CN110734912A

CN110734912A - Partial sequence of internal reference gene of sitobion avenae, cloning method and application

Info

Publication number: CN110734912A
Application number: CN201910608195.0A
Authority: CN
Inventors: 朱勋; 李祥瑞; 张云慧; 阎维巍; 程登发; 李新安; 任智萌; 龚培盼; 王超; 魏长平; 杨超霞; 李亚萍; 殷新田
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2019-07-08
Filing date: 2019-07-08
Publication date: 2020-01-31
Anticipated expiration: 2039-07-08
Also published as: CN113832157B; CN110734912B; CN113832158A; CN113862275B; CN113832157A; CN113862275A

Abstract

The invention discloses a partial sequence of a reference gene of a sitobion avenae, a cloning method and application, belongs to the field of molecular biology, and particularly relates to the reference genes SA-HEL, SA-RPL14, SA-SA-RPL11 and SA-28S of the sitobion avenae, wherein the nucleotide sequences are respectively shown as SEQ ID No.1, SEQ ID No.6, SEQ ID No.11 and SEQ ID No. 16.

Description

Partial sequence of internal reference gene of sitobion avenae, cloning method and application

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a part sequence of a reference gene SA-HEL, SA-RPL14, SA-SA-RPL11 or SA-28S of sitobion avenae, a cloning method and application of the reference gene in RT-qPCR.

Background

The Aphis graminicola (Sitobion avenae Fabricius) belongs to the homoptera, Aphidae, is which is the main pest of wheat crops in China, has more host types, is harmful to gramineae crops such as wheat, barley, oat and the like, is harmful to gramineae and cyperaceae weeds such as rice, sorghum, corn, sugarcane and the like, and is also harmful to gramineae and cyperaceae weeds such as blue grass, alopecurus, digitaria sanguinalis, club grass, green bristlegrass and aegilops tauschii, has the characteristics of large quantity and strong fertility in distribution , influences the normal growth of wheat plants, causes serious reduction of the wheat yield, causes huge loss to agricultural production, can reduce the yield of the wheat by 5.1-16.5% in years, reduces the yield of the wheat by more than 40% in the large-occurring years, is generally wingless, can be regulated by external environmental conditions and biological factors to generate winged aphids, winged individuals can fly to virus plants in a long distance, and also find the aphid which is an important aphid spreading besides directly sucking the host.

The wingless parthenogenetic female aphid of the sitobion avenae has a length of 3.1mm, a width of 1.4mm, a long oval shape, a green grass to an orange red color, a slightly gray head and a gray green color spot on the ventral side. The tentacles, rostral distal nodes, tarsal nodes, abdominal ducts were black, and the tails were light in color. The sixth to eighth segments of the abdomen and the abdomen have cross reticulate pattern without edge tumor. The middle chest and abdomen fork short handle. The forehead tumour is markedly extroversion. The antenna is long and thin, the overall length is shorter than the body length, and the base of the third section has 1-4 secondary sensory circles. The beak is thick and larger than the midfoot node, and the end section is conical and 1.8 times wider than the base. The abdominal tube is cylindrical, 1/4 long and body long, and has tens of rows of cross-hatching at the end. The tail piece is in a long cone shape, the length of the tail piece is 1/2 of the abdominal tube, and 6-8 curly hairs are arranged. The winged parthenogenetic female aphid body is 3.0mm long, oval, green and black in tentacle, and 8-12 sensory circles are arranged in the third section to form 1 row. The beak does not reach the midfoot. The abdominal tube is long cylindrical and black, and the end part of the abdominal tube is provided with 15-16 rows of cross-line reticulate patterns. The anterior wing, the middle vessel, trifurcate, is widely divergent.

