CN114507277B - Beet armyworm gene with antiviral effect and application thereof - Google Patents
Beet armyworm gene with antiviral effect and application thereof Download PDFInfo
- Publication number
- CN114507277B CN114507277B CN202210297727.5A CN202210297727A CN114507277B CN 114507277 B CN114507277 B CN 114507277B CN 202210297727 A CN202210297727 A CN 202210297727A CN 114507277 B CN114507277 B CN 114507277B
- Authority
- CN
- China
- Prior art keywords
- gene
- seprr
- asparagus caterpillar
- semnpv
- asparagus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Insects & Arthropods (AREA)
- Toxicology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a asparagus caterpillar gene SePRR-06 with antiviral effect, the amino acid sequence of the coded protein is SEQ ID NO. 1. The invention also provides a method for reducing the resistance of the asparagus caterpillar to the asparagus caterpillar nuclear polyhedrosis virus, which is to reduce the expression quantity of the SePRR-06 gene in the asparagus caterpillar. The invention screens and obtains a gene with antiviral effect from beet armyworm which is an important agricultural pest. The sequence structure and the space-time expression mode of the gene are analyzed, and meanwhile, the incremental expression and RNA interference technology is utilized to prove that the gene has the effect of resisting the asparagus caterpillar nuclear polyhedrosis virus SeMNPV, so that a new target gene is provided for better prevention and control of asparagus caterpillar by utilizing viruses in production, and the gene has obvious pushing effect on interaction research of hosts and viruses.
Description
Technical Field
The invention belongs to the technical field of insect molecular biology, and particularly relates to a asparagus caterpillar gene with an antiviral effect and application thereof.
Background
Beet armyworm is a worldwide pest that can harm more than 90 plants, mainly including beet, cotton, soybean, corn, vegetables, etc. The beet armyworm has high growth speed and strong fertility and is also a long-distance migratory pest. In the last 20 years, beet armyworm outbreaks have been reported in many areas of asia, africa, europe, america, etc.
At present, the prevention and control of the asparagus caterpillar mainly takes chemical prevention and control, but the drug resistance of the asparagus caterpillar is rapidly increased due to the use of a large amount of chemical pesticides, so that the asparagus caterpillar is greatly destroyed in agricultural production and ecological environment, and the prevention and control of the asparagus caterpillar are more and more difficult. With the development of biotechnology, the use of asparagus caterpillar nuclear polyhedrosis virus (SeMNPV) for biological control of asparagus caterpillar has attracted attention. The asparagus caterpillar nuclear polyhedrosis virus (SeMNPV) is a virus with strong host specificity, has strong pathogenicity on asparagus caterpillar, can cause virus disease epidemic in a host, and therefore becomes a biological control preparation with great application prospect.
The SeMNPV infects the asparagus caterpillar and excites the innate immune system of the asparagus caterpillar, thereby weakening the prevention and control effect of viruses on the asparagus caterpillar. Therefore, how the virus destroys the immune system of host insects, and improving the pathogenicity of the virus becomes a current research hot spot, and researchers always want to find out genes affecting the insect to have resistance to the virus, and the control effect is improved by silencing the resistance genes, so that a new molecular target is provided for the control of pests.
Disclosure of Invention
The invention aims to provide a asparagus caterpillar gene with antiviral effect and application thereof, namely a gene which is derived from asparagus caterpillar and has resistance to SenNPV.
