' and the donor parent 'Hua 130B' as controls, amplification primers are designed for homologous recombination fragments upstream and downstream of RecCR020428, high fidelity enzyme KOD FXneo (TOYOBO) is used for amplification, and a two-step method or a three-step method is used for searching for optimal amplification conditions to ensure that an amplification product shows a single bright band in agarose gel electrophoresis detection. 26 pairs of screened 2 pairs of primers are designed and used for amplifying upstream homologous recombination fragments, and the reaction conditions are respectively 1) BphCC03X13K 5: 94 ℃ for 2 min; 10sec at 98 ℃, 30sec at 61 ℃, 60sec at 68 ℃, 37 cycles; 1min at 20 ℃; 2) BphCC03X13K 23: 94 ℃ for 2 min; 10sec at 98 ℃, 30sec at 59 ℃, 240sec at 68 ℃, 37 cycles; 1min at 20 ℃. Screening 1 pair of primers for amplifying downstream homologous recombination fragments, wherein the reaction conditions are as follows: 94 ℃ for 2 min; 98 ℃ 10sec, 61 ℃ 30sec, 68 ℃ 150sec, 37 cycles; 1min at 20 ℃.

In addition, the amplification product is used as a template, sequencing is carried out by a Sanger sequencing method, a total of 116 sequencing primers are designed for the upstream homologous recombination fragment, and 2 sequencing primers are selected for SNP or Indel sites according to the actual sequencing effect. 4 sequencing primers are designed for the downstream homologous recombination fragments, and 3 sequencing primers are selected for SNP or Indel sites according to the actual sequencing effect. Specific amplification primer and sequencing primer sequences are shown in Table 2.

TABLE 2 amplification and sequencing primer information for Brown planthopper resistant genomic recombinant nucleic acid fragments

The upstream homologous recombination fragment of RecCR020428 comprises the signature sequences SEQ ID NO 1 and SEQ ID NO 2. SEQ ID NO. 1 is a characteristic sequence derived from 629's "Zhonghui" of an acceptor, and 1 Indel is present as compared with 130B's of a donor. SEQ ID NO. 2 is a characteristic sequence derived from donor 'Hua 130B', and 1 SNP exists compared with recipient 'Zhonghui 629'.

The length of the homologous recombination fragment downstream of RecCR020428 was 1892bp (SEQ ID NO: 3). 1-1065bp is the genome segment of donor 'Hua 130B', and there are 3 SNPs and 1 Indel compared with 629's in recipient'. 1066-1785bp 720bp segment is a homologous recombination segment. 1786-1892bp is the genomic fragment of 629 'from the recipient' Mitsui, and compared with the donor 'Hua 130B', there are 1 SNP and 1 Indel.

The differences in the CR020428, ` Zhonghui 629 ` and ` Hua 130B ` SNP or Indel sites are shown in Table 3. The "positions" in the table are: the positions of the upstream homologous recombination fragment SNP or Indel site differences are respectively relative to the positions of SEQ ID NO:1 or SEQ ID NO:2, the positions of the downstream homologous recombination fragment SNP or Indel site differences relative to SEQ ID NO: and 3. the Chinese patent medicine can be used for treating the diseases.

TABLE 3CR020428, ` Zhonghui 629 `, and ` Hua 130B ` SNP or Indel site differences

Example 3'Zhonghui 629' identification of resistance after introduction of genome fragment resistant to brown planthopper

In order to identify the resistance effect, the indoor resistance identification of the brown planthopper is carried out on the new strain CR020428 bred by the application, the recipient parent 'Zhonghui 629', the donor parent 'Hua 130B' (as a positive control), and the station 1 'Taiwan' of the high-susceptibility brown planthopper variety (as a negative control), and the identification method is as follows.

