CN110747231A

CN110747231A - Construction of ribosome inactivating protein gene virus vector and method for expressing active protein in tumor cell

Info

Publication number: CN110747231A
Application number: CN201911035602.XA
Authority: CN
Inventors: 刘梦铃
Original assignee: Chengdu Fudai Biomedical Co Ltd
Current assignee: Chengdu Fudai Biomedical Co Ltd
Priority date: 2019-10-29
Filing date: 2019-10-29
Publication date: 2020-02-04

Abstract

The application belongs to the technical field of biological engineering, and particularly discloses a ribosome inactivating protein gene virus vector construction and a method for expressing active protein in tumor cells, which comprises the following steps of selecting proper ribosome inactivating protein, carrying out codon optimization of humanized expression on mature region genes, constructing wild adenovirus vectors and optimized genes, packaging recombinant viruses, infecting tumor cells by the recombinant adenovirus, and detecting protein expression and anti-tumor effect in the tumor cells.

Description

Construction of ribosome inactivating protein gene virus vector and method for expressing active protein in tumor cell

The technical field is as follows:

the invention belongs to the technical field of bioengineering, and particularly relates to a ribosome inactivating protein gene virus vector construction method and a method for expressing active protein in tumor cells.

Background art:

ribosome Inactivating Proteins (RIPs) are toxic Proteins mainly distributed in plants and have RNA N-glycosidase activity. RIPs have highly conserved active cleft residues and secondary structures in an active site region, and can act on the eukaryotic cell large subunit 28S to inactivate ribosome and inhibit protein biosynthesis, thereby exerting a cytotoxic effect on cells. RIPs are divided into three types, type I RIP is single peptide chain protein with the molecular weight of about 1 l-30 kDa, such as balsam pear ribosome inactivating protein, Trichosanthin (TCS), pokeweed protein (PAP), luffa poison protein (1uffin), saporin and the like, and most ribosome inactivating proteins belong to type I; type II RIP is a dimeric protein, such as ricin, which has not only a toxic polypeptide A chain that inactivates ribosomes, but also a binding polypeptide B chain; type III is less common. RIPs have pharmacological activities of reducing blood sugar, resisting fertility, resisting tumor and virus, treating AIDS and the like, and have wide clinical application prospect.

At present, Lee-Huang et al utilize pRSET expression vector to express MAP30 gene in Escherichia coli, find that non-glycosylated recombinant MAP30 has the same activity as natural MAP30, Arazi T et al (2002) report that recombinant MAP30 protein produced by cucurbitaceae special-purpose virus vector pumpkin yellow mosaic virus (ZYMV-AG1I) vector has antiviral and antitumor activities, national scholars Zhongpeng (2005), Huangqianming (2007), Zhanjinbiao (2010) and the like successfully construct α -MMC and MAP30 expression systems in sequence, and obtain bioactive balsam pear ribosome inactivating protein.

However, neither the ribosome-inactivating protein is expressed in E.coli by using a prokaryotic vector or expressed in a plant virus vector system, nor the ribosome-inactivating protein is expressed in mammalian cells, and thus, it cannot be used for anti-tumor gene therapy.

The invention content is as follows:

in view of the above-mentioned disadvantages, the present invention aims to provide a construction of a ribosome inactivating protein gene viral vector and a method for expressing an active protein in a tumor cell.

In order to achieve the purpose, the basic scheme of the invention is as follows:

a method for constructing a ribosome inactivating protein gene virus vector and expressing active protein in tumor cells by the ribosome inactivating protein gene virus vector comprises the following steps:

selecting proper ribosome inactivating protein, and optimizing humanized codons of the ribosome inactivating protein;

cloning Wild α -MMC gene, namely using plasmid as a template to obtain Wild Type-Type sequence, designing a primer to perform PCR reaction, cloning the gene into a pDC316-mCMV-EGFP adenovirus shuttle vector after enzyme cutting, and performing sequencing verification, (2) performing complete sequence synthesis on the sequence after codon optimization in the step one, (3) respectively inserting the Wild Type and the optimized α -MMC gene into the pDC316-mCMV-EGFP adenovirus shuttle vector, and performing sequencing verification, (4) respectively cotransfecting AdMax293 cells with the shuttle vector and adenovirus skeleton plasmid pBHGlox _ E1 and 3Cre, and performing homologous recombination to obtain the Wild Type recombinant adenovirus and the optimized recombinant adenovirus containing target gene;

and step three, transfecting the recombinant adenovirus obtained in the step two to tumor cells, expressing active protein in the tumor cells, and detecting the anti-tumor effect.