The invention firstly provides a beet armyworm gene protein with antiviral effect, the protein is named as SePRR-06, and the SePRR-06 protein comprises:
1) Protein with amino acid sequence of SEQ ID NO. 1
2) Substitution, deletion, addition of one or several amino acids on 1), protein derived from 1);
wherein the sequence of SEQ ID NO. 1 is specifically as follows:
MLYYLVLSCISVCVGAMPTVVVNRVESTENEVHSYNFPFVSRAQWRARDPVKTTPLQTPVPYVVIHHSYIPPACYDREKCCAAMRGMQDFHIDDHGWWDIGYHFAVGSDGAAYEGRGWETLGAHALHFNSVSIGICLIGDWRYEIPPAQQRKTAMALIAAGVELGYIKPDYKLLGHRQVRATECPGDALFNEIKTWDHFSPYPSSHLDLLDIAEIPEWVKDTIRGKNTTIPIPS；
a specific nucleotide sequence of the gene encoding the protein is as follows:
atgctatattatttggtgttatcctgtatttccgtgtgtgtcggggctatgcctaccgtcgtggttaatcgtgtggaatctacagagaatgaggtccattcctacaactttccattcgtgagtcgagcgcaatggcgtgctcgggatccagtcaagacaactccattgcaaactccggtaccctacgtggtgatccatcactcttacataccaccagcttgttacgaccgggagaagtgctgcgcagccatgaggggcatgcaagacttccatattgatgaccacggctggtgggatattggataccattttgctgttggaagcgacggcgctgcgtacgagggacggggctgggagacgttgggtgcgcacgcgctgcatttcaactcagtcagcattggtatctgtctcattggagattggagatacgaaataccaccagcacagcaaaggaagacagccatggcattaatagcagctggagttgagcttggctacatcaaaccagactataaactccttggtcaccgccaagtcagagccaccgaatgccctggagacgcactcttcaatgaaatcaagacttgggatcacttctcaccttacccgagctctcatttagatctgcttgatattgcagagattcccgaatgggtgaaagatacgataaggggaaaaaatactacaatacctataccttcataa(SEQ ID NO:2)。
the invention also provides a recombinant expression vector, wherein the nucleotide fragment of the coding gene is inserted into the recombinant expression vector.
The invention also provides a method for reducing the resistance of the asparagus caterpillar to the asparagus caterpillar nuclear polyhedrosis virus, which is to reduce the expression quantity of the SePRR-06 gene in the asparagus caterpillar;
the specific description of the embodiment for reducing the expression level of the SePRR-06 gene in the asparagus caterpillar is to reduce the expression level of the SePRR-06 gene in cells by adopting an RNA interference method.
Wherein the RNA interference method uses dsRNA of which one sequence is as follows (SEQ ID NO: 3):
aactttccattcgtgagtcgagcgcaatggcgtgctcgggatccagtcaagacaactccattgcaaactccggtaccctacgtggtgatccatcactcttacataccaccagcttgttacgaccgggagaagtgctgcgcagccatgaggggcatgcaagacttccatattgatgaccacggctggtgggatattggataccattttgctgttggaagcgacggcgctgcgtacgagggacggggctgggagacgttgggtgcgcacgcgctgcatttcaactcagtcagcattggtatctgtctcattggagattggagatacgaaataccaccagcacagcaaaggaagacagccatggcattaatagcagctggagttgagcttggctacatcaaaccagactataaactccttggtcaccgccaagtcagagccaccgaatgccctggagacgcactcttcaatgaaatcaagacttgggatcacttctcaccttacccgagctctcatt。
the invention screens and obtains a gene with antiviral effect from beet armyworm which is an important agricultural pest. The sequence structure and the space-time expression mode of the gene are analyzed, and meanwhile, the incremental expression and RNA interference technology is utilized to prove that the gene has the effect of resisting the asparagus caterpillar nuclear polyhedrosis virus (SeMNPV), provides a new target gene for better preventing and controlling the asparagus caterpillar by utilizing the virus in production, and has obvious pushing effect on the interaction research of a host and the virus.
Drawings
Fig. 1: the invention relates to an expression condition diagram of asparagus caterpillar SePRR-06 in different development periods of asparagus caterpillar.
Fig. 2: expression pattern of asparagus caterpillar sepr-06 in different tissues of asparagus caterpillar 5-instar larvae.
Fig. 3: the proliferation diagram of the asparagus caterpillar SePRR-06 for inhibiting the proliferation of the SeMNPV is characterized in that A is the transcription level of the SePRR-06 in the SePRR-06 delta expression cells, B and C are the infection rate of the SeMNPV to the Se-PRR-06 cells, D is the ODV yield of the SeMNPV infected cells for 72h, and E is the BV titer of the SeMNPV infected cells for 24, 48 and 72 h.