The Expression of the Gene is found to be different in vivo by the ribosome 847, the Gene Expression of the Gene is found to be different in vivo by the ribosome 849, the Gene Expression of the Gene is found to be different in the ribosome 848, the Gene Expression of the Gene is found to be different in the ribosome 847, the Gene Expression of the Gene, the Gene is found to be different in the ribosome 848, the Gene Expression of the Gene, the Gene is found to be different in vivo by the ribosome 848, the Gene Expression of the ribosome 848-Gene, the Gene is found to be different in the ribosome 847, the Gene Expression of the Gene, the Gene of the Gene, the Gene is found to be different in the ribosome 847, the Gene Expression of the Gene, the Gene of the Gene, the Gene of the insect 8-Gene, the Gene is found to be different in the Gene, the Gene was found to be different in the Gene, the insect, the Gene was found to be different in the Gene, the Gene Expression of the Gene, the Gene was found to be different in the Gene, the insect, the Gene was found to be different in the insect, the Gene was found to be different in the insect, the Gene, the insect.

Disclosure of Invention

The invention provides a partial sequence, a cloning method and application of a reference gene SA-HEL stably expressed by myzus avenae in different ages and different fin types, a reference gene SA-RPL14 stably expressed under different density treatment, a reference gene SA-SA-RPL11 stably expressed under the treatment of pheromone E- β -farnesene solution, and a reference gene SA-28S stably expressed under the treatment of pesticide or antibiotic.

The invention also provides specific primers for cloning the sitobion avenae SA-HEL, SA-RPL14, SA-SA-RPL11 and SA-28S, and establishes an RT-PCR method based on SYBR Green1 dye technology, so that a useful method is provided for research under the conditions that the SA-HEL, SA-RPL14, SA-RPL11 and SA-28S of the sitobion avenae are used as reference genes, and qPCR is utilized to express functional genes of the sitobion avenae or genes in different development periods, and the pteroid differentiation of the sitobion avenae is used as different density treatment, or used as pheromone E- β -farnesene solution treatment, or used as insecticide or antibiotic treatment.

The technical scheme provided by the invention is as follows: the avenae gene fragment is an SA-HEL gene fragment, an SA-RPL14 gene fragment, an SA-RPL11 gene fragment or an SA-28S gene fragment, and the nucleotide sequences of the avenae gene fragment are respectively shown as SEQ ID No.1, SEQ ID No.6, SEQ ID No.11 and SEQ ID No. 16. On the basis of carrying out full analysis and research on the gene sequences, the method avoids the cervical loop structure and non-specific amplification at a specific temperature, ensures the amplification efficiency meeting the conditions, and obtains the gene fragments through design and screening.

The invention also provides a cloning method of kinds of sitobion avenae gene partial sequences, which comprises the steps of extracting the total RNA of the sitobion avenae genome, carrying out RT reaction by taking a mixed primer carried by a kit as a reaction primer, carrying out RT-PCR amplification by taking the th chain cDNA of a product as a template and respectively taking a primer pair SA-HEL-F/SA-HEL-R, SA-RPL14-F/SA-RPL14-R, SA-RPL11-F/SA-RPL11-R, SA-28S-F/SA-28S-R to obtain positive clones, and finally carrying out sequencing verification, wherein the sequences of the primer pair are as follows:

SA-HEL-F：5’-ACTGGTTTGAACGAATATG-3’；

SA-HEL-R：5’-CATCCAAATAGTGTGTAAGA-3’；

the obtained target fragment has a size of 805 bp.

SA-RPL14-F：5’-AATGTGAGGTTATGATTGTC-3’；

SA-RPL14-R：5’-TTAAACAGTGCTTGGTAG-3’；

The size of the obtained target fragment was 500 bp.

SA-RPL11-F：5’-TCGTGTTGTTTCGCTTCGTC-3’；

SA-RPL11-R：5’-TGATACCCAAATCGATGTGTTCTTG-3’；

The size of the obtained target fragment was 418 bp.

SA-28S-F：5’-CGAGTGAGCCAGAAACACAT-3’；

SA-28S-R：5’-ATCCCCAGTCTTTGGCCTTTT-3’；

The obtained target fragment had a size of 617 bp.