Furthermore, the ribosome inactivating protein obtained in the step one has RNA N-glycosidase activity, namely has highly conserved active cleft residues and secondary structures in an active site region, can act on eukaryotic cell large subunit 28S to inactivate ribosomes, inhibit the biosynthesis of protein, and can generate cytotoxic action on tumor cells to kill tumors.

Further, the ribosome inactivating protein gene may be any one of α -charantin, MAP30, β -charantin, gamma-charantin, delta-charantin, trichosanthin, pokeweed protein, luffa toxin protein, saporin and other type I ribosome inactivating protein and type II ribosome inactivating protein (such as ricin A chain).

Further, the gene of the ribosome inactivating protein is α -charantin gene, including wild type and optimized α -charantin gene.

Furthermore, in the step A, three professional codon Optimization software are used for simultaneously carrying out mammal codon Optimization on the α charantin mature region, namely MaxCodon Optimization Program, DNAworks and synthetic Gene Designer, and the advantages of the software are integrated to obtain an ideal Optimization result, so that the expression quantity and the expression efficiency of the target gene in the mammal cell and the tumor cell are improved.

Further, the adenovirus vector in the second step is a ribosome inactivating protein carrier constructed by any one of adenovirus vectors of a mammalian cell expression system and adenovirus vectors, retrovirus vectors, lentivirus vectors and the like; the scheme uses the adenovirus vector of a mammalian cell expression system, and other vector systems also have the same vector function, so that the ribosome inactivating protein carrier constructed by virus vectors such as adenovirus, adeno-associated virus, retrovirus, lentivirus and the like is also suitable.

The technical effects are as follows:

the proposal takes α -charantin gene as an experimental model to construct a gene expression virus recombinant containing ribosome inactivating protein, wherein the ribosome inactivating protein has RNA N-glycosidase activity and can inactivate the ribosome of tumor cells and inhibit protein synthesis to generate cytotoxic action on the tumor cells.

Compared with the prior art, the method can ensure that the expression quantity and sales of the target protein are higher; the expressed toxicological effect is more obvious, the two recombinant viruses have obvious cytotoxic effects on breast cancer MCF-7 cells and cervical cancer Hela cells, and the optimized effect is more obvious; the two recombinant viruses have obvious inhibition effect on the growth of breast cancer MCF-7 cells and cervical cancer Hela cells.

The ribosome inactivating protein in the scheme has RNA N-glycosidase activity, so the recombinant virus containing the ribosome inactivating protein gene is also suitable for cells of breast cancer, liver cancer, lung cancer, gastric cancer, colon cancer, bladder cancer, choriocarcinoma, cervical cancer, trophoblastic carcinoma and melanoma.

Description of the drawings:

FIG. 1 is a schematic flow chart of the present invention

FIG. 2 is a schematic diagram of analysis of amino acid expression rate before codon optimization of α charantin gene of the present invention;

FIG. 3 is a schematic diagram of analysis of codon preference and amino acid expression rate of α charantin gene after codon optimization;

FIG. 4 adenovirus shuttle vector map;

FIG. 5 is a schematic diagram of optimized sequence shuttle plasmid vector pDC316-MMC-mCMV-EGFP enzyme digestion;

FIG. 6 is a schematic representation of the sequencing validation of the optimized sequence shuttle plasmid vector α Momordicaxin gene;

FIG. 7 is a schematic diagram of the PCR results of the wild type sequence shuttle plasmid vector pDC316-MMCwt-mCMV-EGFP construction;

FIG. 8 is a schematic diagram of the double digestion of pDC316-MMCwt-mCMV-EGFP adenovirus vector and PCR-recovered product;