Fig. 4: the interference of the asparagus caterpillar SePRR-06 promotes the proliferation diagram of the SeMNPV, wherein A is the down-regulation of the expression of the SePRR-06 after dsRNA interferes with the cell of the SePRR-06 in an increment mode, B and C are the infection rate of the cell of the SeMNPV after dsRNA interferes, D is the ODV yield of the SeMNPV after dsRNA interferes with 72h, and E is the BV titer of the SeMNPV after dsRNA interferes with 24, 48 and 72 h.
Fig. 5: the expression down regulation of the asparagus caterpillar SePRR-06 affects the survival rate diagram of asparagus caterpillar larvae to the SeMNPV, wherein A is the expression down regulation of the asparagus caterpillar larvae after dsRNA is injected into the asparagus caterpillar larvae, and B is the survival rate of the asparagus caterpillar larvae injected with the SePRR-06dsRNA or GFP dsRNA for infecting the SeMNPV.
Detailed Description
The invention obtains the asparagus caterpillar gene protein with antiviral effect by analyzing the genome from the asparagus caterpillar genome, the protein is named as SePRR-06, and the amino acid sequence of the SePRR-06 protein is SEQ ID NO:1. However, one of ordinary skill in the art can obtain a protein derived from 1) by substituting, deleting, adding one or more amino acids based on SEQ ID NO. 1 by conventional methods; the derived proteins should also have an effect against the asparagus caterpillar nuclear polyhedrosis virus SeMNPV.
Constructing a recombinant expression vector of the SePRR-06, and obtaining a beet armyworm cell line for stably and incrementally expressing the SePRR-06 through liposome transfection.
The expression level of the SePRR-06 gene in the cells is increased in an incremental expression mode, and then viruses are infected, so that whether the proliferation of the viruses is inhibited or not is detected. Microscopic observation and qPCR detection both show that proliferation of SeMNPV is obviously inhibited; the result proves that the expression quantity of the SePRR-06 is increased, and the resistance of the asparagus caterpillar cells to the SeMNPV can be obviously improved.
The present invention will be described in detail with reference to the following examples and the accompanying drawings.
Example 1: cloning and space-time expression profiling of SePRR-06
By analyzing the asparagus caterpillar genome, specific primers are designed, wherein the sequence of the forward primer is 5'-ATGCTATATTATTTGGTGTTATCCTG-3', and the sequence of the reverse primer is 5'-TTATGAAGGTATAGGTATTGTAGTA-3'.
The cDNA of the asparagus caterpillar cells is used as a template for amplification, and the PCR reaction conditions are as follows: pre-deforming for 4min at 94 ℃; denaturation at 94℃for 40s, annealing at 50℃for 40s, extension at 72℃for 50s for a total of 35 cycles; extending at 72℃for 5min and at 4℃for 10min. The PCR product is identified and recovered by agarose gel electrophoresis, then is connected with a PMD18-T carrier, is linked for 1h at 16 ℃ under the action of T4DNA ligase, then is transformed into DH5 alpha competent cells, and is sent to Shanghai Biotechnology limited company for sequencing after positive cloning is obtained, the sequencing result is shown as SEQ ID NO. 2, and the sequence is named as SePRR-06 gene.
Trizol was used to extract total RNA from asparagus caterpillar eggs, 1 to 5 instar larvae, female pupae and male pupae, respectively, while extracting total RNA from asparagus caterpillar 5 instar larvae, salivary glands, ganglia, female glands, male glands, female genitals, male genitals, midgut, haemolymph, fat bodies, epidermis and Marshall's tube tissue, and then the RNA was sent to Hua major genes Limited for transcriptome sequencing. The results of sequencing analysis on the expression of SePRR-06 in different development periods of asparagus caterpillar are shown in FIG. 1, and the results show that the expression quantity of SePRR-06 in 5-instar larvae is the highest. The results of SePRR-06 expression in different tissues of asparagus caterpillar are shown in FIG. 2, and the results show that the expression amount of SePRR-06 in the fat body is the highest.