Soaking and accelerating germination of each part of material indoors, then sowing the material in a plastic basin with scribed grid lines, sowing 45 plants in each part of material in 3 rows, and reserving 10 plants in each row for inoculation, wherein the total number of 30 plants with consistent healthy growth vigor are reserved when two leaves are in one heart period. The insects are sourced from brown planthoppers collected from fields and bred indoors. And (3) collecting 2-3-year nymphs to plants to be identified, wherein each plant is only provided with 5-10 nymphs. When 95% of the number 1 'dead seedlings in the' Taiwan stand begin to record the resistance grade of each identified seedling, the average value of the resistance grades of 30 seedlings is taken as the resistance grade of the material, and the resistance level is evaluated according to the resistance grade. Wherein, the resistance grade is 10 grades in total:

stage

0 or 1, the blade is not damaged or the tip of the first blade is yellow; grade 2, first leaf 1/2 yellow or tip crinkled; grade 3, the first leaf becomes yellow or withered; at grade 4, the second leaf part or the apex of heart leaf becomes yellow; grade 5, the second leaf is yellow, shriveled or withered, and the heart leaves are green and curled; grade 6, curling heart leaves and withering heart leaf tips; grade 7, heart leaves are curled and withered, and plants are not dead; grade 8, withered heart leaves, slightly lodging; grade 9, lodging the whole plant. According to the resistance grades, the grade 0-0.9 is judged as high resistance, the grade 1.0-2.9 is resistance, the grade 3.0-5.9 is medium resistance, the grade 6.0-6.9 is medium feeling, the grade 7.0-7.9 is medium feeling, and the grade 8.0-9.0 is high feeling.

The results of identifying the indoor resistance of brown planthopper are shown in figure 2, wherein the 'Taizhongyuan No. 1' is high-sensitive, the original variety 'Zhonghui No. 629' is sensitive, the improved new strain CR020141 is resistant, and the donor parent 'Hua 2048B' is high-resistant.

Although the present application has been described in detail with respect to the general description and specific embodiments, it will be apparent to those skilled in the art that certain modifications or improvements may be made based on the present application. Accordingly, such modifications and improvements are intended to be within the scope of this invention as claimed.

Sequence listing

<110> China seed group Co., Ltd

<120> rice genome recombinant nucleic acid fragment RecCR020428 and detection method thereof

<160>16

<170>PatentIn version 3.5

<210>1

<211>25

<212>DNA

<213> Rice (Oryza sativa)

<400>1

atttttattg gggaagagag agaga 25

<210>2

<211>25

<212>DNA

<213> Rice (Oryza sativa)

<400>2

cctgcttgac ccaattatat gggtg 25

<210>3

<211>1892

<212>DNA

<213> Rice (Oryza sativa)

<220>

<221> derived from the genome segment of' Hua 130B

<222>(1)..(1065)

<220>

<221> homologous recombination segment

<222>(1066)..(1785)

<220>

<221> A genome segment derived from' Zhongzhonghui 629

<222>(1786)..(1892)