FIG. 9 is a schematic alignment of the sequencing results of wild type sequence shuttle plasmid vector pDC 316-MMCwt-mCMV-EGFP;

FIG. 10 is a schematic diagram of a two-step QPCR process;

FIG. 11 is a schematic representation of the dissolution curves for wild-type momordicin and the optimized codon momordicin;

FIG. 12 is a fluorescence image of 293T cell transfection;

FIG. 13 is a diagram showing WB detection results;

FIG. 14 is a schematic diagram showing the results of infection of breast cancer MCF-7 and cervical cancer Hela with three viruses, i.e., unloaded adenovirus Adv-mCMV, recombinant adenovirus Adv-MMCwt and recombinant adenovirus Adv-MMC;

FIG. 15 is a graph showing an absorbance value (OD value) curve of MTT-method-detecting cells;

FIG. 16 is a schematic diagram showing the results of cytopathic effect observed 5 days after the recombinant adenovirus infects tumor cells;

FIG. 17 is a schematic diagram showing the effect of inhibiting tumor cell growth by recombinant virus infection.

Brief description of the sequence listing (I) shows the nucleotide sequence of α charantin gene after codon optimization

Detailed Description

The following will clearly and completely describe the technical solutions in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments of the present invention without making any creative effort, shall fall within the protection scope of the present invention.

It should be noted that all the directional indicators (such as up, down, left, right, front, and rear … …) in the embodiment of the present invention are only used to explain the relative position relationship between the components, the motion situation, etc. in a specific posture, if the specific posture is changed, the directional indicator is changed accordingly.

In addition, the descriptions related to "first", "second", etc. in the present invention are for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In addition, technical solutions between various embodiments may be combined with each other, but must be realized by a person skilled in the art, and when the technical solutions are contradictory or cannot be realized, such a combination should not be considered to exist, and is not within the protection scope of the present invention.

Example 1

α charantin gene codon optimization

1 method of experiment

The optimization process follows the following main principles of ① species codon usage preference, ② GC content, ③ CpG dinucleotide content, ④ recessive splice site, ⑤ premature polyA site, ⑥ internal stagnation point and ribosome binding site, ⑦ minus strand CG island, ⑧ RNA unstable motif (ARE), ⑨ repetitive sequence and ① restriction enzyme site, Kozak sequence and SD sequence ARE used for improving mRNA translation efficiency, and TGA stop codon is used for improving translation termination signal.

2 codon optimization results

2.1 analysis of amino acid expression rates before optimization

See fig. 2.

2.2 post-optimization codon preference and amino acid expression Rate analysis

See fig. 3.

2.3 optimized sequences

GCCACC

ATGGACGTGAGCTTCCGCCTGAGCGGCGCCGACCCCCGCAGCTACGGCAT 50

GTTCATCAAGGACCTGCGCAACGCCCTGCCCTTCCGCGAGAAGGTGTACA 100

ACATCCCCCTGCTGCTGCCCAGCGTGAGCGGCGCCGGCCGCTACCTGCTG 150

ATGCACCTGTTCAACTACGACGGCAAGACCATCACCGTGGCCGTGGACGT 200

GACCAACGTGTACATCATGGGCTACCTGGCCGACACCACCAGCTACTTCT 250

TCAACGAGCCCGCCGCCGAGCTGGCCAGCCAGTACGTGTTCCGCGACGCC 300

CGCCGCAAGATCACCCTGCCCTACAGCGGCAACTACGAGCGCCTGCAGAT 350

CGCCGCCGGCAAGCCCCGCGAGAAGATCCCCATCGGCCTGCCCGCCCTGG 400

ACAGCGCCATCAGCACCCTGCTGCACTACGACAGCACCGCCGCCGCCGGC 450

GCCCTGCTGGTGCTGATCCAGACCACCGCCGAGGCCGCCCGCTTCAAGTA 500

CATCGAGCAGCAGATCCAGGAGCGCGCCTACCGCGACGAGGTGCCCAGCC 550

TGGCCACCATCAGCCTGGAGAACAGCTGGAGCGGCCTGAGCAAGCAGATC 600

CAGCTGGCCCAGGGCAACAACGGCATCTTCCGCACCCCCATCGTGCTGGT 650

GGACAACAAGGGCAACCGCGTGCAGATCACCAACGTGACCAGCAAGGTGG 700

TGACCAGCAACATCCAGCTGCTGCTGAACACCCGCAACATCGCCGAGGGC 750

GACAACGGCGACGTGAGCACCACCCACGGCTTCAGCAGCTACTAA (stop codon)