Example 2: construction of the expression vector pIZ/V5-His-SePRR-06
In order to study the function of the SePRR-06 gene, the transcription condition of the SePRR-06 in the asparagus caterpillar Se-3 cells is improved by an incremental expression mode, then the infection condition of the cells by viruses is observed, and qPCR detects the change of virus proliferation, so that the function of the gene is proved. The method comprises the following specific steps:
designing an incremental expression primer by taking the full-length CDS sequence of the SePRR-06 gene as a target, wherein the upstream primer is as follows: 5'-attAAGCTTATGCTATATTATTTGGTGTTATCCTG-3', the downstream primer is: 5'-cggACTAGTTTATGAAGGTATAGGTATTGTAGTA-3' (capital italic letter is the cleavage site; lowercase italic letter is the protecting base of the cleavage site). Carrying out PCR amplification by taking the cloned SePRR-06 gene as a template, wherein the PCR reaction conditions are as follows: pre-denaturation at 94℃for 4min; denaturation at 94℃for 40s, annealing at 50℃for 40s, extension at 72℃for 50s for a total of 35 cycles; extending at 72℃for 5min and at 4℃for 10min. The amplified target bands are recovered, connected and transformed, and positive clones are screened for sequencing.
Carrying out double digestion on the plasmid successfully sequenced in the previous step by HindIII and SpeI, and carrying out agarose electrophoresis identification and recovery to obtain a SePRR-06 digested fragment; simultaneously, hindIII and SpeI are used for carrying out double digestion on the pIZ/V5-His vector, and the digested fragments of pIZ/V5-His are identified and recovered by agarose electrophoresis. Under the action of T4DNA ligase, the enzyme fragments of SePRR-06 and pIZ/V5-His are connected together by HindIII and SpeI, and then transformed into DH5 alpha competent cells, positive clones are screened, and pIZ/V5-His-SePRR-06 vector is obtained.
Example 3: effect of increased expression of SePRR-06 on SeMNPV proliferation and infection
Reference to
II reagent shows that plasmids of pIZ/V5-His-SePRR-06 and control pIZ/V5-His-GFP are respectively transfected into asparagus caterpillar Se-3 cells to respectively obtain Se-PRR-06 cells and Se-GFP cells. Subculturing the cells with TNM-FH cell culture medium (containing 10% fetal bovine serum), extracting RNA of the 10 th generation Se-PRR-06 and Se-GFP cells, reversely transcribing into cDNA, and using specific fluorescent quantitative primer SePRR-06qF of the SePRR-06 gene: 5'-TCGTGGTTAATCGTGTGGAATC-3' and SePRR-06qR:5'-GTACCGGAGTTTGCAATGGAGT-3' the transcription of the gene was quantitatively determined. The detection method comprises the following steps: the plasmid SePRR-06 is used as a template, the PCR amplification is carried out by using the SePRR-06qF and the SePRR-06qR, the PCR product is connected to a PMD-18T carrier by using T4DNA ligase, positive clones are selected and propagated, and the plasmid SePRR-06q is extracted. PRR-06q was diluted with a 10-fold gradient and used as a template for fluorescent quantitative PCR using PRR-06qF and PRR-06qR, and a standard curve for absolute quantitative detection was prepared by Analytik Jena qPCRsoft 4.0.4.0 software. The results of the detection are shown in FIG. 3A, which shows that the expression level of SePRR-06 in Se-PRR-06 cells is 2.7X10 of that of control cells 5 Fold, very significantly higher than control.
