CN112961839A - Bivalent attenuated vaccine for resisting cucumber mosaic virus and potato virus Y - Google Patents

Abstract

The invention discloses a bivalent attenuated vaccine for resisting cucumber mosaic virus and potato virus Y, which contains CMV_FnyMutant RNA2 of the isolate; the CMV_FnyMutant RNA2 of the isolate isIn the CMV_FnyThe RNA2 full-length sequence of the isolate is inserted with TAATAG and a conserved sequence of potato virus Y after position 2661; the nucleotide sequence of the inserted conserved sequence of the potyvirus is shown as SEQ ID NO. 1; the CMV_FnyThe nucleotide sequence of mutant RNA2 of the isolate is shown in SEQ ID NO. 2. The bivalent attenuated vaccine of the invention and the vaccine containing CMV_FnyThe plasmid mixed inoculation of the isolate RNA1 and the RNA3 can prevent the harm of cucumber mosaic virus and potato virus Y, and provides vaccine materials and effective prevention and treatment measures for preventing and treating plant virus diseases caused by CMV and PVY in fields.

Description

Bivalent attenuated vaccine for resisting cucumber mosaic virus and potato virus Y

Technical Field

The invention relates to the technical field of plant virology and molecular biology, in particular to a bivalent attenuated vaccine for resisting cucumber mosaic virus and potato virus Y and application thereof in preventing and treating the cucumber mosaic virus and the potato virus Y.

Background

Tobacco is one of important economic crops in China, and at present, the main factor limiting the development of the tobacco industry is tobacco virus disease which can be called as tobacco cancer and seriously influences the quality of tobacco, so that the prevention and the treatment of the tobacco virus disease are problems which are urgently needed to be solved in production. The compound infection is the characteristic of tobacco virus diseases, generally infected tobacco is infected with a plurality of virus diseases simultaneously, the symptoms are complex, and the effect of singly preventing and treating one disease is often poor. Therefore, it is important to design a strategy that can simultaneously resist multiple viruses.

Cucumber Mosaic Virus (CMV) belongs to the genus cucumovirus (sormoviraceae) and is one of the widest host range of plant viruses known at present, and can infect more than 1200 plants in 100 families (Mochizuki et al, 2012). CMV is a main pathogen causing tobacco mosaic, causing plant dwarfing and serious deformity, causing mosaic and necrosis of leaves, having mottle of yellow and green, and seriously affecting the quality and yield of tobacco because the leaves become thin in serious conditions. Potato Virus Y (PVY) belongs to the genus Potyvirus in the family of Potyviridae (Potyviridae), and when PVY infects tobacco, the infection mainly occurs in the provincial and vigorous stages, which causes vein necrosis, veins and yellow spots of the tobacco, can cause the yield of the tobacco to be reduced by 20-50%, and serious blocks can cause the tobacco to be harvested absolutely, which seriously affects the quality and yield of the tobacco (junxin et al, 2014; Sunwei Nur et al, 2011).

For the prevention and treatment of plant virus diseases, the most effective method is the screening and cultivation of disease-resistant varieties, but the method has the defects of long breeding period, easy loss of resistance of the disease-resistant varieties and the like. The other method is weak-toxicity cross protection, which is to use weak-toxicity mutant to infect and induce the immune system of the plant to prevent and control the later-stage infected strong virus strain of the same type; is an effective virus control strategy. The attenuated mutants may be naturally occurring or may be artificially prepared by molecular biological means.

A virulent mutant that can only be used to control a corresponding virulent virus. If one wants to control different viruses simultaneously, several different types of attenuated mutants are required. But can achieve the effect of preventing and treating the backbone virus and the virus corresponding to the insert by inserting the heterologous virus segment into the backbone virus, and the mutant virus is the multivalent attenuated vaccine. A bivalent attenuated vaccine which takes cucumber mosaic virus as a basic viral vector and can resist the cucumber mosaic virus and potato virus Y at the same time is not reported at present.

Disclosure of Invention

Aiming at the research background, the invention aims to provide a bivalent attenuated vaccine for resisting both CMV and PVY, and provides vaccine materials and effective control measures for field control of plant virus diseases caused by CMV and PVY.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect of the present invention, there is provided a bivalent attenuated vaccine against both cucumber mosaic virus and potyvirus, said bivalent attenuated vaccine comprising CMV_FnyMutant RNA2 of the isolate; the CMV_FnyMutant RNA2 of the isolate is in CMV_FnyThe RNA2 full-length sequence of the isolate is inserted with TAATAG and a conserved sequence of potato virus Y after position 2661; the nucleotide sequence of the inserted conserved sequence of the potyvirus is shown as SEQ ID NO. 1; the CMV_FnyThe nucleotide sequence of mutant RNA2 of the isolate is shown in SEQ ID NO. 2.