In the cloning method, the reaction system for PCR amplification is as follows: 10 XPCR Buffer 2.5. mu.L, 2.5mmol/LdNTP 2.0. mu.L, 25.0mmol/L MgCl₂2.0. mu.L, 5.0U/. mu.L TaqDNA polymerase 0.5. mu.L, 10.0. mu.M upstream and downstream primers 1.0. mu.L each, cDNA 2.5. mu.L, ddH₂Make up to 25. mu.L of O. The reaction conditions were as follows: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30sec, annealing at 60 ℃ for 30sec, and cooling to 0.5 ℃ and extension at 72 ℃ for 1mim for 30 cycles each; denaturation at 94 ℃ for 30sec, re-annealing at 45 ℃ for 30sec, and re-extension at 72 ℃ for 1mim for 10 cycles; finally, the temperature is leveled off at 72 ℃ for 7min, and the termination temperature is 8 ℃.

The invention also provides a method for amplifying the partial sequence of the sitobion avenae gene by qPCR, which comprises the steps of extracting the total RNA of the sitobion avenae genome, carrying out RT reaction by taking a self-contained mixed primer of a kit as a reaction primer, carrying out fluorescent quantitative PCR amplification by taking the chain cDNA of a product as a template, wherein the fluorescent dye is SYBR Green1, the sequence of the quantitative primer of the sitobion avenae in the quantitative PCR amplification is as follows:

QSA-HEL-F：5’-TGCTACCGGATGTGGGAAAA-3’；

QSA-HEL-R：5’-TCCAGCCACGTTCTCTGTTT-3’；

the size of the obtained target fragment was 152 bp.

QSA-RPL14-F：5’-AAGCACCACAGTTCCAAGCG-3’；

QSA-RPL14-R：5’-ACTCGGCCAGTTTCCACAAA-3’；

The size of the obtained target fragment was 116 bp.

QSA-RPL11-F：5’-CGTGTTGTTTCGCTTCGTCT-3’；

QSA-RPL11-R：5’-CTTTAAGTCGGCGAGGACCA-3’；

The size of the obtained target fragment was 91 bp.

QSA-28S-F：5’-TCTATCAACCGGCAACCACA-3’；

QSA-28S-R：5’-TGGCGAATCTCGTTGCATTT-3’；

The size of the obtained target fragment was 109 bp.

The reaction conditions for the fluorescent quantitative PCR amplification are as follows: pre-denaturation at 95 ℃ for 15 min; 40 cycles of denaturation at 95 ℃ for 10sec, annealing at 60 ℃ for 32sec were run, followed by dissolution profile phase at 95 ℃ for 15sec, 60 ℃ for 1min, 95 ℃ for 30sec, and 60 ℃ for 15 sec.

The SA-HEL gene fragment of the sitobion avenae disclosed by the invention can be used as an internal reference gene and applied to functional genes or gene expression in different development periods of the sitobion avenae and application of quantitative PCR detection of gene expression in vivo of the winged aphid and the wingless aphid.

The SA-RPL14 gene segment of the sitobion avenae can be used as an internal reference gene and applied to the functional gene of the sitobion avenae or the application of gene expression quantitative PCR detection under different density treatments.

The gene fragment SA-RPL11 of the sitobion avenae can be used as an internal reference gene and applied to the quantitative PCR detection of gene expression under the treatment of a functional gene or a pheromone E- β -farnesene solution of the sitobion avenae.

The gene fragment of the sitobion avenae SA-28S can be used as an internal reference gene and applied to the application of gene expression quantitative PCR detection under the treatment of a functional gene of the sitobion avenae or an insecticide or an antibiotic.

According to the sequencing result of the angiomyzus horridus transcriptome, the nucleotide sequence of SA-HEL gene, SA-RPL14 gene, SA-RPL11 gene or SA-28S gene is obtained by analyzing and annotating, partial sequences of SA-HEL, SA-RPL14 gene, SA-RPL11 gene or SA-28S gene housekeeping gene of the angiomyzus horridus are cloned, corresponding specific quantitative primers are designed, on the basis of fully analyzing and researching the gene sequences, the cervical ring structure and non-specific amplification are avoided, and the amplification efficiency of the primers is ensured to meet the conditions in the design process of the primers, an RT-PCR method based on SYBR Green1 dye technology is established, so that the RT-PCR method is used for expressing the SA-HEL, SA-RPL14, SA-RPL11 or SA-28S of the angiomyzus as an internal reference gene, and is used for processing the functional gene of the angiomyzus horridus as an insecticidal gene or as a different developmental period genotype, or as a different density differentiation treatment or as an antibiotic under the research of a nisin β or a useful method under the utilization of PCR.

Compared with the prior art, the invention has the following advantages:

1. the SA-HEL gene fragment, the SA-RPL14 gene, the SA-RPL11 gene or the SA-28S gene of the sitobion avenae are obtained by first cloning;

2. the invention firstly proposes to establish a universal reference gene in the quantitative PCR detection of the sitobion avenae;

3. the invention firstly proposes the quantitative PCR detection of the SA-HEL gene of the sitobion avenae as an internal reference gene in different development periods of the sitobion avenae, the quantitative PCR detection of the SA-RPL14 gene of the sitobion avenae as an internal reference gene in different density treatments of the sitobion avenae, the quantitative PCR detection of the SA-RPL11 gene of the sitobion avenae as an internal reference gene in the treatment of a sitobion avenae pheromone E- β -farnesene solution, the quantitative PCR detection of the SA-28S gene of the sitobion avenae as an internal reference gene in the treatment of a sitobion avenae insecticide;

4. the invention firstly proposes that the SA-HEL gene of the sitobion avenae can be used as an internal reference gene to relatively quantify the relative expression level of the genes in the winged aphids and the wingless aphids;

5. the invention firstly proposes the quantitative PCR detection of the SA-28S gene of the sitobion avenae as the reference gene under the treatment of the sitobion avenae antibiotic;

6. the detection primer provided by the invention has specificity, optimizes a PCR amplification program, greatly improves the detection efficiency, shortens the detection time and improves the reliability of a detection result.

Drawings

FIG. 1 is a PCR electrophoresis diagram of a reference gene of sitobion avenae SA-HEL; m is DNA molecular weight standard;

FIG. 2 is a melting curve of a reference gene of Aphis avenae SA-HEL;

FIG. 3 is a standard curve of a reference gene of sitobion avenae SA-HEL;

FIG. 4 shows the relative expression levels of the SA-HEL reference gene in different stages of Aphis gramineus.

FIG. 5 is a PCR electrophoresis of the reference gene of Adenophora avenae SA-RPL 14; m is DNA molecular weight standard;

FIG. 6 is a melting curve of a reference gene of Aphis avenae SA-RPL 14;

FIG. 7 is a standard curve of the reference gene of sitobion avenae SA-RPL 14;

FIG. 8 shows the relative expression levels of the SA-RPL14 reference gene in Myzus avenae density-independent treatment.

FIG. 9 is a PCR electrophoretogram of a reference gene of Adenophora avenae SA-RPL 11; m is DNA molecular weight standard;

FIG. 10 is a melting curve of a reference gene of Aphis avenae SA-RPL 11;

FIG. 11 is a standard curve of the reference gene for A. hordei SA-RPL 11.

FIG. 12 is a PCR electrophoresis of a reference gene of Aphis avenae SA-28S; m is DNA molecular weight standard;

FIG. 13 is a melting curve of a reference gene of Aphis avenae SA-28S;

FIG. 14 is a standard curve of a reference gene for Aphis avenae SA-28S;

FIG. 15 shows the relative expression levels of the SA-28S reference gene in Aphis graminicola insecticide treatment.

Detailed Description

The invention is further illustrated by the following detailed description of specific embodiments, but is not intended to be limiting and is presented by way of example only.

Example 1 cloning of SA-HEL Gene, SA-RPL14 Gene, SA-RPL11 Gene or SA-28S Gene of Myzus avenae