Infection of 10 th generation Se-PRR-06 and Se-GFP cells with SeMNPV 200. Mu.L of cell culture solution was taken 24h,48h and 72h after infection, DNA of budding virus particles (BV) of SeMNPV was extracted, and specific primer set of the SeMNPV GP41 gene was used, wherein the primer set comprises:
GP41qF：5′-ACGTCATCGACGATCTTTTCG-3′；
GP41qR：5′-CGGTGCCATGTAGCTAATGTTT-3′；
qPCR quantitative determination of virus content was performed and the production of a quantitative determination standard curve was performed with reference to the method in the example in which SePRR-06 was expressed in increments, and the results are shown as E in FIG. 3. qPCR detection results show that cells which express the SePRR-06 in an increment can obviously inhibit proliferation of virus BV, and the content of BV in Se-PRR-06 cells is only 50.3 percent and 52.2 percent of that in a control after 48 hours and 72 hours of virus infection. At 72h of infection of cells by SeMNPV, total DNA of the cells was extracted, and qPCR quantitative detection of inclusion body-derived virions (ODV) of SeMNPV was performed using specific primers GP41qF and GP41qR of the SeMNPV virus GP41 gene, and the results are shown in D in fig. 3. The qRT-PCR detection result shows that the cells which express the SePRR-06 in an increment mode can obviously inhibit the ODV proliferation of viruses, and the ODV content in the Se-PRR-06 cells is only 20.6% of that in a control mode.
At 72h of infection of the cells by SeMNPV, the infection symptoms of the virus on the cells were recorded by observation with a microscope, and the infection rate of the virus was calculated, and the results are shown in FIG. 3B and C. As a result, the infection rate of the virus to cells which are used for expressing the SEPRR-06 in an increment mode is obviously lower than that of a control, namely, only 36.2 percent of the control, and the effect that the resistance of the cells which are used for expressing the SEPRR-06 in an increment mode to the SEMNPV is obviously improved is proved.
Example 4: interference of SePRR-06 promotes proliferation of SeMNPV
Taking partial CDS sequence of the SePRR-06 gene as a target, designing and synthesizing a specific primer of dsSePRR-06, wherein the forward primer sequence is as follows: 5'-taatacgactcactatagggAACTTTCCATTCGTGAGTCG-3', the reverse primer sequence is: 5'-taatacgactcactatagggAATGAGAGCTCGGGTAAGGT-3' (lowercase is the T7 promoter sequence). dsSePRR-06 (SEQ ID NO: 3) was synthesized and purified as required by the specification using a Transcriptaid T7 high yield transcription kit reagent, and the quality and concentration of dsSePRR-06 were simultaneously detected using a micro-UV spectrophotometer and agarose gel. By means of
Reagent II by using liposomes to transfect dsSePRR-06 into spodoptera exigua cells expressing SePRR-06 in increased amounts, RNA interference of the SePRR-06 gene was performed while dsGFP was transfected into the spodoptera exigua cells as a control. After RNA interference, the results are shown in FIG. 4A, the expression level of SePRR-06 in dsPRR-06 interfering cells is 45.2%,55.9%,52.0% and 48.6% of that of the control, respectively, 24h,48h,72h and 96h after RNA interference, and the expression level of SePRR-06 is significantly reduced compared with the control. 24h after RNA interference, cells were infected with SeMNPV. 200 mu L of cell culture solution is taken 24h,48h and 72h after virus infection respectively, DNA of budding virus particles (BV) of the SeMNPV is extracted, and qPCR quantitative detection is carried out on BV of the SeMNPV by using specific primers GP41qF and GP41qR of GP41 gene of the SeMNPV virus, and the result is thatAs shown in FIG. 4E, the levels of viral BV in dsSePRR-06-interfered cells were significantly higher than the control, 24h,48h and 72h after virus infection, and the levels of viral BV in dsSePRR-06-interfered cells were 14.3, 2.56 and 2.51 fold, respectively, of the control. At 72h of infection of cells by SeMNPV, total DNA of the cells was extracted, and qPCR quantitative detection of inclusion body-derived virions (ODV) of SeMNPV was performed using specific primers GP41qF and GP41qR of the SeMNPV virus GP41 gene, and the results are shown in D in fig. 4. The qPCR detection result shows that the interference of the SePRR-06 significantly improves the proliferation of the SeMNPV in cells, and the content of virus ODV in dsSePRR-06 interference cells is 1.5 times that of the control.