α charantin gene recombinant adenovirus vector construction and recombinant virus packaging

1 principle of experiment

α obtaining charantin Wild-Type sequence, using plasmid as template, designing primer to make PCR reaction, after enzyme digestion, cloning it into pDC316-mCMV-EGFP adenovirus shuttle vector, sequencing and verifying, α after charantin codon optimization, making complete sequence synthesis, then constructing it into pDC316-mCMV-EGFP adenovirus shuttle vector, sequencing and verifying, co-transfecting AdMax293 cell with shuttle vector and adenovirus skeleton plasmid pBHGlox _ E1,3Cre, homologous recombination becoming recombinant adenovirus containing target gene.

2 method of experiment

2.1 adenovirus shuttle vector map

See fig. 4.

2.2 construction of Wild Type (WT) sequence shuttle plasmid vector pDC316-MMCwt-mCMV-EGFP

① according to the mature region sequence of α charantin, designing PCR upstream and downstream primers with restriction enzyme cutting site + protective base, the sequence is as follows:

primer name	Sequence of
		WT-Mature-F	GGAATTCGCCACCATGGATGTTAGCTTTCGTTTGTCG
WT-Mature-R	CGGGATCCTTAGTAGCTCGAAAAGCCAT

② the plasmid DNA is used as a template to carry out PCR amplification, and the reaction system is as follows:

the PCR cycle was as follows:

③ detecting PCR product by running glue, and recovering the glue;

④ recovering PCR product and adenovirus vector pDC316-mCMV-EGFP double enzyme cutting system as follows:

reaction components	Volume (μ L)
		DdH2O	Up to 40
10×Buffer	4.0μL
		NotI	1.0μL
HindIII	1.0μL
		PCR product or pDC316-mCMV-EGFP	30 or 4ug

Enzyme digestion is carried out at 37 ℃ for 1hr, inactivation is carried out at 80 ℃ for 10min, glue running detection is carried out, and a target strip is recovered.

⑤ PCR fragment is connected with pDC316-mCMV-EGFP carrier enzyme cutting fragment, and the system is as follows:

⑥ the ligation product transforms Escherichia coli DH5a competent cells, plates, picks up single clone, and sequence verification, the successfully constructed plasmid is named as pDC 316-MMCwt-mCMV-EGFP.

2.3 construction of optimized post-sequence shuttle plasmid vector pDC316-MMC-mCMV-EGFP

① performing full sequence synthesis according to the optimized sequence;

② NotI and HindIII double enzyme digestion synthesized fragments are connected with pDC 316-mCMV-EGFP;

③ transforming Escherichia coli DH5a competent cells, plating, and selecting single clone;

④ sequencing verification, and the successfully constructed plasmid is named as pDC 316-MMC-mCMV-EGFP.

2.4 packaging the virus to obtain recombinant adenovirus Adv-MMCwt and Adv-MMC

① 293 cells were seeded in six well plates at 5X 10 per well⁵And (4) cells. When the cells grow to 80% -90% of the basal area, respectively taking shuttle plasmids (pDC316-MMCwt-mCMV-EGFP or pDC316-MMC-mCMV-EGFP) and skeleton plasmids pBHGlox _ E1,3Cre, and transfecting the cells by Lipofectamine2000 liposome. Double plasmid cotransfects 293 cells, and homologous recombination generates recombinant adenovirus. The experiment was set up with an empty pDC316-mCMV-EGFP control.

② at 25cm²Culturing 293 cells in a cell bottle, inoculating 500 mu L of the first generation virus seeds on the cells when the cells grow to 90% of full, freezing and thawing the cells for 3 times when the cells are completely diseased, centrifugally collecting virus supernatant, taking 50 mu L of second generation virus seeds supernatant, adding 2 mu L of proteinase K, incubating at 56 ℃, boiling for 10min, cooling in ice bath, taking 1 mu L of second generation virus seeds as a template, and performing polymerase chain reaction identification.

③ the virus is digested by DNase enzyme, filtered by a filter membrane, purified by a column, and preserved in adenovirus preservation solution by using an Adeno-X Virusthroughout Kit, desalted and filtered and sterilized by 0.22 mu m to obtain sterile purified viruses which are named as recombinant adenovirus Adv-MMCwt and Adv-MMC respectively, and the unloaded virus is Adv-mCMV.

3 results of the experiment

3.1 optimized sequence shuttle plasmid vector pDC316-MMC-mCMV-EGFP enzyme digestion and sequencing results

(1) And (3) double enzyme digestion verification:

see fig. 5.

Strip M: KB Ladder

Strip 1: constructed plasmid electrophoresis

Strip 2: the plasmid was electrophoresed after double digestion with NotI & HindIII

(2) Sequencing and verifying:

see fig. 6.

The sequence alignment result is completely correct, and the vector construction is successful.

3.2 wild type sequence shuttle plasmid vector pDC316-MMCwt-mCMV-EGFP construction results

(1) And (3) PCR result:

see fig. 7.

The PCR band size is between 500bp and 750bp, which is the expected size.

(2) pDC316-MMCwt-mCMV-EGFP adenovirus vector and PCR recovery product double enzyme digestion:

see fig. 8.

(3) Sequencing result alignment:

see fig. 9.

Note: the sequencing results were aligned with the MegAlign in the DNAstar software package and were completely correct.

3.3 plasmid transfection and mRNA expression analysis

3.3.1 principle of the experiment

Transfecting human cervical carcinoma Hela cells with a blank control plasmid, a Wild Type charantin recombinant shuttle plasmid pDC316-MMC-mCMV-EGFP and an optimized charantin recombinant shuttle plasmid pDC316-MMC-mCMV-EGFP respectively, collecting the cells 48hr after transfection, extracting total RNA by using a Trizol method, and finally detecting the expression quantity of charantin mRNA by QPCR.

3.3.2 Experimental methods

(1) Cell transfection

Inoculation of 1X 10⁶Hela cells were plated onto six-well plates and cultured overnight with 2ml of complete medium. When the cell confluence rate is 60-80%, 2ml of fresh complete culture medium is replaced for the cells 1-2 h before transfection. 3 sterile 1.5ml centrifuge tubes were prepared and each plasmid and transfection diluent were added separately according to the following amounts:

blank control plasmid/WT charantin plasmid/optimized charantin plasmid	2.0μg
		Transfection diluent	100.0μL

Fully and uniformly mixing, and standing for 5 minutes at room temperature; then adding 6.0 mul of transfection reagent Nanofusion into each centrifuge tube respectively, fully and uniformly mixing, and standing for 15 minutes at room temperature; after standing, the mixture is blown back and forth for 3 times by a 200.0-microliter gun head, and then is evenly added into Hela cells, and after the cross method or the splayed method is fully shaken up, the cells are put back into the incubator for continuous culture.

(2) Total RNA extraction

Fully grinding each sample tissue in liquid nitrogen, transferring to a 1.5ml EP tube, and adding 1ml of RNAioso Plus lysate; shaking on a vortex instrument for 1min, and standing at room temperature for 10 min; adding 1/5 volume of chloroform, shaking on a vortex instrument for 1min, emulsifying sufficiently, and standing at room temperature for 10 min; centrifuging at 13000rpm at 4 ℃ for 15 min; carefully transferring the upper aqueous phase into a precooled 1.5ml EP tube, adding equal volume of isopropanol to precipitate RNA, fully and uniformly mixing, and standing at room temperature for 10 min; centrifuging at 13000rpm at 4 ℃ for 15 min; removing supernatant, washing with 70% ethanol, and drying for 8-10 min; adding appropriate amount of DEPC water to dissolve RNA.