In a second aspect of the present invention, there is provided a method for constructing the bivalent attenuated vaccine against both cucumber mosaic virus and potato virus Y, comprising the following steps:

(1) with CMV_FnyRNA2 infectious clone plasmid pCB301-CMV_Fnyusing-R2 as template, obtaining intermediate carrier pCC by inverse PCR amplification technology_FR2-2bPT II; the intermediate vector pCC_FR2-2bPT II is that TAATAG is inserted after 2661, and then enzyme cutting sites of BamH I, SpeI and Sma I are introduced in sequence;

(2) the conserved sequence of the potato virus Y shown in SEQ ID NO.1 is inserted into an intermediate vector pCC by utilizing an enzyme digestion and connection method_FR2-2bPT II, to construct bivalent mutant plasmid vector pCC for resisting cucumber mosaic virus and potato virus Y_FR2-2bPTⅡ-PY_2810-3009。

In a third aspect of the invention, the application of the bivalent attenuated vaccine for resisting both cucumber mosaic virus and potato virus Y in preventing and treating cucumber mosaic virus and potato virus Y is provided.

In a fourth aspect of the present invention, there is provided a method for controlling cucumber mosaic virus and potato virus Y, comprising the steps of:

bivalent attenuated vaccine against cucumber mosaic virus and potato virus Y and CMV-containing vaccine_FnyThe isolates were inoculated with a mixture of RNA1 and plasmid RNA 3.

The invention has the beneficial effects that:

(1) 2b protein premature termination mutant pCC for obtained cucumber mosaic virus RNA2_FR2-2bPT II, the invention further inserts PVY conservative fragment after the new stop codon to obtain 2b protein early termination type mutant of cucumber mosaic virus RNA2 containing PVY fragment, the plasmid and the mutant contain CMV_FnyThe plasmid mixed inoculation of the RNA1 and RNA3 of the isolate can prevent the infection of CMV and PVY virulent strains, and can be used as a bivalent attenuated vaccine for resisting cucumber mosaic virus and potato virus.

(2) The PVY gene fragment inserted into the mutant plasmid provided by the invention is a PVY genome conserved sequence with the length of 200bp, and has the potential of preventing and treating various PVY isolates.

Drawings

FIG. 1: basic vector pCB301-CMV_Fny-R2, inIntervector pCC_FR2-2bPT II, and attenuated mutant pCC containing PVY_FR2-2bPTⅡ-PY_2810-3009A schematic diagram; in the figure, LB, T-DNA Left Border (LB); RB, T-DNA Right Border (RB); 35S, promoter (from gene 2x 35S); RZ, ribozyme (HDV-RZ); NOS, terminator (NOS terminator).

FIG. 2: plasmid pCC_FR2-2bPTⅡ-PY_2810-3009Alignment of the PVY sequence contained in (a) with the PVY (NCBI accession number X97895) sequence.

FIG. 3: pCC_FR2-2bPTⅡ-PY_2810-3009Weak pathogenic symptoms on forest tobacco; mock, empty agrobacterium liquid; r1, CMV_Fny RNA1；R2，CMV_Fny RNA2；R3，CMV_Fny RNA3；pCC_FR2-2bPTⅡ-PY_2810-3009Containing CMV_FnyThe complete sequence of RNA2, and 200bp conserved sequence of PVY is inserted after the 2b protein early stop codon; dpi, days post inoculation.

FIG. 4: pCC_FR2-2bPTⅡ-PY_2810-3009Stability of the PVY insert of (a) in plants; wherein M is a D2000 molecular weight standard from Tiangen corporation; mock, empty agrobacterium liquid; r2, CMV_Fny RNA2；R2-2bPTⅡ-PY_2810-3009Containing CMV_FnyThe complete sequence of RNA2, and a 200bp conserved fragment of PVY is inserted after the 2b protein early stop codon; dpi, days post inoculation.

FIG. 5: pCC_FR2-2bPTⅡ-PY_2810-3009Measuring the cross protection effect; wherein mock, empty agrobacterium liquid; r1, CMV_Fny RNA1；R3，CMV_Fny RNA3；R2-2bPTⅡ-PY_2810-3009Containing CMV_FnyThe complete sequence of RNA2, and a 200bp conserved fragment of PVY is inserted after the 2b protein early stop codon; dpi, days post inoculation.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As described in the background section, a bivalent attenuated vaccine against both cucumber mosaic virus and potato virus Y has not been reported. Compared with the monovalent attenuated vaccine, when the bivalent attenuated vaccine is constructed, the insertion of the fragment of the heterologous virus is required, the insertion of the fragment with a certain length is ensured to effectively trigger the gene silencing effect on the heterologous virus, and the stability of the inserted fragment in the attenuated mutant is also ensured, so that the construction difficulty of the bivalent attenuated vaccine is higher.

The bivalent attenuated vaccine for resisting cucumber mosaic virus and potato virus Y of the present invention is CMV_FnyRNA2 infectious clone plasmid pCB301-CMV_Fny-R2 as a base vector in which CMV is present_FnyTAATAG and a conserved sequence of potyvirus were inserted after position 2661 of the full length sequence of RNA 2.