When the SeMNPV infects cells for 72 hours, the infection symptoms of the virus to the cells are recorded by utilizing the observation of a microscope, the infection rate of the virus is calculated, the results are shown as B and C in figure 4, and the result shows that the interference of the SePRR-06 remarkably improves the infection rate of the virus to the cells, is 2.7 times of that of the contrast GFP, and remarkably reduces the resistance of the asparagus caterpillar cells to the SeMNPV.
Example 5: down-regulation of SePRR-06 expression affects survival of spodoptera exigua larvae to SeMNPV infection
The dsSePRR-06 of example 4 was injected into the 3-instar larvae of Spodoptera exigua using microinjection, interference of SePRR-06 was performed, and dsGFP was injected into the 3-instar larvae of Spodoptera exigua as a control. The interference efficiency of target genes was detected by 24h,48h,72h and 96h insect-out after interference, and the results are shown in fig. 5 a, and the expression level of sepr r-06 in dssepr r-06 interfered larvae after dsRNA interference was significantly lower than that of control, which was 16.5%,22.7%,30.9% and 32.5% of control, respectively, and the results showed that sepr-06 genes were successfully interfered. After SePRR-06 interference, 1 group was replicated 3 times per 30 larvae. 24h,48h,72h, 96h, 120h, 144h, 168h and 172h after the SeMNPV inoculation are respectively carried out, and the survival rate of larvae is counted. As shown in fig. 5B, the survival rate of dssepr-06 interfered spodoptera exigua larvae was significantly lower than the control at 96h, 120h, 144h and 168h, and the results showed that the interference of sepr-06 reduced the survival rate of spodoptera exigua larvae, significantly reducing the resistance of spodoptera exigua to SeMNPV.
Sequence listing
<110> Qingdao university of agriculture
<120> beet armyworm gene with antiviral effect and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 234
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 1
Met Leu Tyr Tyr Leu Val Leu Ser Cys Ile Ser Val Cys Val Gly Ala
1 5 10 15
Met Pro Thr Val Val Val Asn Arg Val Glu Ser Thr Glu Asn Glu Val
20 25 30
His Ser Tyr Asn Phe Pro Phe Val Ser Arg Ala Gln Trp Arg Ala Arg
35 40 45
Asp Pro Val Lys Thr Thr Pro Leu Gln Thr Pro Val Pro Tyr Val Val
50 55 60
Ile His His Ser Tyr Ile Pro Pro Ala Cys Tyr Asp Arg Glu Lys Cys
65 70 75 80
Cys Ala Ala Met Arg Gly Met Gln Asp Phe His Ile Asp Asp His Gly
85 90 95
Trp Trp Asp Ile Gly Tyr His Phe Ala Val Gly Ser Asp Gly Ala Ala
100 105 110
Tyr Glu Gly Arg Gly Trp Glu Thr Leu Gly Ala His Ala Leu His Phe
115 120 125
Asn Ser Val Ser Ile Gly Ile Cys Leu Ile Gly Asp Trp Arg Tyr Glu
130 135 140
Ile Pro Pro Ala Gln Gln Arg Lys Thr Ala Met Ala Leu Ile Ala Ala
145 150 155 160
Gly Val Glu Leu Gly Tyr Ile Lys Pro Asp Tyr Lys Leu Leu Gly His
165 170 175
Arg Gln Val Arg Ala Thr Glu Cys Pro Gly Asp Ala Leu Phe Asn Glu
180 185 190
Ile Lys Thr Trp Asp His Phe Ser Pro Tyr Pro Ser Ser His Leu Asp
195 200 205
Leu Leu Asp Ile Ala Glu Ile Pro Glu Trp Val Lys Asp Thr Ile Arg
210 215 220
Gly Lys Asn Thr Thr Ile Pro Ile Pro Ser
225 230
<210> 2
<211> 705
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
atgctatatt atttggtgtt atcctgtatt tccgtgtgtg tcggggctat gcctaccgtc 60
gtggttaatc gtgtggaatc tacagagaat gaggtccatt cctacaactt tccattcgtg 120
agtcgagcgc aatggcgtgc tcgggatcca gtcaagacaa ctccattgca aactccggta 180
ccctacgtgg tgatccatca ctcttacata ccaccagctt gttacgaccg ggagaagtgc 240
tgcgcagcca tgaggggcat gcaagacttc catattgatg accacggctg gtgggatatt 300