(3) RNA concentration determination (spectrophotometry)

And respectively adding 2 mu L of samples into a trace spectrophotometer, respectively measuring the absorption peak values and the ratio values of 230nm, 260nm and 280nm, and calculating the concentration and the purity of the RNA in each sample.

(4) Reverse transcription of RNA

Preparing a reaction solution (the reaction solution is prepared on ice) according to the following components:

reagent	Amount used (ul)
		5×PrimeScript RT Master Mix(Perfect Real Time)	2.0
Total RNA	200ng
		RNase Free dH₂O	up to 10.0

After gentle and uniform mixing, carrying out reverse transcription reaction under the following conditions:

37℃	15min
		85℃	5s
4℃	∞

(5)QPCR

a. design and synthesis of primers:

primer name	Sequence of
		wtMMC-F	CTCCCAGCGTTGGATAGTGC
wtMMC-R	CCTCCGCAGTGGTCTGAATG
		opMMC-F	TCATCAAGGACCTGAGGAACG
opMMC-R	GATGGTCTTGCCGTCATAGTTG
		ACTB-F	CATGTACGTTGCTATCCAGGC
ACTB-R	CTCCTTAATGTCACGCACGAT

Note: wtMMC: wild-type momordicin; opMMC: codon-optimized charantin

b. Preparing a PCR reaction solution (the reaction solution is prepared on ice) according to the following components:

reagent	Amount of the composition used
		TB Green Premix Ex Taq II(Tli RNaseH Plus)(2×)	10μl
PCR Forward Primer(10μM)	0.8μl
		PCR Reverse Primer(10μM)	0.8μl
ROX Reference DyeI I(50×)	0.4μl
		cDNA solution	2μl
Sterilized water	6μl
		Total	20μl

c. Two-step QPCR procedure:

see fig. 10.

3.3.3 results of the experiment

(1) Concentration and purity of each RNA sample

Sample name	Concentration (ng/. mu.l)	OD260/OD280	OD260/OD230
				Ctr1	177.6	1.86	1.93
wtMMC	165.3	1.89	1.97
				opMMC	160.9	1.93	1.88

(2) Dissolution curve

See fig. 11.

(3) Expression level of momordicin mRNA

The expression level of the wild-type charantin in the cells with the over-expression of the wild-type charantin is 184083 times of that of the control, and the expression level of the optimized charantin in the cells with the over-expression of the optimized codon charantin is 6566379 times of that of the control.

3.4 plasmid transfection and analysis of expression of the protein of interest

3.4.1 principle of the experiment

Transfecting a control blank plasmid, a Wild Type charantin recombinant shuttle plasmid pDC316-MMC-mCMV-EGFP and an optimized charantin recombinant shuttle plasmid pDC316-MMC-mCMV-EGFP respectively to 293T cells of human embryo kidney, carrying out fluorescence photographing for 48h after transfection, then collecting the cells, carrying out concentration determination on the collected proteins after cracking, and finally detecting the expression quantity of the charantin proteins by WB.

3.4.2 Experimental methods

(1) Cell transfection

Inoculation of 1X 10⁶293T cells were plated onto six-well plates and incubated overnight with 2ml of complete medium. When the cell confluence rate is 60-80%, 2ml of fresh complete culture medium is replaced for the cells 1-2 h before transfection. 3 sterile 1.5ml centrifuge tubes were prepared and each plasmid and transfection diluent were added separately according to the following amounts:

blank control plasmid/WT charantin plasmid/optimized charantin plasmid	2.0μg/4.0μg
		Transfection diluent	100.0μL

Fully and uniformly mixing, and standing for 5 minutes at room temperature; then adding 6.0 muL/12 muL of transfection reagent Nanofusion into each centrifuge tube respectively, fully mixing uniformly, and standing for 15 minutes at room temperature; after standing, the mixture is blown back and forth for 3 times by a 200.0 mu L gun head, and then is evenly added into 293T cells, and after the cross method or the splayed method is fully shaken up, the cells are put back into the incubator for continuous culture.

(2) Fluorescence photography of transfected cells

And (4) carrying out fluorescence photographing on the three groups of transfected cells, and observing the expression condition of fluorescence.

(3) Extraction of Total cellular protein

a. After 48h of plasmid transfection, the medium was discarded, washed 1 time with 1XPBS and digested for 2 min with 500. mu.L pancreatin. b. Digestion was stopped by adding 1mL of complete medium, and all cells were blown down with a pipette tip and transferred to an EP tube. c.1000rpm for 5 minutes. d. The supernatant was discarded, washed once with pre-cooled 1XPBS and centrifuged at 1000rpm for 5 minutes. e. The supernatant was discarded and 0.1mL of RIPA lysine buffer containing protease inhibitor was added. f. The cells were blown up thoroughly with a lance tip and then lysed on ice for 30 minutes. g.12000rpm, 4 ℃, after 15min of centrifugation, the supernatant was transferred to a new EP tube for concentration determination.

3.4.3 results of the experiment

(1) Transfection fluorescence map of 293T cells

See fig. 12.

(2) WB detection result

See fig. 13.

Cell fluorescence pictures and WB results show that the expression level of the charantin protein after codon optimization in human 293T cells is obviously higher than that of wild type.

Step three: toxicological effects of recombinant charantin adenoviruses on tumor cells

1 principle of experiment

Respectively infecting human breast cancer MCF-7 cells and human cervical cancer Hela cells with unloaded viruses Adv-mCMV, wild type recombinant adenoviruses Adv-MMCwt and optimized recombinant adenoviruses Adv-MMC, carrying out fluorescence photographing 48 hours after transfection, then transferring the cells into a 96-well plate for MTT cytotoxicity experiments or transferring a small amount of transfected cells into a 10cm cell culture dish for cell cloning and forming experiments, and observing the influence of intracellular expressed charantin on the growth of tumor cells.

2 method of experiment

2.1 expression of the recombinant viruses of momordicin in tumor cells

① cell preparation

Respectively inoculating 1X 10⁶MCF-7 cells or Hela cells were plated on 6-well plates and incubated overnight with 2mL of complete medium. In the thinThe cell confluence rate is 60-80%, and 2mL of fresh complete culture medium is replaced for the cells 1-2 h before transfection.

② infection of cells by viral particles

The unloaded adenovirus Adv-mCMV, recombinant adenovirus Adv-MMCwt and recombinant adenovirus Adv-MMC were inoculated into MCF-7 cells or Hela cell culture plate wells as above, respectively, in a virus infection amount of 1.0ml MOI 10. After the cross method or the splayed method is fully shaken up, the cells are put back into the incubator for continuous culture. After 4 hours, the culture medium was replaced with fresh one and continued to be cultured.

③ the fluorescence of the transfected three groups of cells is photographed to observe the expression of fluorescence.

2.2 toxicological Effect of the recombinant viruses of momordicin on tumor cells

① cell preparation

Respectively inoculating 1X 10⁶MCF-7 cells or Hela cells were plated on 6-well plates and incubated overnight with 2mL of complete medium. When the cell confluence rate is 60-80%, 2mL of fresh complete culture medium is replaced for the cells 1-2 h before transfection.

② infection of cells by viral particles

③, digesting the cells with pancreatin 48 hours after infection, transferring the cells into a 96-well plate for MTT detection, and paving 10000 cells in each well;

④ 12h later, the cells are completely attached to the wall, the first MTT determination is carried out, and 5 multiple wells are detected in each group;

⑤ MTT assays were performed every 12h thereafter for a total of 6 time points, with 5 replicates per set.

⑥ cells were observed morphologically and photographed before the last MTT assay.

2.3 inhibition of the clonogenic potency of tumor cells by the recombinant charantin viruses

① No-load adenovirus Adv-mCMV, recombinant adenovirus Adv-MMCwt and recombinant adenovirus Adv-MMC respectively infect human breast cancer MCF-7 cells and human cervical cancer Hela cells;

② cells were digested with trypsin 48h after transfection, and transferred to a 10cm cell culture dish with 200 cells;

③ after the cells are fully attached, they are cultured continuously for 7d, and the total number of cell clones is observed and counted under a phase contrast microscope.