<400>3

gtggcggtca cggaggcgac ggggcggcag gcggcgtcgt tcgtgctcgg ctgcgtggcc 60

acgctcaccg tcatgctgct cttccagtac caggcgccgccggactacgg ccgcgccgcc 120

aggtcgccgg tgcagttctc cacctccaga gaccagctgc tgctgcactg cggcggcaat 180

ggaacggcgc cgccgccgcc ggtgatcgca cgtggcggcg aggaggctaa catcaccggc 240

aagcctccga cgactgctac tgctgtcgcc gaggagcagc cgccaaccaa gcctcctgcg 300

acctctactg catcttcacc aactcatcat attccagcaa ccagtacaga tcttgaagaa 360

gaggttagtt ctcattaatc tcccggctta attaattttc acttctttaa tttcttatgc 420

gtcatctggt atcagtaatc tgctaaattt gtgccgtctt gaattcactc tgctgcccac 480

agtttcctca catgttcaaa attaactcaa cagtacaact catcataata aaaacagggg 540

gttcttcaat ttcagtagga cacaactaac cctttttggg tgtctgccaa atgcaccaag 600

aaaatgattt tgtaagatat atgctacata taaccacgaa ttcagaaatc attccatgag 660

acttgatcta ctattttgac ttcgaaaaag agataggcta atcaatttgt tatatattaa 720

tctcgatcct tgattacctt attgtacttg tttcgagtgt acgaaaagtg gcaaagaaag 780

tcctaggatc ttacaccacc tagtgattca cgctaatttg atcatcaatg gcggcagggc 840

ggagagttcc gggggttggc ggcggcggtg gcgcgggcgg cgacggatga ccggacggtg 900

atcatcacgt gcgtgaacca cgcgttcgcg gcgcccgact cgctcctgga catcttcctc 960

gagggcttcc gcgtcggcga cggcacgccg gagctcctcc gccacgtcct cgtcgtcgcc 1020

atggatccca ccgcgctcac ccggtgccgc gccgtccacc cccactgcta cctctacacc 1080

atgcccggcc tcgacgtcga cttcacctcc gagaagttct tcgcctccaa ggactacctc 1140

gagctcgtct ggagcaagct caagctccag cgccgaattc tccagctcgg ctacaacttc 1200

ctcttcacgg taattcagta actgtaaatt gaaattaaca ccgccattga ctgcaaatca 1260

agatgaactg attaattaac caattgcaag atcaggacgt tgacattgtg tggctgagga 1320

atccgttcaa gcacgtggcg gtgtacgcgg acatggcgat ctcgagcgac gtgttcttcg 1380

gtgacccgga caacatcgac aacttcccaa acacgggctt cttctacgtg aagccgagcg 1440

cgaggacgat cgccatgacc aaggagtggc acgaggcgag gagctcgcac ccggggctca 1500

acgagcagcc ggtgttcaac cacatcaaga agaagctggt gaagaagctg aagctcaagg 1560

ttcagtacct ggacacggcc tacatcggcg gattctgcag ctacggcaag gatctgagca 1620

agatctgcac catgcacgcc aactgctgca tcggcctcca atccaagatc agtgatctca 1680

agggtgttct tgctgactgg aagaactaca ccaggttgcc accctgggca aagcccaatg 1740

ccaggtggac tgtgcctggt aaatgcatcc attgattttg attgtcgatc gggcagtatc 1800

tggtgttgta ggctacgtac agtcaggaag atagctttat ttgcacatga aagggcgaat 1860

tttgtttttt ttttggtttg ttgtagattg at 1892

<210>4

<211>23

<212>DNA

<213> Artificial sequence

<400>4

gcacgatctt gaacaggtag tcg 23

<210>5

<211>23

<212>DNA

<213> Artificial sequence

<400>5

ttgatggtac tggtgcaagggat 23

<210>6

<211>22

<212>DNA

<213> Artificial sequence

<400>6

ccgaagaaga agttcccata aa 22

<210>7

<211>22

<212>DNA

<213> Artificial sequence

<400>7

gctgtaccaa acatacccat ac 22

<210>8

<211>24

<212>DNA

<213> Artificial sequence

<400>8

ggaacgaagt tagcagtagt agca 24

<210>9

<211>24

<212>DNA

<213> Artificial sequence

<400>9

cgagacagtt ttgagatggg atag 24

<210>10

<211>20

<212>DNA

<213> Artificial sequence

<400>10

gttgcccaca gtttcctcac 20

<210>11

<211>20

<212>DNA

<213> Artificial sequence

<400>11

gcaagaatcc gacgccataa 20

<210>12

<211>24

<212>DNA

<213> Artificial sequence

<400>12

ctctgctcct tgctctaatc ctct 24

<210>13

<211>19

<212>DNA

<213> Artificial sequence

<400>13

tggcagcatt ttgttgtag 19

<210>14

<211>18

<212>DNA

<213> Artificial sequence

<400>14

ttccagccgt gtctattt 18

<210>15

<211>20

<212>DNA

<213> Artificial sequence

<400>15

gtgatgcatg ctttaccacc 20

<210>16

<211>20

<212>DNA

<213> Artificial sequence

<400>16

ataccgtaaa ctttgcacgc 20

Claims

1. A rice genome recombinant nucleic acid fragment consisting of a first recombinant nucleic acid fragment and a second recombinant nucleic acid fragment as follows:

-a first recombinant nucleic acid fragment being the sequence shown in SEQ ID No. 1 or the complement thereof and SEQ ID No. 2 or the complement thereof; and

-a second recombinant nucleic acid fragment which is the sequence shown in SEQ ID NO. 3 or a complementary sequence thereof.

2. A primer set for detecting the fragment of claim 1, wherein the primer set comprises:

(I) primer pairs for amplifying first recombined nucleic acid fragments

5’-GCACGATCTTGAACAGGTAGTCG-3’，

5’-TTGATGGTACTGGTGCAAGGGAT-3’；

5’-CCGAAGAAGAAGTTCCCATAAA-3’，

5'-GCTGTACCAAACATACCCATAC-3', respectively; and

(II) primers for sequencing the first recombinant nucleic acid fragment

5’-GCACGATCTTGAACAGGTAGTCG-3’；

5'-GCTGTACCAAACATACCCATAC-3', respectively; and

(III) primer pairs for amplifying sequences shown in SEQ ID NO. 3

5’-GGAACGAAGTTAGCAGTAGTAGCA-3’，

5’-CGAGACAGTTTTGAGATGGGATAG-3’；

(IV) primer for sequencing SEQ ID NO. 3

5’-GGAACGAAGTTAGCAGTAGTAGCA-3’；

5’-GTTGCCCACAGTTTCCTCAC-3’；

5’-CGAGACAGTTTTGAGATGGGATAG-3’。

3. A method of breeding a rice plant comprising the recombinant nucleic acid fragment of claim 1, wherein the recombinant nucleic acid fragment has brown planthopper resistance function, and the method comprises the steps of:

1) hybridizing 'Zhonghui 629' of recurrent parent rice with 'Hua 130B' of donor rice, backcrossing the obtained hybrid with recurrent parent to obtain a backcross generation, screening single-side homologous recombination fragments of brown planthopper resistant genome fragments by using a positive selection marker BphC03ID03 and negative selection markers BphC03S20 and BphC03S88, and performing background selection by using a rice whole genome breeding chip;

2) selecting a recombinant single plant with better background reversion and recurrent parents for backcross again to obtain a second backcross generation, detecting the second backcross generation by using a forward selection marker BphC03ID03, selecting the recombinant single plant containing the brown planthopper resistant genome segment, and then selecting the background of the recombinant single plant by using a rice whole genome breeding chip;

3) carrying out backcross again on the recombinant single plant with the recovered background and recurrent parents to obtain three backcross generations, carrying out screening on homologous recombination fragments on the other side of the brown planthopper resistant genome fragment by utilizing a positive selection marker BphC03ID03 and negative selection markers BphC03S20 and BphC03S88, and carrying out background selection on the recombinant single plant by utilizing a rice whole genome breeding chip; and

4) selecting a recombinant single plant with small introduced segment and good background reversion, selfing the selected recombinant single plant once to obtain a selfed seed, detecting the selfed seed by using a forward selection marker BphC03ID03, and performing background selection on the selfed seed by using a rice whole genome breeding chip to finally obtain a rice plant containing homozygous genome recombinant nucleic acid segment and with reversion of background,

wherein the amplification primers used for the foreground selection of the recombinant plants by using the molecular markers are as follows

The primer pair of the amplification molecular marker BphC03ID03 is as follows:

a forward primer: 5'-GCAAGAATCCGACGCCATAA-3' the flow of the air in the air conditioner,

reverse primer: 5'-CTCTGCTCCTTGCTCTAATCCTCT-3', respectively;

the primer pair of the amplification molecular marker BphC03S20 is as follows:

a forward primer: 5'-TGGCAGCATTTTGTTGTAG-3' the flow of the air in the air conditioner,

reverse primer: 5'-TTCCAGCCGTGTCTATTT-3', respectively; and

the primer pair of the amplification molecular marker BphC03S88 is as follows:

a forward primer: 5'-GTGATGCATGCTTTACCACC-3' the flow of the air in the air conditioner,

reverse primer: 5'-ATACCGTAAACTTTGCACGC-3' are provided.

4. A method for detecting the recombinant nucleic acid fragment of claim 1, which comprises the steps of performing a PCR reaction using the primer set of claim 2 and a test genome as a template, and analyzing the PCR product.

5. A kit for detecting the recombinant nucleic acid fragment of claim 1, comprising the primer set of claim 2.

6. A method of screening rice plants or seeds containing the recombinant nucleic acid fragment of claim 1, comprising the step of detecting whether the genome of a test rice plant or seed contains the recombinant nucleic acid fragment of claim 1.

7. The method of claim 6, wherein the detection is performed using the primer set of claim 2, or using the method of claim 4, or using the kit of claim 5.