ggataccatt ttgctgttgg aagcgacggc gctgcgtacg agggacgggg ctgggagacg 360
ttgggtgcgc acgcgctgca tttcaactca gtcagcattg gtatctgtct cattggagat 420
tggagatacg aaataccacc agcacagcaa aggaagacag ccatggcatt aatagcagct 480
ggagttgagc ttggctacat caaaccagac tataaactcc ttggtcaccg ccaagtcaga 540
gccaccgaat gccctggaga cgcactcttc aatgaaatca agacttggga tcacttctca 600
ccttacccga gctctcattt agatctgctt gatattgcag agattcccga atgggtgaaa 660
gatacgataa ggggaaaaaa tactacaata cctatacctt cataa 705
<210> 3
<211> 514
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
aactttccat tcgtgagtcg agcgcaatgg cgtgctcggg atccagtcaa gacaactcca 60
ttgcaaactc cggtacccta cgtggtgatc catcactctt acataccacc agcttgttac 120
gaccgggaga agtgctgcgc agccatgagg ggcatgcaag acttccatat tgatgaccac 180
ggctggtggg atattggata ccattttgct gttggaagcg acggcgctgc gtacgaggga 240
cggggctggg agacgttggg tgcgcacgcg ctgcatttca actcagtcag cattggtatc 300
tgtctcattg gagattggag atacgaaata ccaccagcac agcaaaggaa gacagccatg 360
gcattaatag cagctggagt tgagcttggc tacatcaaac cagactataa actccttggt 420
caccgccaag tcagagccac cgaatgccct ggagacgcac tcttcaatga aatcaagact 480
tgggatcact tctcacctta cccgagctct catt 514
Claims (3)
1. A method for reducing the resistance of asparagus caterpillar to asparagus caterpillar nuclear polyhedrosis virus is characterized by reducing the expression quantity of protein with antiviral effect in asparagus caterpillar, wherein the amino acid sequence of the protein is SEQ ID NO. 1.
2. The method according to claim 1, wherein the method is to reduce the expression level of a protein having the amino acid sequence of SEQ ID NO. 1 in a cell by RNA interference.
3. The method of claim 2, wherein the dsRNA sequence used in the RNA interference method is SEQ ID No. 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210297727.5A CN114507277B (en) | 2022-03-24 | 2022-03-24 | Beet armyworm gene with antiviral effect and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210297727.5A CN114507277B (en) | 2022-03-24 | 2022-03-24 | Beet armyworm gene with antiviral effect and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114507277A CN114507277A (en) | 2022-05-17 |
| CN114507277B true CN114507277B (en) | 2023-05-23 |
Family
ID=81555403
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210297727.5A Active CN114507277B (en) | 2022-03-24 | 2022-03-24 | Beet armyworm gene with antiviral effect and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114507277B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115851574B (en) * | 2022-12-27 | 2024-04-19 | 青岛农业大学 | Beet armyworm cell line |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010132097A2 (en) * | 2009-05-11 | 2010-11-18 | Massachusetts Institute Of Technology | Compositions and methods for pest control |
| CN108148817A (en) * | 2018-03-07 | 2018-06-12 | 青岛农业大学 | A kind of Strain for having the function of to prevent beet armyworm |
| CN108642056A (en) * | 2018-01-05 | 2018-10-12 | 东北农业大学 | Eating-core bean worm LgPGRP-LB genes and its application |
| CN110759983A (en) * | 2019-09-10 | 2020-02-07 | 华南农业大学 | Recombinant fungus expressed by targeted silent pest pattern recognition protein GNBP3 gene and application thereof in pest control |
-
2022
- 2022-03-24 CN CN202210297727.5A patent/CN114507277B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010132097A2 (en) * | 2009-05-11 | 2010-11-18 | Massachusetts Institute Of Technology | Compositions and methods for pest control |
| CN108642056A (en) * | 2018-01-05 | 2018-10-12 | 东北农业大学 | Eating-core bean worm LgPGRP-LB genes and its application |