3 results of the experiment

3.1 expression of Bright fluorescence by recombinant viruses in tumor cells

After the recombinant virus particles infect cells, the virus can proliferate and express fluorescein protein, and green fluorescence is shown. As can be seen from the results of the following figures, the fluorescent light of the codon-optimized Adv-MMC shows bright strong fluorescence in MCF-7 cells of breast cancer regardless of the unloaded adenovirus Adv-mCMV, the recombinant adenovirus Adv-MMCwt or the recombinant adenovirus Adv-MMC. Corresponding non-fluorescent pictures of infected cells also show that cultured cells are sparse compared to empty vector viruses, and the growth state of cells in the Adv-MMC group is poor. The results of infection of cervical cancer Hela by the three viruses were substantially the same, as shown in fig. 14.

See fig. 14.

3.2 the recombinant virus has significant cytotoxic effect on tumor cells

After 24h of infecting the breast cancer MCF-7 cells and the cervical cancer Hela cells by the recombinant viruses, the absorbance value (OD value) of the cells is detected by an MTT method every 12h and is plotted as follows. The experimental result shows that the Adv-MMCwt group and the Adv-MMC group which can express the momordin have stronger cytotoxic effect along with the time of virus infection, the OD value is obviously reduced, and the OD value is obviously different from that of a no-load virus group, wherein the effect of the Adv-MMC in the optimized group is more obvious. The cytotoxic effect of the charantin recombinant adenovirus on MCF-7 and Hela cells is similar, as shown in FIG. 15.

See fig. 15.

Cytopathic effect was observed 5 days after infection of tumor cells with recombinant adenovirus, as shown in FIG. 16. The negative control no-load virus group has good cell state, but the cells of the Adv-MMCwt group and the Adv-MMC group have large shedding and death, the cell layer grows sparsely, the cell morphology is irregular, and the swelling and necrosis are obvious. Among these, the necrosis effect of the optimized virus group is stronger.

See fig. 16.

3.3 infection with recombinant viruses can significantly inhibit tumor cell clonogenic

After 7d, the unloaded adenovirus Adv-mCMV can still form larger flaky island cell clone after being respectively infected with human breast cancer MCF-7 cells and human cervical cancer Hela cells, and the Adv-MMCwt and Adv-MMC infected groups only can have islet cell clone, as shown in FIG. 17.

See fig. 17.

Claims

1. A ribosome inactivating protein gene virus vector construction and a method for expressing active protein in tumor cells are characterized by comprising the following steps:

2. The method for constructing a ribosome inactivating protein gene viral vector according to claim 1 and expressing active protein in tumor cells thereof, wherein the ribosome inactivating protein selected in the step one has RNA N-glycosidase activity, has highly conserved active cleft residues and secondary structures in the active site region, and acts on eukaryotic cell large subunit 28S to inactivate ribosomes and inhibit the biosynthesis of the protein.

3. The method according to claim 2, wherein the ribosome inactivating protein gene selected in the step one is selected from any one of the group consisting of type I ribosome inactivating proteins such as α -charantin, MAP30, β -charantin, γ -charantin, δ -charantin, trichosanthin, pokeweed protein, luffa and saporin, and type II ribosome inactivating proteins such as ricin A chain.

4. The method for constructing a ribosome inactivating protein gene viral vector according to claim 3 and expressing active protein in tumor cells, wherein the gene of ribosome inactivating protein is α -momordicin gene.

5. The method of claim 4, wherein said step A comprises using three specialized codon Optimization software to simultaneously optimize α momordicin mature region, including MaxCodon Optimization Program, DNAworks, Synthetic Gene Designer, and combining the advantages of each software to obtain ideal Optimization results.

6. The method of claim 5, wherein the adenovirus vector in step two is a mammalian cell expression system adenovirus vector, or a ribosome inactivating protein vector constructed from any one of adenovirus, retrovirus, and lentivirus.