The difficulty of constructing the bivalent attenuated vaccine for resisting both cucumber mosaic virus and potato virus Y mainly lies in the modification of a basic vector and the selection of an insertion sequence. Wherein: for the transformation of the basic vector, the inventors studied CMV as a primary vector (CN108486148A)_FnyRNA2 infectious clone plasmid pCB301-CMV_FnyThe intermediate vector pCB301-CMV of 2b protein early termination is obtained by taking-R2 as a template and utilizing an inverse PCR amplification method_Fny2Del2b, which is a multiple cloning site containing BamH I, SpeI and Sma I and a TAATA sequence inserted between position 2661 and position 2662 immediately after the stop codon of the 2a protein. In further subsequent studies, it was found that, by using this modification strategy, the newly inserted sequence in the intermediate vector can act simultaneously at the nucleotide and amino acid levels, wherein the action at the amino acid level may involve changes in the 2b elongase protein sequence and tertiary structure, resulting in low controllability of the vaccine effect.

Based on this, the modification strategy of cucumber mosaic virus 2b protein coding gene is improved, TAATAG is inserted after 2661, and then enzyme cutting sites of BamH I, SpeI and Sma I are introduced in sequence, the design of the invention can ensure that the inserted sequence only acts at nucleotide level, and the controllability of the prepared vaccine effect is stronger. The cloning sites BamH I, Spe I and Sma I introduced were mainly prepared for the insertion of different types of fragments into the vector. An exogenous insert can be introduced by using the combination of any two enzyme cutting sites, so that 3 enzyme cutting sites are necessary to be designed to facilitate the insertion of different exogenous sequences.

For the selection of the inserted sequence, the genomic sequence of the potyvirus itself is relatively long, and because the virus has packaging limitation on the size of the virus itself, the inserted foreign virus fragment has length limitation when constructing the multivalent attenuated vaccine. Therefore, it is impossible to introduce the full-length sequence of potyvirus, and it is necessary to select an appropriate sequence from the genome of potyvirus for introduction as a foreign gene fragment, and the introduced foreign gene fragment needs to ensure the effectiveness and stability. Therefore, it is critical to select which sequence is to be used as the insertion sequence for potyvirus. Through repeated optimization and screening, the invention finally selects a PVY gene sequence with the length of 200bp as an insertion sequence, as shown in SEQ ID NO.1, and concretely comprises the following steps:

AGCTGTACATGGGCACCGGAAGGAATGACACGTTCACATACGCTGGATGCCAAGGGCTAACCAAGCCGAAAGTACAAATTGTGTTGGACCACAACACCCAAGTGTGTAGTGCGAATGTGATGTACACGGCACTCTCTAGAGCTACCGACAGGATTCACTTCGTGAACACAAGTGCAAACTCTTCGGCCTTCTGGGAAAAG。

the sequence shown in SEQ ID NO.1 is adopted as an insertion sequence, so that the infection performance of the potato virus Y can be effectively maintained on one hand; on the other hand, the plant can stably exist in the plant body after inoculation.

In a preferred embodiment of the present invention, Cucumber Mosaic Virus (CMV) is given_Fny) RNA2 mutant plasmid vector pCC_FR2-2bPTⅡ-PY_2810-3009The construction method specifically comprises the following steps:

(1) cloning of partial fragments of PVY: based on the PVY complete sequence of 5 different strains published in GenBank (accession numbers: X97895, AB714135, JQ969040, EF026076, JF928460), DNAMAN software was used to perform sequence alignment, find regions with conserved sequence and design primers PVY-BamHI-2810-F and PVY-SmaI-3009-R (see Table 1 for detailed information). Extracting the total RNA of the plant infected by the PVY tobacco, and amplifying a 200bp segment corresponding to 2810-3009 bit of the PVY genome by using RT-PCR.

Table 1: primers used in the present invention

Note: the protected bases are in bold, the cleavage sites are underlined, and the non-viral sequences are in italics.

(2)pCC_FR2-2bPTⅡ-PY_2810-3009The construction of (1): double digestion of pCC with BamH I and Sma I respectively_FR2-2bPT II and PVY 200bp fragments are recovered by glue and then are connected, the connection product is transformed into escherichia coli DH5 alpha, and the plasmid vector pCC is confirmed to be obtained by colony PCR, plasmid restriction enzyme identification and DNA sequencing_FR2-2bPTⅡ-PY_2810-3009。

The plasmid vector pCC_FR2-2bPTⅡ-PY_2810-3009Contains CMV_FnyMutant RNA2 of the isolate; the CMV_FnyThe nucleotide sequence of the mutant RNA2 of the isolate is shown as SEQ ID NO.2, and specifically comprises the following steps: gtttatttacaagagcgtacggttcaacccctgcctcccctgtaaaactccctagacttaaatcttttctttctagtatcttttctatggctttccctgcccccgcattctcactagccaatcttttgaacggcagttacggtgtcgacactcccgaggatgtggaacgtttgcgatctgagcaacgcgaagaggctgctgcggcctgtcgtaattacaggcccctacccgctgtggatgtcagcgagagtgtcacagaggacgcgcattccctccgaactcctgacggagctcccgctgaagcggtgtctgatgagtttgtaacttatggtgctgaagattaccttgaaaaatctgatgatgagctccttgtcgcttttgagacgatggtcaaacccatgcgtatcggacaactatggtgccctgcgtttaataaatgttcttttatttccagcattgctatggccagagctttgttgttggcacctagaacatcccaccgaaccatgaagtgttttgaagacctggtcgcggctatttacactaaatctgatttctactacagtgaagagtgtgaagccgacgacgctcagatagatatctcgtctcgcgatgtacccggttattctttcgaaccgtggtcccgaacgtctggatttgaaccgccgcccatttgtgaagcgtgcgacatgatcatgtaccagtgcccgtgttttgattttaatgctttaaagaaatcgtgcgctgagaggaccttcgctgatgattatgttattgaaggtttagatggtgttgttgataatgcgactctgttgtcgaatttgggtccatttttggtacccgtgaagtgtcaatatgaaaaatgtccaacgccaaccatcgcgattcctccggatttaaaccgtgctactgatcgtgttgatatcaatttagttcaatccatttgtgactcgactctgcccactcatagtaattacgacgactcttttcatcaagtgttcgtcgaaagtgcagactattctatagatctggatcatgttagacttcgacagtctgatcttattgcaaaaattccagattcagggcatatgataccggttctgaacaccgggagcggtcacaagagagtaggtacaacgaaggaggtccttacagcaattaagaaacgtaatgctgacgttccagagctaggtgattccgttaatttgtctagattgagtaaagctgtggctgagagattcttcatttcatacatcaatggtaactctctagcatccagtaactttgtcaatgtcgttagtaacttccacgattacatggaaaaatggaagtcctcaggtctttcttatgatgatcttccggatcttcatgctgagaatttgcagttttatgaccacatgataaaatccgatgtgaaacctgtggtgagcgacacactcaatatcgacagaccggttccagctactataacgtatcataagaagagtataacctcccagttctcaccgttattc acagcgctattcgagcgcttccagagatgccttcgagaacgtattattcttcctgttggtaagatttcatcccttgagatggcaggatttgatgtcaagaacaagcactgcctcgagattgacctgtctaagtttgataagtctcaaggtgaatttcacttgctaatccaggaacacattttgaatggtctaggatgtccagctccgataactaagtggtggtgtgatttccatcgattctcttacattagagaccgtagagctggtgttggtatgcctattagtttccagagacgaactggcgatgcactcacttattttggcaataccatcgtcaccatggctgagtttgcctggtgttatgacaccgaccaattcgaaaagcttttattctcaggcgatgattctctaggattttcactgcttccccctgttggtgacccgagtaaattcacaactcttttcaacatggaagctaaggtgatggaacctgccgtaccatatatttgttcgaagttcttactctctgacgagttcggtaacacattttccgttccagatccattgcgcgaggttcagcggttaggaacaaagaaaattccctattctgacaatgatgaattcttgtttgctcacttcatgagctttgttgatcgattgaagtttttggaccgaatgtctcagtcgtgtatcgatcaactttcgattttcttcgaattgaaatacaagaagtctggggaagaggctgctttaatgttaggcgcctttaagaagtataccgctaatttccagtcctacaaagaactctattattcagatcgtcgtcagtgcgaattgatcaattcgttttgtagtacagagttcagggttgagcgtgtaaattccaacaaacagcgaaagaattatggaattgaacgtaggtgcaatgacaaacgtcgaactccaactggctcgtatggtggaggcgaagaagcagagacgaaggtctcacaaacagaatcgacgggaacgaggtcacaaaagtcccagcgagagagcgcgttcaaatctcagactattccgcttcctaccgttctatcaagtggatggttcggaactgacagggtcatgccgccatgtgaacgtggcggagttacccgagtctgaTAATAGGGATCCAGCTGTACATGGGCACCGGAAGGAATGACACGTTCACATACGCTGGATGCCAAGGGCTAACCAAGCCGAAAGTACAAATTGTGTTGGACCACAACACCCAAGTGTGTAGTGCGAATGTGATGTACACGGCACTCTCTAGAGCTACCGACAGGATTCACTTCGTGAACACAAGTGCAAACTCTTCGGCCTTCTGGGAAAAGCCCGGGggcctctcgtttagagttatcggcggaagaccatgattttgacgatacagattggttcgccggtaacgaatgggcggaaggtgctttctgaaacctccccttccgcatctccctccggttttctgtggcgggagctgagttggcagtattgctataaactgtctgaagtcactaaacacattgtggtgaacgggttgtccatccagcttacggctaaaatggtcagtcgtagaggaatctacgccagcagacttacaagtctctgaggcacctttgaaaccatctcctaggtttcttcggaaggacttcggtccgtgtacttctagcacaacgtgctagtttcagggtacgggtgccccccacttttgtggggcctccaaaaggagacca。

The lower case letter is CMV_FnyAn RNA2 sequence; capital letters are introduced foreign fragments, underlined for stop codons, italicized capital letters for cleavage sites, and positive capital letters for heterologous viral fragments.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples of the present invention, which were not specifically described, were all those conventional in the art and commercially available. In the examples of the present invention, the specific experimental conditions and methods are not specified, and the conventional conditions such as J. SummBruker et al, science publishers, 2002, molecular cloning guidelines (third edition); master catalog of speekt et al, scientific press, 2001, cell experimental guidelines; or according to conditions recommended by the manufacturer.

Example 1.pCC_FR2-2bPTⅡ-PY_2810-3009Construction of

(1) Cloning of partial fragments of PVY: extracting total RNA of a Nicotiana benthamiana plant infected by PVY (X97895) by using TransZol Up (TransGen), performing Reverse transcription reaction under the action of Reverse Transcriptase M-MLV (Takara), wherein Reverse primers are PVY-SmaI-3009-R, and reaction conditions are as follows: denaturing at 80 deg.c for 3min without adding enzyme; after addition of reverse transcriptase, the reaction was carried out at 42 ℃ for 1.5 h. Then taking the cDNA of the reverse transcription product as a template, and carrying out PCR reaction under the action of 2 XTaq Master Mix (Vazyme), wherein the primer pair is PVY-BamHI-2810-F and PVY-SmaI-3009-R; PCR conditions were as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 52 ℃ for 15s, extension at 72 ℃ for 12s, 30 cycles; extending for 5min at 72 ℃; storing at 4 deg.C; the PCR product is a 200bp conserved sequence fragment in PVY. And recovering the PCR product by a DNA recovery kit for later use.

(2) Intermediate carrierpCC_FConstruction of R2-2bPT II: with CMV_FnyInfectious clone plasmid pCB301-CMV_Fny-R2 is a template ((CMV)_FnyThe construction of infectious clone plasmid pCB301-Fny2 refers to "construction of Agrobacterium mediated CMV infectious clone and 2b deletion mutant", YaoMin et al, Chinese agricultural science, 2011,44 (14): 3060) and reverse PCR amplification is carried out under the action of PrimeSTAR HS DNA Polymerase (Takara), wherein the primer pairs are Fny2-2bPT 3'-BSS-2662-F and Fny2-2bPT 3' -BT-2661-R; PCR conditions were as follows: denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 8min, and 7 cycles; denaturation at 98 ℃ for 10s, extension at 68 ℃ for 8min, 25 cycles; storing at 4 deg.C; the PCR product obtained by amplification is the linearized intermediate vector pCC_FR2-2bPTⅡ。

Plasmid template pCB301-CMV in PCR reaction is degraded by DpnI (NEB)_Fny-R2 under the reaction conditions: 1h at 37 ℃; 20min at 80 ℃; and (3) recovering the product by using an absolute ethyl alcohol precipitation method: the product was added to ddH₂Adding 50ul of sodium acetate with pH of 5.23.0 mM and 1ml of absolute ethyl alcohol into the mixture until the volume of O is 450 mu l, precipitating the mixture for 2h at minus 80 ℃, centrifuging the mixture at the normal temperature of 12000rpm for 10min, pouring the liquid out, adding 600 mu l of 70% ethyl alcohol into the mixture, centrifuging the mixture at the normal temperature of 12000rpm for 5min, pouring the liquid out, centrifuging the mixture at the normal temperature of 12000rpm for 1min, completely sucking the liquid in a centrifuge tube, adding ddH into the centrifuge tube₂O30. mu.l was redissolved.

Then using BamH I (Takara) enzyme to cut and recover the product, after the cut enzyme product is recovered by DNA recovery kit, at T₄DNA ligase (Takara) was ligated overnight at 16 ℃ to transform the ligated product into E.coli DH 5. alpha. and applied to LB plates with 100. mu.g/mL kanamycin for colony PCR, plasmid restriction and DNA sequencing to confirm the intermediate pCC_FR2-2bPTⅡ。

(3)pCC_FR2-2bPTⅡ-PY_2810-3009Construction: an intermediate vector pCC_FCarrying out double enzyme digestion on R2-2bPT II by BamH I and Sma I, and recovering the enzyme digestion product by a DNA recovery kit; the 200bp conserved sequence fragment in the PVY is subjected to double enzyme digestion by BamH I and Sma I, and the enzyme digestion product is recovered by a DNA recovery kit. The intermediate vector pCC digested in two times is used_FR2-2bPT II and PVY fragment at T₄Carrying out overnight ligation at 16 ℃ under the action of DNA ligase; transformation of E.coli by ligation productsThe competent cells of DH5 alpha were plated on LB plates with 100. mu.g/mL kanamycin, and the positive clone pCC was obtained by colony PCR screening, enzyme digestion and DNA sequencing_FR2-2bPTⅡ-PY_2810-3009。

And (4) analyzing results: after the ligation product is transformed, the product is subjected to colony PCR primary screening, the plasmid is subjected to enzyme digestion identification, and the final identification is performed by DNA sequencing of the plasmid after the plasmid is basically confirmed to contain a gene sequence of PVY 200bp (figure 2).

Example 2 plasmid vector pCC_FR2-2bPTⅡ-PY_2810-3009Biological effects of

Infiltrating the infected forest tobacco with agrobacterium: the wild-type CMV is first_FnyRNA1、pCC_FR2-2bPTⅡ-PY_2810-3009Wild type CMV_FnyThe plasmid of RNA3 was used to transform competent cells of Agrobacterium GV3101, plated on LB plates with 50. mu.g/ml kanamycin and 100. mu.g/ml rifampicin, incubated at 28 ℃ for 48h, and single plaques were picked for colony PCR verification, and then picked into 2ml LB medium (50. mu.g/ml kanamycin, 100. mu.g/ml rifampicin) and incubated at 28 ℃ for 24h at 200 rpm.

Induction: separately collecting CMV_FnyRNA1、pCC_FR2-2bPTⅡ-PY_2810-3009、CMV_FnyRNA3, 100. mu.l of the bacterial suspension was added to 5ml of LB medium (containing 50. mu.g/ml kanamycin, 100. mu.g/ml rifampicin), and cultured at 28 ℃ and 200rpm with shaking to OD₆₀₀Is 1.0-2.0.

Resuspending: centrifuging the induced bacterial liquid in a 10ml centrifuge tube at 6000rpm for 10min at room temperature; the cells were collected and resuspended in 1ml Agrobacterium cell resuspension solution (10mM MgCl)₂10mM MES, 0.15mM AS) was pipetted and mixed, 50. mu.l of the suspension was taken to 1ml of the resuspension, and the OD was measured₆₀₀Value, adjusting the concentration to OD₆₀₀1.2, adjusting the OD of the residual bacteria liquid according to the ratio of the bacteria liquid to the resuspension liquid₆₀₀0.9-1.5, and making 3 kinds of bacterial liquid OD₆₀₀And (5) the consistency is achieved.

Adjusting the OD of the three types₆₀₀Bacterial solutions of value (each containing CMV_FnyRNA1、pCC_FR2-2bPTⅡ-PY_2810-3009、CMV_FnyRNA3) in equal proportion, and standing at 28 ℃ for 3 h.

Inoculation: taking a 1ml disposable injector, removing a needle head to absorb agrobacterium tumefaciens bacterial liquid, selecting forest tobacco in a 3-4 leaf stage, injecting the bacterial liquid in the injector between veins on the back sides of the leaves by using pressure, injecting two leaves for each plant, and at least covering 1/3 of the leaves by the injection amount of each leaf.

The inoculated plants are placed at 25 ℃ for culture, and the illumination time of 16 h/the darkness time of 8h are alternated.

And (4) analyzing results: 9d after inoculation, wild type CMV_FnyThe tobacco leaves of the forest with RNA1/RNA2/RNA3 are shriveled, the symptoms of flower and leaf exist, and the plants are dwarfed; inoculation of CMV_FnyRNA1/RNA2-2bPTⅡ-PY_2810-3009the/RNA 3 was essentially identical to the healthy controls, with no obvious symptoms of viral disease. Indicating pCC_FR2-2bPTⅡ-PY_2810-3009A weakly virulent mutant of CMV RNA2 (fig. 3).

To test the genetic stability of the mutants after tobacco inoculation, samples were taken from the leaves of the non-inoculated system 9 days after inoculation, and RT-PCR was used to test whether the heterologous viral insert was stably present. To determine whether the heterologous viral insert is stably present in CMV_FnyPrimers CM-Fny2-2510-F (SEQ ID NO.7) and CM-Fny2-2760-R (SEQ ID NO.8) are designed upstream and downstream of the insertion sequence of the heterologous fragment of RNA2, and RT-PCR detection is carried out.

And (4) analyzing results: pCC_FR2-2bPTⅡ-PY_2810-3009At day 9 after inoculation of the tobacco, the virus replication signals were detected in the lamina of the system by RT-PCR, and the presence of the inserted PVY fragment was judged by the size of the amplified fragment (FIG. 4).

Example 3 plasmid vector pCC_FR2-2bPTⅡ-PY_2810-3009Cross protection effect test of

CMV inoculation Using the method of example 2_FnyRNA1/RNA2-2bPTⅡ-PY_2810-3009The cross-protection test was performed with/RNA 3. After inoculating the attenuated mutant for 10 days, infecting the plant which is inoculated with the attenuated mutant in advance and the plant which is not inoculated with the attenuated mutant in advance with the target virulent CMV and PVY respectively, photographing for recording symptoms after inoculating for 15 days, and testing the cross protection effect.

And (4) analyzing results: strong poison of CMV and PVYThe planted tobacco is short and small, and the plant shows dark and light green intercross flower and leaf symptoms; pre-inoculated CMV_FnyRNA1/RNA2-2bPTⅡ-PY_2810-3009The RNA3 forest tobacco is inoculated with the target strong virus (CMV + PVY), the plant height is slightly dwarfed compared with the healthy control, the growth state is good, and only weak mosaic symptoms exist, which indicates that the CMV is pre-inoculated_FnyRNA1/RNA2-2bPTⅡ-PY_2810-3009The forest tobacco of RNA3 has better cross-protection and prevention effects on CMV + PVY, and is a bivalent attenuated vaccine for resisting both PVY and CMV (figure 5).

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Shandong university of agriculture

<120> a bivalent attenuated vaccine against both cucumber mosaic virus and potato virus Y

<130> 2021

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 200

<212> DNA

<213> PVY Gene sequence

<400> 1

agctgtacat gggcaccgga aggaatgaca cgttcacata cgctggatgc caagggctaa 60

ccaagccgaa agtacaaatt gtgttggacc acaacaccca agtgtgtagt gcgaatgtga 120

tgtacacggc actctctaga gctaccgaca ggattcactt cgtgaacaca agtgcaaact 180

cttcggcctt ctgggaaaag 200

<210> 2

<211> 3268

<212> DNA

<213> Artificial sequence

<400> 2

gtttatttac aagagcgtac ggttcaaccc ctgcctcccc tgtaaaactc cctagactta 60

aatcttttct ttctagtatc ttttctatgg ctttccctgc ccccgcattc tcactagcca 120

atcttttgaa cggcagttac ggtgtcgaca ctcccgagga tgtggaacgt ttgcgatctg 180

agcaacgcga agaggctgct gcggcctgtc gtaattacag gcccctaccc gctgtggatg 240

tcagcgagag tgtcacagag gacgcgcatt ccctccgaac tcctgacgga gctcccgctg 300

aagcggtgtc tgatgagttt gtaacttatg gtgctgaaga ttaccttgaa aaatctgatg 360

atgagctcct tgtcgctttt gagacgatgg tcaaacccat gcgtatcgga caactatggt 420

gccctgcgtt taataaatgt tcttttattt ccagcattgc tatggccaga gctttgttgt 480

tggcacctag aacatcccac cgaaccatga agtgttttga agacctggtc gcggctattt 540

acactaaatc tgatttctac tacagtgaag agtgtgaagc cgacgacgct cagatagata 600

tctcgtctcg cgatgtaccc ggttattctt tcgaaccgtg gtcccgaacg tctggatttg 660

aaccgccgcc catttgtgaa gcgtgcgaca tgatcatgta ccagtgcccg tgttttgatt 720

ttaatgcttt aaagaaatcg tgcgctgaga ggaccttcgc tgatgattat gttattgaag 780

gtttagatgg tgttgttgat aatgcgactc tgttgtcgaa tttgggtcca tttttggtac 840

ccgtgaagtg tcaatatgaa aaatgtccaa cgccaaccat cgcgattcct ccggatttaa 900

accgtgctac tgatcgtgtt gatatcaatt tagttcaatc catttgtgac tcgactctgc 960

ccactcatag taattacgac gactcttttc atcaagtgtt cgtcgaaagt gcagactatt 1020

ctatagatct ggatcatgtt agacttcgac agtctgatct tattgcaaaa attccagatt 1080

cagggcatat gataccggtt ctgaacaccg ggagcggtca caagagagta ggtacaacga 1140

aggaggtcct tacagcaatt aagaaacgta atgctgacgt tccagagcta ggtgattccg 1200

ttaatttgtc tagattgagt aaagctgtgg ctgagagatt cttcatttca tacatcaatg 1260

gtaactctct agcatccagt aactttgtca atgtcgttag taacttccac gattacatgg 1320

aaaaatggaa gtcctcaggt ctttcttatg atgatcttcc ggatcttcat gctgagaatt 1380

tgcagtttta tgaccacatg ataaaatccg atgtgaaacc tgtggtgagc gacacactca 1440

atatcgacag accggttcca gctactataa cgtatcataa gaagagtata acctcccagt 1500

tctcaccgtt attcacagcg ctattcgagc gcttccagag atgccttcga gaacgtatta 1560

ttcttcctgt tggtaagatt tcatcccttg agatggcagg atttgatgtc aagaacaagc 1620

actgcctcga gattgacctg tctaagtttg ataagtctca aggtgaattt cacttgctaa 1680

tccaggaaca cattttgaat ggtctaggat gtccagctcc gataactaag tggtggtgtg 1740

atttccatcg attctcttac attagagacc gtagagctgg tgttggtatg cctattagtt 1800

tccagagacg aactggcgat gcactcactt attttggcaa taccatcgtc accatggctg 1860

agtttgcctg gtgttatgac accgaccaat tcgaaaagct tttattctca ggcgatgatt 1920

ctctaggatt ttcactgctt ccccctgttg gtgacccgag taaattcaca actcttttca 1980

acatggaagc taaggtgatg gaacctgccg taccatatat ttgttcgaag ttcttactct 2040

ctgacgagtt cggtaacaca ttttccgttc cagatccatt gcgcgaggtt cagcggttag 2100

gaacaaagaa aattccctat tctgacaatg atgaattctt gtttgctcac ttcatgagct 2160

ttgttgatcg attgaagttt ttggaccgaa tgtctcagtc gtgtatcgat caactttcga 2220

ttttcttcga attgaaatac aagaagtctg gggaagaggc tgctttaatg ttaggcgcct 2280

ttaagaagta taccgctaat ttccagtcct acaaagaact ctattattca gatcgtcgtc 2340

agtgcgaatt gatcaattcg ttttgtagta cagagttcag ggttgagcgt gtaaattcca 2400

acaaacagcg aaagaattat ggaattgaac gtaggtgcaa tgacaaacgt cgaactccaa 2460

ctggctcgta tggtggaggc gaagaagcag agacgaaggt ctcacaaaca gaatcgacgg 2520

gaacgaggtc acaaaagtcc cagcgagaga gcgcgttcaa atctcagact attccgcttc 2580

ctaccgttct atcaagtgga tggttcggaa ctgacagggt catgccgcca tgtgaacgtg 2640

gcggagttac ccgagtctga taatagggat ccagctgtac atgggcaccg gaaggaatga 2700

cacgttcaca tacgctggat gccaagggct aaccaagccg aaagtacaaa ttgtgttgga 2760

ccacaacacc caagtgtgta gtgcgaatgt gatgtacacg gcactctcta gagctaccga 2820

caggattcac ttcgtgaaca caagtgcaaa ctcttcggcc ttctgggaaa agcccggggg 2880

cctctcgttt agagttatcg gcggaagacc atgattttga cgatacagat tggttcgccg 2940

gtaacgaatg ggcggaaggt gctttctgaa acctcccctt ccgcatctcc ctccggtttt 3000

ctgtggcggg agctgagttg gcagtattgc tataaactgt ctgaagtcac taaacacatt 3060

gtggtgaacg ggttgtccat ccagcttacg gctaaaatgg tcagtcgtag aggaatctac 3120

gccagcagac ttacaagtct ctgaggcacc tttgaaacca tctcctaggt ttcttcggaa 3180

ggacttcggt ccgtgtactt ctagcacaac gtgctagttt cagggtacgg gtgcccccca 3240

cttttgtggg gcctccaaaa ggagacca 3268

<210> 3

<211> 26

<212> DNA

<213> Artificial sequence

<400> 3

atggatccag ctgtacatgg gcaccg 26

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

atcccgggac ttttcccaga aggccgaaga 30

<210> 5

<211> 44

<212> DNA

<213> Artificial sequence

<400> 5

tcggatccac tagtcccggg gcctctcgtt tagagttatc ggcg 44

<210> 6

<211> 36

<212> DNA

<213> Artificial sequence

<400> 6

atggatccct attactcaga ctcgggtaac tccgcc 36

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

agaatcgacg ggaacgaggt 20

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence

<400> 8

ggggaggttt cagaaagcac c 21

Claims (4)

1. A bivalent attenuated vaccine for resisting cucumber mosaic virus and potato virus Y, which contains CMV_FnyMutant RNA2 of the isolate; the CMV_FnyMutant RNA2 of the isolate is in CMV_FnyThe RNA2 full-length sequence of the isolate is inserted with TAATAG and a conserved sequence of potato virus Y after position 2661; the nucleotide sequence of the inserted conserved sequence of the potyvirus is shown as SEQ ID NO. 1; the CMV_FnyThe nucleotide sequence of mutant RNA2 of the isolate is shown in SEQ ID NO. 2.

2. The method for constructing a bivalent attenuated vaccine against cucumber mosaic virus and potato virus Y of claim 1, which comprises the following steps:

(1) with CMV_FnyRNA2 infectious clone plasmid pCB301-CMV_Fnyusing-R2 as template, obtaining intermediate carrier pCC by inverse PCR amplification technology_FR2-2bPT II; the intermediate vector pCC_FInserting TAATAG at the 2661 position of R2-2bPT II, and then sequentially introducing enzyme cutting sites of BamH I, SpeI and Sma I;

(2) the conserved sequence of the potato virus Y shown in SEQ ID NO.1 is inserted into an intermediate vector pCC by utilizing an enzyme digestion and connection method_FR2-2bPT II, to construct bivalent mutant plasmid vector pCC for resisting cucumber mosaic virus and potato virus Y_FR2-2bPT Ⅱ-PY_2810-3009。

3. The use of the bivalent attenuated vaccine against both cucumber mosaic virus and potato virus Y as claimed in claim 1 for the control of cucumber mosaic virus and potato virus Y.

4. A method for preventing and controlling cucumber mosaic virus and potato virus Y is characterized by comprising the following steps:

the combination of the dual attenuated vaccine of claim 1 against cucumber mosaic virus and potyvirus with CMV_FnyThe isolates were inoculated with a mixture of RNA1 and plasmid RNA 3.

Images