| CN108148817A (en) * | 2018-03-07 | 2018-06-12 | 青岛农业大学 | A kind of Strain for having the function of to prevent beet armyworm |
| CN110759983A (en) * | 2019-09-10 | 2020-02-07 | 华南农业大学 | Recombinant fungus expressed by targeted silent pest pattern recognition protein GNBP3 gene and application thereof in pest control |
Non-Patent Citations (1)
| Title |
|---|
| 肽聚糖识别蛋白PGRP-SC在家蝇肠道免疫中的功能分析;路永鹏;顾冀海;高一夫;唐婷;柳峰松;黄大卫;;昆虫学报(第03期);第269-277页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114507277A (en) | 2022-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Katsuma et al. | Novel macula-like virus identified in Bombyx mori cultured cells | |
| CN114507277B (en) | Beet armyworm gene with antiviral effect and application thereof | |
| Prosser et al. | Molecular analysis of double-stranded RNAs reveals complex infection of grapevines with multiple viruses | |
| CN112877302A (en) | Bivalent attenuated vaccine for resisting cucumber mosaic virus and tobacco mosaic virus | |
| Haider et al. | Identification of two Sugarcane mosaic virus (SCMV) variants from naturally infected sugarcane crop in Pakistan | |
| Tian et al. | Isolation and identification of a non-haemagglutinating strain of rabbit hemorrhagic disease virus from China and sequence analysis for the VP60 Gene | |
| CN113388637B (en) | Mutant plasmid vector containing cucumber mosaic virus Fny isolate RNA2 and application thereof | |
| CN110628725B (en) | Citrus yellowed vein clearing virus mutant and construction method thereof | |
| CN112480215B (en) | Virus-like particle of Coxsackie virus CV-A2 | |
| CN110526960A (en) | One antiviral polypeptide and the preparation method and application thereof | |
| CN112143754A (en) | Porcine Galta virus infectious clone and construction method and application thereof | |
| Nida'M et al. | Further complexity of the genus Crinivirus revealed by the complete genome sequence of Lettuce chlorosis virus (LCV) and the similar temporal accumulation of LCV genomic RNAs 1 and 2 | |
| CN106957358A (en) | Cereal cyst nematode Ha34609 albumen, encoding gene and its application | |
| CN104357457A (en) | Transcription factor TaWRKY gene sequence for cultivating wheat Brock and application thereof | |
| CN108409844B (en) | Application of protein TaNRT2.5 in regulation and control of plant yield | |
| Tzanetakis et al. | Nucleotide sequence of Blackberry yellow vein associated virus, a novel member of the Closteroviridae | |
| CN100549029C (en) | One plant disease resistance-related SGT1 and encoding gene and application | |
| CN106047901A (en) | Fungus pathogenic gene Moarrdc1 derived from Magnaporthe Oryzae and application | |
| Chen et al. | Sequence analysis demonstrates that Onion yellow dwarf virus isolates from China contain a P3 region much larger than other potyviruses | |
| CN114605504A (en) | Wheat yellow mosaic virus 14K protein capable of inducing plant cell necrosis and application thereof in virus resistance | |
| CN110295196B (en) | Method for prolonging death time of bombyx mori infected nuclear polyhedrosis virus, recombinant baculovirus thereof and application | |
| CN110904056B (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof | |
| Tian et al. | Molecular diversity of tobacco vein banding mosaic virus | |
| CN112961839A (en) | Bivalent attenuated vaccine for resisting cucumber mosaic virus and potato virus Y | |
| Ahmed et al. | Molecular detection, phylogenetic analysis and designing of siRNA against Potato Virus X |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |