CN108018284B

CN108018284B - Rice genome recombinant nucleic acid fragment RecCR012070 and detection method thereof

Info

Publication number: CN108018284B
Application number: CN201610933917.6A
Authority: CN
Inventors: 喻辉辉; 周发松; 陆青; 刘刚; 陈伟康; 韦懿; 石义涛; 宋丁丁; 张小波; 雷昉; 姚玥; 李旭; 潘丽; 李菁; 陈�光
Original assignee: China National Seed Group Co Ltd
Current assignee: China National Seed Group Co Ltd
Priority date: 2016-10-25
Filing date: 2016-10-25
Publication date: 2020-07-10
Anticipated expiration: 2036-10-25
Also published as: CN108018284A

Abstract

The application provides a rice genome recombinant nucleic acid fragment and a detection method thereof. The application also provides a breeding method of the rice plant containing the recombinant nucleic acid segment, and the rice plant containing the recombinant nucleic acid segment is obtained by performing foreground selection and background selection on the recombinant plant by using the molecular marker.

Description

Rice genome recombinant nucleic acid fragment RecCR012070 and detection method thereof

Technical Field

The present application relates to whole genome selection breeding techniques. In particular, the application relates to a rice plant which utilizes a whole genome selective breeding technology to breed a recombinant nucleic acid segment with a rice blast resistance function, the recombinant nucleic acid segment obtained thereby and a detection method thereof.

Background

For a long time, the traditional breeding selection method mainly depends on the evaluation of field phenotype, and selection are carried out according to personal experience of breeders, and the biggest defects of the traditional breeding selection method are long time consumption and low efficiency. To improve the efficiency of selection, it is desirable to select directly from the genotype. With the development of molecular biotechnology, molecular markers offer the possibility of enabling direct selection of genotypes. In recent years, molecular marker assisted selection methods have been applied to improve individual traits of interest, enabling significant reductions in the breeding years.

As the research on the rice blast is advanced, a plurality of rice blast resistance gene DNA fragments are positioned and cloned successively, wherein, a Pi2 interval of a 6 th chromosome of the rice contains a gene cluster of the rice blast resistance genes (Qu et al, genetics.2006,172: 1901-.

Disclosure of Invention

In one aspect, the present application provides rice genomic recombinant nucleic acid fragments comprising or alternatively consisting of:

-a first recombinant nucleic acid fragment selected from the group consisting of: i) a sequence comprising nucleotides 152 to 198 and 1404 to 1428 of the sequence shown in SEQ ID NO. 1 or a fragment thereof or a variant thereof or a complementary sequence thereof; ii) a sequence comprising nucleotides 169 to 1416 of the sequence shown in SEQ ID NO. 1 or a fragment or variant or complement thereof; iii) a sequence comprising nucleotides 152 to 198 and 1404 to 1428 of the sequence shown in SEQ ID NO. 1 or a fragment thereof or a variant thereof or a complementary sequence thereof, and at least one of nucleotides 10 to 31, 117 to 142, 1649 to 1678 and 1908 to 1930 of the sequence shown in SEQ ID NO. 1 or a fragment thereof or a variant thereof or a complementary sequence thereof; or iv) comprises the sequence shown in SEQ ID NO. 1 or a fragment or variant or complement thereof; and/or

-a second recombinant nucleic acid fragment selected from: v) a sequence comprising nucleotides 1095 to 1120 and 1250 to 1273 of the sequence shown in SEQ ID NO. 2 or a fragment thereof or a variant thereof or a complementary sequence thereof; vi) a sequence comprising nucleotides 1106 to 1263 of the sequence shown in SEQ ID NO. 2 or a fragment or variant or complement thereof; vii) a sequence comprising nucleotides 1095 to 1120 and 1250 to 1273 of the sequence shown in SEQ ID NO. 2 or a fragment thereof or a variant thereof or a complementary sequence thereof, and at least one of nucleotides 9 to 32, 174 to 200, 1307 to 1332 and 1500 to 1520 of the sequence shown in SEQ ID NO. 2 or a fragment thereof or a variant thereof or a complementary sequence thereof; or viii) comprises the sequence shown in SEQ ID NO. 2 or a fragment thereof or a variant thereof or the complement thereof.

In one embodiment, the rice genomic recombinant nucleic acid fragment provided herein comprises or consists of a first recombinant nucleic acid fragment selected from any one of i), ii), iii), iv) sequence.

In another embodiment, the rice genomic recombinant nucleic acid fragment provided herein comprises or consists of a second recombinant nucleic acid fragment selected from any one of v), vi), vii), viii) or a sequence selected from any one of v), vi), vii), viii).

In yet another embodiment, the rice genomic recombinant nucleic acid fragments provided herein comprise or consist of a combination of a first recombinant nucleic acid fragment selected from any one of sequences i), ii), iii), iv) and a second recombinant nucleic acid fragment selected from any one of sequences v), vi), vii), viii).

Further, the present application provides a primer for detecting the recombinant nucleic acid fragment, wherein the primer comprises:

-a primer for detecting the first recombined nucleic acid fragment, selected from the group consisting of: (I) a primer that specifically recognizes a sequence of nucleotides 152 to 198 of the sequence shown in SEQ ID NO. 1, and a primer that specifically recognizes a sequence of nucleotides 1404 to 1428 of the sequence shown in SEQ ID NO. 1; (II) a primer that specifically recognizes a sequence of nucleotides 169 to 1416 of the sequence shown in SEQ ID NO. 1; (III) a primer that specifically recognizes a sequence of nucleotides 152 to 198 of the sequence shown in SEQ ID NO. 1, a primer that specifically recognizes a sequence of nucleotides 1404 to 1428 of the sequence shown in SEQ ID NO. 1, and a primer that specifically recognizes at least one of nucleotides 10 to 31, nucleotides 117 to 142, nucleotides 1649 to 1678, and nucleotides 1908 to 1930 of the sequence shown in SEQ ID NO. 1; or (IV) a primer which specifically recognizes the sequence shown in SEQ ID NO. 1; and/or the presence of a gas in the gas,

-a primer for detecting the second recombinant nucleic acid fragment selected from the group consisting of: (V) a primer that specifically recognizes a sequence of nucleotides 1095 to 1120 of the sequence shown in SEQ ID NO. 2, and a primer that specifically recognizes a sequence of nucleotides 1250 to 1273 of the sequence shown in SEQ ID NO. 2; (VI) a primer that specifically recognizes the sequence 1106 to 1263 nucleotides of the sequence shown in SEQ ID NO. 2; (VII) a primer that specifically recognizes a sequence of nucleotides 1095 to 1120 of the sequence shown in SEQ ID NO:2, a primer that specifically recognizes a sequence of nucleotides 1250 to 1273 of the sequence shown in SEQ ID NO:2, and a primer that specifically recognizes at least one of nucleotides 9 to 32, nucleotides 174 to 200, nucleotides 1307 to 1332, and nucleotides 1500 to 1520 of the sequence shown in SEQ ID NO: 2; or (VIII) a primer which specifically recognizes the sequence shown in SEQ ID NO. 2.

In one embodiment, the primer pairs used to amplify the first recombinant nucleic acid fragment, e.g., the primer pairs used to amplify the sequence set forth in SEQ ID NO. 1, are, e.g., 5'-AGAGTTATTGGCACCAGCACATAC-3', and 5'-TTGGGCAAGTTATGTGGGGTAAGA-3'; and primers for sequencing the first recombinant nucleic acid fragment, e.g., primers for sequencing the sequences shown at positions 10 to 31, 117 to 142, and 152 to 198 of SEQ ID NO. 1 are, e.g., 5'-TTTCCCTAAACGCAAACTG-3'; the primers used for sequencing the sequence shown in positions 1404 to 1428 of SEQ ID NO. 1 are, for example, 5'-GAAAGGATCGAGGTTCCAC-3'; the primers used for sequencing the sequences shown at positions 1649 to 1678 and positions 1908 to 1930 of SEQ ID NO. 1 are, for example, 5'-TTGGGCAAGTTATGTGGGGTAAGA-3'.

In another embodiment, the primer pairs for amplifying the second recombinant nucleic acid fragment, the primer pairs for amplifying the sequences set forth in SEQ ID NO. 2 are, for example, 5'-TCGGCTGTGAATCTATGATGTCTT-3', and 5'-AACCACCCTGCTCCTACGTCTTCT-3'. The primers used for sequencing the second recombinant nucleic acid fragment, for example, the primers used for sequencing the sequences shown in positions 9-32 and 174-200 of SEQ ID NO:2 are, for example, 5'-CGAAGCCTATTCCGTTAAA-3'; and primers for sequencing the sequences shown at positions 1095 to 1120, 1250 to 1273, 1307 to 1332 and 1500 to 1520 of SEQ ID NO 2 are, for example, 5'-GGTATGAATCCTGTCTCCC-3'.

In another aspect, the present application provides a method of breeding a rice plant comprising the recombinant nucleic acid fragment, wherein the recombinant nucleic acid fragment has a rice blast resistance function, and the method comprises the steps of: 1) hybridizing recurrent parent rice 'empty breeding 131' with donor rice 'Valsa 4', backcrossing the obtained hybrid with recurrent parent to obtain backcross first generation, screening single-side homologous recombination fragments of rice blast resistance genome fragments by using a positive selection marker Pi2-4 and negative selection markers Pi2S27 and RM7311, and performing background selection by using a rice whole genome breeding chip; 2) selecting a recombinant single plant with better background reversion and recurrent parents for backcross again to obtain a second backcross generation, detecting the second backcross generation by using a forward selection marker Pi2-4, selecting the recombinant single plant containing a rice blast resistant genome segment, and then selecting the background of the recombinant single plant by using a rice whole genome breeding chip; 3) selecting a recombinant single plant with a restored background and recurrent parents for backcross again to obtain three backcross generations, screening homologous recombination fragments on the other side of the rice blast resistant genome fragment by using a positive selection marker Pi2-4 and negative selection markers Pi2S27 and RM7311, and selecting the background of the recombinant single plant by using a rice whole genome breeding chip; and 4) selecting a recombinant single plant with small introduced segment and good background recovery, selfing the selected recombinant single plant once to obtain a selfed seed, detecting the selfed seed by using a forward selection marker Pi2-4, and performing background selection on the selfed seed by using a rice whole genome breeding chip to finally obtain a rice plant containing the homozygous genome recombinant nucleic acid segment and with the background recovery.

In one embodiment, the amplification primers used in the foreground selection of recombinant plants using molecular markers include a primer pair for amplifying the molecular marker Pi2-4, wherein the forward primer is 5'-CGGTAAGAGTAACACCAAGC-3' and the reverse primer is 5'-GACGTGCGAGTTGTGACAGCT-3'; a primer pair for amplifying the molecular marker Pi2S27, wherein the forward primer is 5'-CGATACAAAGGATGGACGTG-3' and the reverse primer is 5'-TACCTCTCTGTGCGATTTGC-3'; and a primer pair for amplifying the molecular marker RM7311, wherein the forward primer is 5'-CTAGTTTATGCCCTCGTTTCTTGC-3', and the reverse primer is 5'-ATGGAAGTGGTCGTTGAACTCG-3'.

In another aspect, the present application provides a method for detecting the recombinant nucleic acid fragment, which comprises the steps of performing a PCR reaction using the primer provided herein and the genome to be detected as a template, and analyzing the PCR product. Specifically, the method takes the genome DNA of a sample to be detected as a template, utilizes the amplification primer to carry out PCR amplification, then utilizes the sequencing primer to sequence the obtained amplification product, and if the sequencing result is consistent with or complementary to the sequence shown in SEQ ID NO. 1 and/or 2 or the segment thereof, the sample to be detected contains the homologous recombination nucleic acid segment of the sequence shown in SEQ ID NO. 1 or 2.

The recombinant nucleic acid fragment containing the sequence shown by SEQ ID NO. 1 and/or SEQ ID NO. 2 or the segment thereof in the sample to be detected is determined through detection, so that the recombinant nucleic acid fragment with the rice blast resistance function in the sample to be detected can be determined.

In addition, the present application also provides a kit for detecting a recombinant nucleic acid fragment, which comprises the primer as described above.

Further, the present application also provides a method for screening rice plants or seeds containing the recombinant nucleic acid fragment, which comprises the step of detecting whether the genome of the rice plant to be detected contains the recombinant nucleic acid fragment as described above.

In one embodiment, the primers described above are used to detect whether the genome of the rice plant to be tested contains the recombinant nucleic acid fragment as described above. In another embodiment, the method for detecting the recombinant nucleic acid fragment as described above is used to detect whether the genome of the rice plant to be detected contains the recombinant nucleic acid fragment as described above. In yet another embodiment, the kit as described above is used to detect whether the genome of the rice plant to be tested contains the recombinant nucleic acid fragment as described above.

In yet another aspect, the present application provides rice plants or seeds thereof selected by the methods comprising the recombinant nucleic acid fragments disclosed herein.

The method for breeding the rice plant containing the rice blast resistant genome recombinant nucleic acid segment based on the whole genome selective breeding technology has the advantages of rapidness, accuracy and stability. Only through the transformation of five generations, only the target genome segment can be introduced into the acceptor material, and the reversion of the background can be realized at the same time. The improved receptor material is 'air-cultivated 131', is a variety with the largest planting area in nearly 10 years in Heilongjiang province, has excellent cold resistance, high yield and appearance rice quality, but has poor rice blast resistance and large planting risk. By using the method, the rice blast resistance can be greatly improved under the condition of keeping the original advantages of 'air breeding 131'. Meanwhile, the recombinant nucleic acid fragment provided by the application is closely related to rice blast resistance, and can be used as a resistance resource to be applied to cultivation of other varieties.

Drawings

FIG. 1 shows the results of the CR012070 RICE RICE60K whole genome breeding chip test in example 1 of the present application; wherein, the boxes indicated by the abscissa number sequentially represent 12 rice chromosomes, the ordinate number is the physical position [ in megabases (Mb) ] on the rice genome, the gray line represents the recipient parent 'empty breeding 131' genotype, the black line represents the donor parent 'flos mume 4' genotype, and the white line represents the same genotype of the two parents, i.e. no polymorphism segment. The black dots of chromosome 6 show the sections indicated by the lines, namely the introduced rice blast resistant genomic recombinant nucleic acid fragment RecCR 012070.

FIG. 2 shows the results of indoor identification of resistance to CR012070 blast in example 3 of the present application; the blades shown in the figure are in the order: (A) the rice blast susceptible variety Lijiang Xinjiang black rice; (B) original variety 'air breeding 131'; (C) improved new strain CR 012070; (D) no. 4 of rice blast disease-resistant variety of flos Pruni mume.

Detailed Description

The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be understood in accordance with their ordinary usage by those of ordinary skill in the relevant art.

As used herein, "nucleotide sequence" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, nucleotide sequences are written in the 5 'to 3' direction from left to right, and include known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides.

In some embodiments, changes may be made to the nucleotide sequences of the present application to make conservative amino acid substitutions. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made according to monocot codon preferences, e.g., codons encoding the same amino acid sequence can be substituted with monocot preferred codons without altering the amino acid sequence encoded by the nucleotide sequence.

In particular, the application relates to further optimization of the resulting nucleotide sequence for SEQ ID NO 1 or 2. More details of this method are described in Murray et al (1989) Nucleic Acids Res.17: 477-498. The optimized nucleotide sequence can be used for improving the expression of the rice blast resistant genome recombinant nucleic acid segment in rice.

In some embodiments, the present application relates to variants of the sequences shown in SEQ ID NO 1 or 2 or segments thereof. Generally, a variant of a particular nucleotide sequence will have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more sequence identity, or the complement thereof, to the particular nucleotide sequence. Such variant sequences include additions, deletions or substitutions of one or more nucleic acid residues, which may result in the addition, removal or substitution of the corresponding amino acid residue. Sequence identity is determined by sequence alignment programs known in the art, including hybridization techniques. Nucleotide sequence variants of the embodiments may differ from the sequences of the present application by as little as 1-15 nucleotides, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2, or even 1 nucleotide.

The application also relates to a sequence comprising a specific position in the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2 or a fragment thereof or a variant thereof or a complementary sequence thereof, for example, a sequence comprising nucleotides 152 to 198 and 1404 to 1428 of the sequence shown in SEQ ID NO. 1 or a fragment thereof or a variant thereof or a complementary sequence thereof (border SNP/Indel sites comprising upstream homologous recombination segments); a sequence comprising nucleotides 169 to 1416 of the sequence shown in SEQ ID NO. 1 or a fragment or variant or complement thereof (comprising an upstream homologous recombination segment and its border SNP/Indel site); a sequence comprising nucleotides 152 to 198 and 1404 to 1428 of the sequence shown in SEQ ID No. 1 or a fragment or variant or complement thereof, and any one or more of: 1 or a fragment thereof or a variant thereof or a complement thereof (comprising the border SNP/Indel site of the upstream homologous recombination region, and the SNP/Indel site derived from the acceptor fragment and/or the donor fragment, respectively). Or a sequence comprising nucleotides 1095 to 1120 and 1250 to 1273 of the sequence shown in SEQ ID NO. 2 or a fragment thereof or a variant thereof or a complementary sequence thereof (border SNP/Indel site comprising a downstream homologous recombination region); a sequence comprising nucleotides 1106 to 1263 of the sequence shown in SEQ ID NO. 2 or a fragment or variant thereof or the complement thereof (comprising the downstream homologous recombination segment and its border SNP/Indel site); a sequence comprising nucleotides 1095 to 1120 and 1250 to 1273 of the sequence depicted in SEQ ID No. 2 or a fragment or variant or complement thereof, and any one or more of: 2 or a fragment or variant thereof or the complement thereof (comprising the border SNP/Indel sites of the downstream homologous recombination region and the SNP/Indel sites derived from the donor fragment and/or the acceptor fragment, respectively). .

Based on the fragment or segment containing the specific site, the corresponding sequence shown in SEQ ID NO. 1 and/or SEQ ID NO. 2 can be specifically identified. Furthermore, the recombinant nucleic acid fragment having the rice blast resistance function contained in the sample to be tested can be determined by identifying the recombinant nucleic acid fragment containing the sequence shown in SEQ ID NO. 1 and/or SEQ ID NO. 2.

As used herein, "rice" is any rice plant and includes all plant varieties that can be bred with rice. As used herein, "plant" or "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like.

The method can be applied to any rice variety needing breeding. That is, any elite variety lacking a favorable trait (i.e., a variety having a good comprehensive trait and expected to have a future development) can be used as a recurrent parent. Another variety having the advantageous trait lacking in the recipient is used as the donor parent and the advantageous trait provided is preferably dominantly monogenically controlled. In the embodiment of the present application, rice 'air-bred 131' was used as the recurrent parent, and rice 'oryza sativa No. 4' that has been confirmed to have good rice blast resistance was used as the donor.

In the breeding method of the recombinant plant provided by the application, the molecular marker is used for carrying out prospect selection on the recombinant plant. The reliability of the foreground selection mainly depends on the closeness degree of linkage between the markers and the target gene, and in order to improve the accuracy of selection, the target gene is generally tracked and selected by two adjacent markers on two sides at the same time.

In embodiments of the present application, the foreground selection markers employed include positive selection markers and negative selection markers. In a specific embodiment, the positive foreground selection marker used in the optimized screen is marker Pi2-4 that is closely linked to the genomic fragment of interest, the negative selection marker is marker Pi2S27 that is upstream of the fragment of interest, and marker RM7311 that is downstream of the fragment of interest.

In the present embodiment, when the detection of homologous recombination is carried out using the above-mentioned foreground selection marker, the criteria for judging one-sided or one-sided homologous recombination are that Pi2-4 detects the same band pattern as that of ` Valley plum No. 4 ` and Pi2S27 or RM7311 detects the same band pattern as that of ` null-bred 131 `; the criteria for judging bilateral or bilateral homologous recombination were that Pi2-4 detected the same band pattern as ` Valley plum No. 4 ` and Pi2S27 and RM7311 detected the same band pattern as ` sterile 131 `.

In the present application, any available chip can be used for background selection in the breeding method provided in the present application. In a preferred embodiment, the RICE whole genome breeding chip RICE6K disclosed in the present applicant's Chinese patent application CN102747138A, or the RICE whole genome breeding chip RICE60K disclosed in PCT international application WO/2014/121419, can be used. The entire contents of both of these applications are incorporated herein by reference in their entirety.

The following examples are for the purpose of illustration only and are not intended to limit the scope of the present application. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the molecular cloning Manual, Sambrook et al (Sambrook J & Russell DW, molecular cloning: a laboratory Manual,2001), or the conditions suggested by the manufacturer's instructions.

The rice plant material information used in the application can be seen in Chinese rice varieties and pedigree databases thereof (http:// www.ricedata.cn/variety/index. htm).

The physical location of the rice genome referred to in this application is referred to the rice Nipponbare genome MSU/TIGR annotation, version 6.1 (http:// rice plant. MSU. edu /).

Example 1Breeding recombinant plants introduced with rice blast resistant genome fragments

The materials used in this example were rice 'air-bred 131' and rice 'oryzanol No. 4'.

The rice of 'oryzanol 4' has good rice blast resistance, and it is presumed that the Pi2 interval of chromosome 6 plays a key role in the resistance of the material to rice blast.

In the process of breeding recombinant plants, selecting the foreground of the recombinant plants by using molecular markers, screening the adopted foreground selection molecular markers, referring to the rice Nipponbare genome MSU/TIGR annotation version 6.1, downloading DNA sequences of chromosome 69,559,000 to 10,990,000, scanning SSR loci in the sequences by using SSR L activator software, designing primers for the searched SSR loci by using Primer Premier 3.0 software, designing Primer pairs 162 together, screening polymorphisms of the Primer pairs in 'Valley plum No. 4' and 'empty breeding 131' by using a PCR method, and finally selecting the foreground selection molecular markers with polymorphism and high amplification efficiency in two materials, namely a forward selection marker Pi2-4, a negative selection marker Pi2S27 and an RM7311, wherein specific Primer information for PCR amplification of the molecular markers is shown in Table 1.

TABLE 1 Foreground selection of molecular marker primer information

The genome segment of the gene in the rice 'oryzanol No. 4' is introduced into the rice 'air-bred 131', and the specific process is as follows:

to' emptyBreeding 131' as recurrent parent, ' flos Pruni mume No. 4 ' as donor parent, hybridizing, backcrossing the obtained hybrid with recurrent parent ' empty breeding 131', obtaining BC₁F₁After seed breeding, recombinant individual selection was carried out using a positive selection marker Pi2-4 and negative selection markers Pi2S27 and RM7311, 2 individuals which were homologously recombined on the target genomic DNA fragment side, namely Pi2-4 detected the same band type as ` Valley 4 ` and Pi2S27 or RM7311 detected the same band type as ` No. 131 ` were selected, and they were background selected using a RICE whole genome breeding chip RICE6K (CN102747138A) (Yu et al, plant Biotechnology journal.2014,12: 28-37).

Comparing the chip results in the 2 screened unilateral homologous recombinant individuals, selecting the recombinant individual with the best background recovery (the background recovery value of the generation exceeds 75%), and carrying out backcross again on the recombinant individual and the recurrent parent 'air-bred 131' to obtain BC₂F₁After the seeds are raised, the positive selection marker Pi2-4 is used for detecting the seeds, recombinant individuals containing target genome fragments are selected, namely Pi2-4 detects the same band type as the No. 4 oryzanol, and the RICE whole genome breeding chip RICE6K is used for carrying out background selection on the recombinant individuals.

Selecting single plants with better background recovery (the background recovery value of the generation exceeds 87.5 percent), and carrying out backcross again with the recurrent parent 'empty breeding 131' to obtain BC₃F₁And (3) screening homologous recombination fragments on the other side of the target genome fragment from harvested seeds by using a positive selection marker Pi2-4 and negative selection markers Pi2S27 and RM7311 after seedling culture to obtain 5 individuals recombined on both sides of the target fragment, namely Pi2-4 detects the same band type as the No. 4 'of flos Pruni mume, and Pi2S27 and RM7311 detect the same band type as the No. 131' of the empty culture.

The 5 double-sided cross-over individuals were subjected to background and target fragment selection using a RICE whole genome breeding chip RICE60K (WO/2014/121419) (Chen et al, Molecular plant 2014,7: 541) 553, and one target individual with a smaller introduced target fragment and a good background was selected (the generation background recovery value was more than 93.75%).

Selfing the selected single plant once to obtain BC₃F₂After seedling raising, the positive selection marker Pi2-4 was used to detect it, and the individual plant containing the target genome fragment, i.e., Pi2-4, was selected to detect the same banding pattern as that of "Valley 4", and was background-selected using the RICE whole genome breeding chip RICE 60K.

Finally, one strain which is homozygous for the target fragment and has a background reversion (the background reversion value exceeds 99%) is obtained and named as CR 012070. The chip detection results are shown in FIG. 1.

Example 2Determination of homologous recombination fragments after introduction of Rice blast-resistant genomic fragment

To determine the size of the introduced rice blast resistant genomic fragment, a single strain homozygous for the ` null-bred 131 ` introduced fragment was subjected to sequencing of homologous recombination fragments flanking the genomic fragment of interest. The rice blast resistant genome recombinant nucleic acid fragment contained in CR012070 is named RecCR 012070.

The result of the RICE whole genome breeding chip RICE60K test preliminarily confirms that the upstream homologous recombination fragment of RecCR012070 is positioned between the markers R0610355182TC and F0610359688TC, and the downstream homologous recombination fragment is positioned between the markers R0610435056GA and R0610486650 CT.

Meanwhile, Miseq sequencing technology is used for carrying out whole genome sequencing on three samples of 'air-borne 131', 'flos mume No. 4' and CR012070, TruSeq Nano DNA L T Kit (illumina) is used for library establishment, L ibrary quantification Kit-universal (KAPA biosystems) is used for quantification, Miseq V2Reagent Kit (illumina) is used for sequencing reaction, a Miseq desk sequencer (illumina) is used for detection, and the specific steps and the method are shown in each Kit and a sequencer application instruction.

According to the SNP chip and the Miseq sequencing result, the upstream homologous recombination fragment of RecCR012070 is further determined to be in the interval of 10353729bp to 10360114bp on the 6 th chromosome, and the downstream homologous recombination fragment is positioned in the interval of 10435873bp to 10441344bp on the 6 th chromosome.

On the basis, the DNA sequences of the corresponding segments were downloaded with reference to the rice Nipponbare genome MSU/TIGR annotation, version 6.1. Amplification and sequencing primers were designed using Primer Premier 5.0 software, with the design requirements being around 22nt Primer length, 40-60% GC content and no mismatches.

By taking the acceptor parent 'empty breeding 131' and the donor parent 'flos mume No. 4' as controls, amplification primers are designed for homologous recombination fragments on the upstream and the downstream of RecCR012070, high fidelity enzyme KOD FXneo (TOYOBO) is used for amplification, and a two-step method or a three-step method is used for searching for the optimal amplification condition to ensure that an amplification product is displayed as a single bright band in agarose gel electrophoresis detection. Screening 1 pair of primers for amplifying the upstream homologous recombination fragment, wherein the reaction conditions are as follows: 94 ℃ for 2 min; 98 ℃ 10sec, 68 ℃ 210sec, 37 cycles; 1min at 20 ℃; 94 ℃ for 2 min. Screening 1 pair of primers for amplifying downstream homologous recombination fragments, wherein the reaction conditions are as follows: 94 ℃ for 2 min; 10sec at 98 ℃, 300sec at 68 ℃ for 37 cycles; 1min at 20 ℃; 94 ℃ for 2 min.

In addition, the amplification product is used as a template, sequencing is carried out by a Sanger sequencing method, 12 sequencing primers are designed for the upstream homologous recombination fragment, and 3 sequencing primers are selected for SNP or Indel sites according to the actual sequencing effect. 26 sequencing primers are designed for the downstream homologous recombination fragments, and 2 sequencing primers are selected for SNP or Indel sites according to the actual sequencing effect. Specific amplification primer and sequencing primer sequences are shown in Table 2.

TABLE 2 amplification and sequencing primer information for recombinant nucleic acid fragments of rice blast resistant genomes

The sequencing length of the upstream homologous recombination fragment of RecCR012070 is 1943bp (SEQ ID NO: 1). 1-176bp is the genome segment of the acceptor 'empty breeding 131', and compared with the donor 'Valsa No. 4', 2 SNPs and 2 indels exist. 177-1415bp of this 1239bp segment is a homologous recombination segment. 1416-1943bp are donor genome fragments of 'flos Pruni mume No. 4', and compared with acceptor 'empty breeding 131', 3 SNPs exist.

The sequencing length of the homologous recombination fragment at the downstream of RecCR012070 is 1525bp (SEQ ID NO: 2). 1-1106bp is the genome segment of donor 'Valsa No. 4', and compared with acceptor 'sterile 131', 2 SNPs and 1 Indel exist. The 156bp segment of 1107-1262bp is a homologous recombination segment. 1263-1525bp is the acceptor 'null-bred 131' genome fragment, and compared with the donor 'Valley No. 4', 2 SNPs and 1 Indel exist.

The differences in the CR012070, ` NULL 131 `, and ` Valencia 4 ` SNPs or Indel sites are shown in Table 3. The "positions" in the table are: the position of the upstream homologous recombination fragment SNP or Indel site difference is relative to the position of SEQ ID NO:1, the position of the downstream homologous recombination fragment SNP or Indel site difference relative to the position of SEQ ID NO:2, the preparation method comprises the following steps.

TABLE 3 CR012070, ` NULL 131 `, and ` Glucona 4 ` SNP or Indel site differences

Example 3Identification of resistance after introduction of ` empty-breeding 131 ` -into Rice blast-resistant genomic fragment

In order to identify the resistance effect, the new strain CR012070 bred by the method, a recurrent parent 'empty breeding 131', a rice blast disease-resistant variety of flos Pruni mume No. 4 (as a positive control) and a rice blast susceptible variety of Lijiang new group black valley (as a negative control) are planted indoors, and the new strain is cultured to 3-4 leaves and then identified by the following method:

selecting a 14-7322-1 rice blast strain separated from Heilongjiang in 2014 as an inoculation strain, preserving the strain at-20 ℃ by adopting a sorghum grain method, taking preserved sorghum grains out before use, activating a potato glucose culture medium (PDA) flat plate (PDA: 200g of peeled potatoes, 20g of glucose, 15g of agar powder and distilled water to reach a constant volume of 1L), culturing for 5 days at 28 ℃ by illumination, taking fresh mycelium blocks with the diameter of 5mm, transferring the mycelium blocks into a sorghum grain culture medium (500 g of sorghum grains are added with 1.5L distilled water, boiling to boil, filtering out liquid, taking out the sorghum grains, filling the sorghum grains into a 250ml triangular flask, 100 ml/flask, performing moist heat sterilization for 20 minutes), shaking the sorghum grains for 10 bottles 2 days after inoculation, culturing in darkness at 28 ℃ until the sorghum grains grow to full, spreading the sorghum grains on sterile gauze, covering the gauze without coveringCulturing in wet gauze at 25 deg.C with RH not less than 95% for 12 hr until a large amount of spores are produced, washing the spores with sterile water (containing 0.02% Tween 20), and adjusting concentration to 5 × 10⁵One per ml.

The conidia suspension was spray inoculated with CR012070, 'air-bred 131', oryzanol 4, and lijiang new-ball black grain, three replicates were inoculated. After inoculation, the cells were covered with a transparent hood, incubated at 28 ℃ in the dark for 24 hours, then incubated under light for 16 hours for 5 days, and investigated.

Survey criteria were grade 0 (high resistance, HR): no symptoms; grade 1 (anti, R): very small brown lesions; grade 2 (medium, MR): brown lesions with a diameter of about 1 mm; grade 3 (MS, in feeling): directly taking 2-3mm round scab with gray center and brown edge; grade 4 (feeling, S): oval lesion spots about 1-3cm long, gray-white in the center, brown at the edge; grade 5 (high, HS): the long and wide large oval lesion spots are fused into pieces until the leaves die. Wherein the disease is resistant in 0-2 grade, and susceptible in 3-5 grade. The results of the inoculation are shown in Table 4 and FIG. 2.

TABLE 4 resistance Performance after inoculation with Pyricularia oryzae

Although the present application has been described in detail with respect to the general description and specific embodiments, it will be apparent to those skilled in the art that certain modifications or improvements may be made based on the present application. Accordingly, such modifications and improvements are intended to be within the scope of this invention as claimed.

Sequence listing

<110> China seed group Co., Ltd

<120> rice genome recombinant nucleic acid fragment RecCR012070 and detection method thereof

<160>16

<170>PatentIn version 3.5

<210>1

<211>1943

<212>DNA

<213> Rice (Oryza sativa)

<220>

<221> derived from the ` empty-bred 131 ` genome segment

<222>(1)..(176)

<220>

<221> homologous recombination segment

<222>(177)..(1415)

<220>

<221> derived from the ` Valley 4 ` genome segment

<222>(1416)..(1943)

<400>1

cctctctctc tctctctctc tctcgctggg gtttctaatc tgagaggagg aggagcgcct 60

tgtctttttg gctctcgctg tttcgaaaat tggtgaggag gagagaggcg gagagctcgt 120

gagcggaatg ccccggttcg ggatcgggtt tgggtctctc tctctctccc tctctctctt 180

ctctctctcc tgctgctacc gtttggaagt catcatgcgt cgggcacggc gccgcgtgtt 240

ccgcgggttg ttctccgggg gttgtggctg acgcgtgggg ccaggaggag gggcgggccc 300

gcgtgtcggt gggggggacg gtgagggggt tctcgggtgg gtttaggagt ttttttagga 360

cagcgttttt tgttttttat tttggtttgg tttgggcctg cggggtggga tactgggatg 420

ggagagagat gcgtgcgacg atggggcggt ggattcgggg ttaaactgaa gtgccggagt 480

gcagtttgcg tttagggaaa tccggtgatc tacggtgtgt gagtgctgag tacagtacta 540

ctagtttttc cctccacttt gtattacggt gttcaaaaat agttgttttt ttttgccaat 600

tatgtcctta ttaggaatgt taattcgcgc acgtgttatt tatcacatgg attctaataa 660

acctagggtt tatcgggaca tgtacgagca gcgtcactgc ggcccaagtg gtcgagcctc 720

gaaaggatcg aggttccaca gtgggcgtgg gatggagggg gcaactagcg gaagagagaa 780

gtgggagtgt gcttagaggg atggtctgag aagcgcccga ccgacggtca atggtggtga 840

cggcgaggca gggggtggcg cccactagcc atgggttggg agagggcggt ggagtggggt 900

cggcggtggg agaaacaagt gtcaaccagt taggttgggt gcgcgcggag gacagcagca 960

agcaggtatt actcagtcaa aaaaaagaca aactctagct acgaatatgg acacgtatgt 1020

gtctagattc gtaattagga tttgaccttt tttagacgga ggaggtaggc tacaacaatg 1080

gtgtgcaaat gcgggagata ggagtggcat cttagaggag attgagtggg agaggataag 1140

gcggagaggg aaatgagccg tgggccagca tagggtgggt cgtgtatgca tactagcctt 1200

cccctgcctc attggttaag gtatgactta taagccaaga aaaacaaagg aagcaaaacg 1260

atatcctatt ctaaaataat aaaatgttct tagctgtcca ggagctaaag ctaaaaacaa 1320

tagaaaaacc aacatcaaat ctgaataccc tcttgagcgg ttgtcggttt tcacaataat 1380

aggcttgaaa caaggaaaac tttggatatt tttctaaaaa ttaaaaatta tgtttgaatt 1440

tcttgaattt ggtggtatat atgctaagcg gttccttagt tgttaacttc cttgagatgg 1500

cccataatta ctataatcaa atggttatgt cgacttttgg aaccttgttt cacaaagatt 1560

aacataattg aatgattttt acaaatatgc atgtgccagt tggagaaacc cgagactact 1620

agtgtggaag tgcctactgg catctttttt aaaaaaaaat ttttgaggtt tcaagtaaaa 1680

aattttcttg gttcatgtag aaagttagga ttttaatttg aagttgtaga gttttgagtt 1740

gaaagttagt ggacctccca taaaactatc tatatatttc aatttaaagt ttgactctaa 1800

tgtagaaaga ttcgagactt gggttgaaag ttcaaggcca caagtaaaaa agtttgaaaa 1860

tctgagtaag aagtatgaaa tctaggtcga agtttatttc atgagttgaa agtttctttt 1920

atttttttcc aaggctatgt gtg 1943

<210>2

<211>1525

<212>DNA

<213> Rice (Oryza sativa)

<220>

<221> derived from the ` Valley 4 ` genome segment

<222>(1)..(1106)

<220>

<221> homologous recombination segment

<222>(1107)..(1262)

<220>

<221> derived from the ` empty-bred 131 ` genome segment

<222>(1263)..(1525)

<400>2

cgctggtggg gaatgccatc acgaaggccg gagaggcagc tgctgcagag ataagcttac 60

tgattggtgt gaacaaggag atctggtagg ttttctttaa ttacttacgc aaacaaaata 120

ttggtttagg aaaacgttaa ccctaaactt tccaaactgg ttattttcaa acacccaccc 180

ccacccccca aaaaaagaaa caaaactcct ggtaccaagt ggtaaaacca ttttaagtga 240

ttattcgaat tgattttcat actttaggtg atagaataaa tttaagccat gtaatgtcct 300

aaaattgtcc tttcattatt aggtttatca aagacgagct gaaaacgatg caagcattcc 360

tgatgacagc tgaagagatg gagaaaaaac ccaggctgtt gaaagcgtgg gtggagcaag 420

taagggattt atcttttgac attgaagatt gcctcgctga gtttatggtt cacgtgggga 480

gcaaaagctt gtcacaacag ttgatgaagc tcaaacatcg ccatcgcatt gccatccaga 540

ttcgtgacct caaatcaaga gttgaagaag tgagcgatag gaattcacgg tactcattaa 600

tcagccctaa cactgatgag catgacacct tgagggatga atttcgctac tggtcagcta 660

agaacattga tgaggctgaa cttgtgggtt ttgatgatgc aaaggaaagt atacttaatt 720

tgatcgatgt ccatgctaac catggtcttg ctaaagtgat ctttgtagtt ggcatgggcg 780

gtctagggaa gacaagtctt gttaaaaagg tttaccatag tattaatatt gttaataatt 840

tctcatgccg tgcttgggtc actgtgtcac agtcatttgt caggacagag ctcctgagag 900

gactaatcaa gcaacttttg ggtggtgatt cggaaaatga acacttcaaa ggtcttcaga 960

gcatgcaaag gaatgagaaa gtggaagacc tcgtggaaga cttgaagcaa ggtctaaaag 1020

agaaaaggta ctttgttgtt ctagatgaca tgtggagcat agatgcattg aattggctta 1080

atgaatctgt ttttcctgac tctaaaaatg gaggaagtcgcataatagta accacgagag 1140

atgccagcat aattcaaaac tgtgcttatc cttcttatct gtaccgcctt gaacccttaa 1200

aaacagatga tgctaaacaa ttgctgctga gaaaatcaaa taaaagttat gaggacataa 1260

aagaggcaag gctgagaagg tgtttgatag gatactagaa agatgtggag gcttaccgct 1320

agctcttgtt gcgataggag ctgtccttcg cacgaaatgc atagaagatt gggaaaaact 1380

gtctctgcag ctatcttcag ggctcaaaac aaagtcaagt cttgaagaaa tgactagagt 1440

aattacactt agttatacac acttgccatc tcatctcaag ccatgttttc tgtaccttag 1500

cattttcccc gaggattttc caata 1525

<210>3

<211>24

<212>DNA

<213> Artificial sequence

<400>3

agagttattg gcaccagcac atac 24

<210>4

<211>24

<212>DNA

<213> Artificial sequence

<400>4

ttgggcaagt tatgtggggt aaga 24

<210>5

<211>19

<212>DNA

<213> Artificial sequence

<400>5

tttccctaaa cgcaaactg 19

<210>6

<211>19

<212>DNA

<213> Artificial sequence

<400>6

gaaaggatcg aggttccac 19

<210>7

<211>24

<212>DNA

<213> Artificial sequence

<400>7

tcggctgtga atctatgatg tctt 24

<210>8

<211>24

<212>DNA

<213> Artificial sequence

<400>8

aaccaccctg ctcctacgtc ttct 24

<210>9

<211>19

<212>DNA

<213> Artificial sequence

<400>9

cgaagcctat tccgttaaa 19

<210>10

<211>19

<212>DNA

<213> Artificial sequence

<400>10

ggtatgaatc ctgtctccc 19

<210>11

<211>20

<212>DNA

<213> Artificial sequence

<400>11

cggtaagagt aacaccaagc 20

<210>12

<211>21

<212>DNA

<213> Artificial sequence

<400>12

gacgtgcgag ttgtgacagc t 21

<210>13

<211>20

<212>DNA

<213> Artificial sequence

<400>13

cgatacaaag gatggacgtg 20

<210>14

<211>20

<212>DNA

<213> Artificial sequence

<400>14

tacctctctg tgcgatttgc 20

<210>15

<211>24

<212>DNA

<213> Artificial sequence

<400>15

ctagtttatg ccctcgtttc ttgc 24

<210>16

<211>22

<212>DNA

<213> Artificial sequence

<400>16

atggaagtgg tcgttgaact cg 22

Claims

1. A rice genome recombinant nucleic acid fragment consisting of a first recombinant nucleic acid fragment and a second recombinant nucleic acid fragment as follows:

-a first recombinant nucleic acid fragment being the sequence shown in SEQ ID No. 1 or the complement thereof; and

a second recombinant nucleic acid fragment which is the sequence shown in SEQ ID NO. 2 or a complementary sequence thereof.

2. A primer set for detecting the recombinant nucleic acid fragment of claim 1, wherein the primer set comprises:

(I) primer pairs for amplifying first recombined nucleic acid fragments

5’-AGAGTTATTGGCACCAGCACATAC-3’，

5'-TTGGGCAAGTTATGTGGGGTAAGA-3', respectively; and

(II) primer pairs for sequencing a first recombinant nucleic acid fragment

5’-TTTCCCTAAACGCAAACTG-3’；

5’-GAAAGGATCGAGGTTCCAC-3’；

5'-TTGGGCAAGTTATGTGGGGTAAGA-3', respectively; and

(III) primer pairs for amplifying second recombinant nucleic acid fragments

5’-TCGGCTGTGAATCTATGATGTCTT-3’，

5'-AACCACCCTGCTCCTACGTCTTCT-3', respectively; and

(IV) primer pairs for sequencing second recombinant nucleic acid fragments

5’-CGAAGCCTATTCCGTTAAA-3’；

5’-GGTATGAATCCTGTCTCCC-3’。

3. A method of breeding a rice plant comprising the recombinant nucleic acid fragment of claim 1, wherein the recombinant nucleic acid fragment has a rice blast resistance function, and the method comprises the steps of:

1) hybridizing recurrent parent rice 'empty breeding 131' with donor rice 'Valsa 4', backcrossing the obtained hybrid with recurrent parent to obtain backcross first generation, screening single-side homologous recombination fragments of rice blast resistance genome fragments by using a positive selection marker Pi2-4 and negative selection markers Pi2S27 and RM7311, and performing background selection by using a rice whole genome breeding chip;

2) selecting a recombinant single plant with better background reversion and recurrent parents for backcross again to obtain a second backcross generation, detecting the second backcross generation by using a forward selection marker Pi2-4, selecting the recombinant single plant containing a rice blast resistant genome segment, and then selecting the background of the recombinant single plant by using a rice whole genome breeding chip;

3) selecting a recombinant single plant with a restored background and recurrent parents for backcross again to obtain three backcross generations, screening homologous recombination fragments on the other side of the rice blast resistant genome fragment by using a positive selection marker Pi2-4 and negative selection markers Pi2S27 and RM7311, and selecting the background of the recombinant single plant by using a rice whole genome breeding chip; and

4) selecting a recombinant single plant with small introduced segment and good background recovery, selfing the selected recombinant single plant once to obtain a selfed seed, detecting the selfed seed by using a forward selection marker Pi2-4, performing background selection on the selfed seed by using a rice whole genome breeding chip to finally obtain a rice plant containing homozygous genome recombinant nucleic acid segments and with background recovery,

wherein the primer pair for amplifying the molecular marker Pi2-4 is as follows:

a forward primer: 5'-CGGTAAGAGTAACACCAAGC-3' the flow of the air in the air conditioner,

reverse primer: 5'-GACGTGCGAGTTGTGACAGCT-3', respectively; the primer pair for amplifying the molecular marker Pi2S27 is as follows:

a forward primer: 5'-CGATACAAAGGATGGACGTG-3' the flow of the air in the air conditioner,

reverse primer: 5'-TACCTCTCTGTGCGATTTGC-3', respectively; and

the primer pair of the amplification molecular marker RM7311 is as follows:

a forward primer: 5'-CTAGTTTATGCCCTCGTTTCTTGC-3' the flow of the air in the air conditioner,

reverse primer: 5'-ATGGAAGTGGTCGTTGAACTCG-3' are provided.

4. A method for detecting the recombinant nucleic acid fragment of claim 1, which comprises the steps of performing a PCR reaction using the primer set of claim 2 and a test genome as a template, and analyzing the PCR product.

5. A kit for detecting the recombinant nucleic acid fragment of claim 1, comprising the primer set of claim 2.

6. A method of screening rice plants or seeds containing the recombinant nucleic acid fragment of claim 1, comprising the step of detecting whether the genome of a test rice plant or seed contains the recombinant nucleic acid fragment of claim 1.

7. The method of claim 6, wherein the detection is performed using the primer set of claim 2, or using the method of claim 4, or using the kit of claim 5.