1. Extracting total RNA of the avenae:

total RNA of Aphis gramineus was extracted using TRizol (Amion, USA) as follows: taking a 30mg wingless adult aphid avenae sample, fully grinding the wingless adult aphid avenae sample in liquid nitrogen, then quickly adding 1ml of Trizol lysate, fully oscillating for 20s, and standing for 5-10 minutes; adding 200 μ L chloroform, shaking for 20s, standing for 5min, and centrifuging at 4 deg.C at 12,000rpm for 15 min; adding the supernatant into a centrifugal tube containing 2.5 times of anhydrous ethanol, reversing, mixing, standing for 10min, and storing in a refrigerator at-80 deg.C for 2-4 hr; taking out the sample, and centrifuging at 7500rpm at 4 ℃ for 10 min; discarding the supernatant, adding 1ml of 75% ethanol, washing the precipitate twice, and centrifuging at 4 ℃ at 12,000rpm for 10 min; adding 30 mu L of RNase-free water to dissolve the precipitate; detecting the integrity of RNA by using 1% agarose gel electrophoresis, detecting the concentration and the mass of the extracted total RNA by using an ultramicro ultraviolet spectrophotometer Beckman DU700, wherein an RNA sample with a mass parameter of 1.9 < A260/280 < 2.1 and 2.0 < A260/230 < 2.4 is a qualified sample, and storing the qualified sample in a refrigerator at-80 ℃ for later use.

2. Reverse transcription

The reverse transcription is carried out by utilizing TAKARA PrimeScript 1st Strand cDNA synthesis kit, and the specific operation steps are as follows: adding 1 mu g of total RNA of the Aphis avenae into a sterile PCR tube, adding 1 mu of LOlogo dT Primer and 1 mu of LdNTPmix, and supplementing 10 mu of sterile deionized water without RNase; mixing, heating at 65 deg.C for 5min, and rapidly cooling on ice; to 10. mu.L of the reaction mixture were added 4. mu.L of 5 XPrimeScript Buffer, 0.5. mu.L of RNase Inhibitor, 1.0. mu.L of PrimeScript RTase, and 4.5. mu.L of RNase free H₂And O, carrying out reverse transcription reaction on a PCR instrument, wherein the reaction procedure is that after 60min of warm bath at 42 ℃, inactivation at 95 ℃ is carried out for 5min, ice is placed on the reaction product after the reaction is finished, and the synthesized th chain cDNA is placed at the temperature of 20 ℃ below zero for short-term storage or the temperature of 80 ℃ below zero for long-term storage.

Design of PCR amplification primer sequences

Upstream primer of SA-HEL (SEQ ID NO. 2): 5'-ACTGGTTTGAACGAATATG-3', respectively;

downstream primer of SA-HEL (SEQ ID NO. 3): 5'-CATCCAAATAGTGTGTAAGA-3' are provided.

Upstream primer of SA-RPL14 (SEQ ID NO. 7): 5'-AATGTGAGGTTATGATTGTC-3', respectively;

downstream primer of SA-RPL14 (SEQ ID NO. 8): 5'-TTAAACAGTGCTTGGTAG-3', respectively;

upstream primer of SA-RPL11 (SEQ ID NO. 12): 5'-TCGTGTTGTTTCGCTTCGTC-3', respectively;

downstream primer of SA-RPL11 (SEQ ID NO. 13): 5'-TGATACCCAAATCGATGTGTTCTTG-3', respectively;

upstream primer of SA-28S (SEQ ID NO. 17): 5'-CGAGTGAGCCAGAAACACAT-3', respectively;

downstream primer of SA-28S (SEQ ID NO. 8): 5'-ATCCCCAGTCTTTGGCCTTTT-3' are provided.

Obtaining the nucleic acid partial sequences of the candidate reference genes of the avenae HEL, SA-RPL14, SA-RPL11 and SA-28S from the avenae transcriptome. The above primers were used to analyze the secondary structure of the gene nucleic acid part sequence using UNAFold online software (http:// mfold. rna. albany. edu/: a melttempoperation, 60 ℃; DNA sequence, linear; na + concentration, 50 mM; mg2+ concentration, 3 mM; the other option is initial setup. After obtaining the locus containing the stem-loop structure of the gene template sequence, a Primer is designed by using NCBI-Primer-BLAST online software (http:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST/index. cgi: a primer long temperature, 57-63 ℃; primer GC content, 40-60%; PCR product size, 500-; excludedregines, stem-loop structural sites; the other option is initial setup.

4. Polymerase Chain Reaction (PCR)

PCR amplification is carried out by using th chain cDNA obtained by RT as template, wherein the reaction system is 10 XPCR Buffer 2.5 uL, 2.5mmol/L dNTP 2.0 uL, 25.0mmol/L MgCl₂2.0. mu.L, 5.0U/. mu.L TaqDNA polymerase 0.5. mu.L, 10.0. mu.M upstream and downstream primers 1.0. mu.L each, cDNA 2.5. mu.L, ddH₂Make up to 25. mu.L of O. The reaction conditions were as follows: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30sec, annealing at 60 ℃ for 30sec, and cooling to 0.5 ℃ and extension at 72 ℃ for 1mim for 30 cycles each; denaturation at 94 ℃ for 30sec, re-annealing at 45 ℃ for 30sec, and re-extension at 72 ℃ for 1mim for 10 cycles; finally, the temperature is leveled off at 72 ℃ for 7min, and the termination temperature is 8 ℃. The PCR product was subjected to 1% agarose gel electrophoresis to detect the target fragment (see FIGS. 1, 5, 9 and 12).

5. Obtaining target gene fragment and sequence determination

And (2) performing gel recovery on the PCR products after agarose gel electrophoresis, respectively linking the recovered and purified DNA fragments to a vector pMD17-T Vevtor, transforming the DNA fragments into escherichia coli DH5 α competent cells, screening by Amp antibiotics to obtain positive clone strains into which target fragments are inserted, and performing nucleotide sequence determination to respectively obtain nucleotide sequences of the Myzus avenae SA-HEL, SA-RPL14, SA-RPL11 and SA-28S, wherein the specific sequences are respectively shown as SEQ ID No.1, SEQ ID No.6, SEQ ID No.11 and SEQ ID No. 16.

Example 2 design and Synthesis of fluorescent quantitative PCR amplification primers

Primers for fluorescent quantitative PCR of the gene were designed based on the NCBI of Aphis avenae and the sequence of each gene fragment cloned in example 1. The secondary structure of the nucleic acid part sequence of each gene was analyzed using unaford online software (http:// mfold. rna. albany. edu/: a long temperature, 60 ℃; DNA sequence, linear; na + concentration, 50 mM; mg (magnesium)²⁺After obtaining the site containing the stem-loop structure of each gene template sequence, NCBI-Primer-BLAST online software (http:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST/index. cgi:

QSA-HEL-F(SEQ ID NO.4)：5’-TGCTACCGGATGTGGGAAAA-3’；

QSA-HEL-R(SEQ ID NO.5)：5’-TCCAGCCACGTTCTCTGTTT-3’。

QSA-RPL14-F(SEQ ID NO.9)：5’-AAGCACCACAGTTCCAAGCG-3’；

QSA-RPL14-R(SEQ ID NO.10)：5’-ACTCGGCCAGTTTCCACAAA-3’；

QSA-RPL11-F(SEQ ID NO.14)：5’-CGTGTTGTTTCGCTTCGTCT-3’；

QSA-RPL11-R(SEQ ID NO.15)：5’-CTTTAAGTCGGCGAGGACCA-3’；

QSA-28S-F(SEQ ID NO.19)：5’-TCTATCAACCGGCAACCACA-3’；

QSA-28S-R(SEQ ID NO.20)：5’-TGGCGAATCTCGTTGCATTT-3’。

example 3 fluorescent quantitative PCR detection of SA-HEL Gene in Myzus avenae FinForming Aphis and Africana FinForming Aphis

1. Extracting total RNA of the winged adult aphids and the wingless adult aphids of the sitobion avenae:

total RNA of sitobion avenae Fin aphids and sitobion avenae finless were extracted respectively by TRizol (Amion, USA), and the specific method was the same as the method of extracting total RNA of sitobion avenae in example 1.

2. Reverse transcription

3. Fluorescent quantitative PCR amplification primer synthesis

Fluorescent quantitative PCR upstream primer (SEQ ID NO. 4): 5'-TGCTACCGGATGTGGGAAAA-3', respectively;

fluorescent quantitative PCR downstream primer (SEQ ID NO. 5): 5'-TCCAGCCACGTTCTCTGTTT-3' are provided.

4. Fluorescent quantitative PCR

The qPCR reaction system based on SYBR Green I dye is SsoFast EvaGreen Supermix 10. mu.L, upstream and downstream primers (10.0. mu.M) 1.0. mu.L, cDNA1.0. mu.L, ddH₂Make up to 20. mu.L of O. The reaction conditions for the fluorescent quantitative PCR amplification are as follows: pre-denaturation at 95 ℃ for 15 min; 40 cycles of denaturation at 95 ℃ for 10sec, annealing at 60 ℃ for 32sec were run, and then dissolution was runThe curve phase was 95 ℃ for 15sec, 60 ℃ for 1min, 95 ℃ for 30sec, and 60 ℃ for 15 sec.

5. Amplification efficiency of primers

series of gradient dilutions were performed using the Myzus avenae wingless adult cDNA as a template, and real-time fluorescence quantitative PCR was performed to prepare a standard curve of amplification efficiency of primers, which was calculated as follows, amplification efficiency (E) ═ 10^{1/slope [ - ]]}-1)×100。

6. Results of the experiment

The specificity of an amplification product is judged by combining a melting curve (figure 2), a quantitative cycle (Cq) and an amplification curve (amplification plot) according to quantitative PCR reaction programs, the specificity of the amplification product is judged by combining the melting curve, an ideal melting curve is a unimodal curve, the SA-HEL gene detection of the samples of the winged aphid and the wingless aphid shows the unimodal curve, the non-specific amplification of primer dimers and the like is generated, the fluorescence quantitative PCR amplification primers (SEQ ID No.4 and 5) related to the invention are used for amplifying a single band, the specificity is strong, the non-specific amplification is not generated, the fluorescence quantitative amplification curves of the winged aphid and the wingless aphid related to the invention are used for obtaining a linear amplification coefficient of the amplification products of the winged aphid and the wingless aphid, the fluorescence quantitative amplification curve of the winged aphid are used for a linear amplification product, the amplification coefficient of the Mylophaga linear amplification curve is used for drawing a linear amplification coefficient of the Mylophaga basal linear amplification curve of the Mylophaga avena and the Mylophaga finless Mylophaga gene amplification curve, and a linear amplification coefficient of the Mylophaga gene is used for drawing a basal linear amplification of a basal line of a Mylophaga-11 in a linear amplification curve, the background-A-a linear amplification curve, the fluorescence quantitative amplification curve is obtained by taking a linear amplification curve as a linear amplification curve, the linear amplification curve of the PCR amplification of the Mylophaga zoophophorus ave series of the Mylophagus-11-A-²) At 0.994, the slope of the fitted curve was substituted into the primer amplification efficiency calculation: (10) amplification efficiency (E)^{1/slope [ - ]]}-1) x 100, the amplification efficiency is calculated to be 103%, the amplification efficiency of the primer is about 100%, and the amplification of the primer is shownThe efficiency of amplification is very high, and the fluorescent quantitative PCR detection method accords with the internal reference gene of the fluorescence quantitative PCR detection of the winged adult aphids and the wingless adult aphids of the sitobion avenae.

Example 4 fluorescent quantitative PCR detection of SA-HEL Gene at different development stages of Aphis avenae

1. Extracting total RNA of the avenae:

respectively extracting total RNA of 1-year nymphs, 2-year nymphs, 3-year nymphs, 4-year nymphs, adults and the like which are not less than and less than the Aphis graminicola, collecting the Aphis graminicola samples of different development periods, namely collecting about 40 1-year nymphs, 30-year nymphs, 20-year nymphs and 4-year nymphs in each tube, and 20-year wingless adult aphids, wherein the method comprises the steps of collecting 4 tubes in each development period, quickly freezing the tubes in liquid nitrogen, performing short-term storage at-80 ℃, taking 30mg samples, fully grinding the samples in liquid nitrogen, quickly adding 1ml Trizol solution, fully oscillating for 20s, standing for 5-10 minutes, adding 200 muL chloroform, oscillating for 20s, standing for 5 minutes, centrifuging for 15min at 12,000rpm at 4 ℃, taking supernatant, adding the supernatant into a centrifugal tube containing 2.5 volumes of absolute ethyl alcohol, performing reverse mixing, standing for 10min, storing for 2-4 hours in a refrigerator, taking out the sample, performing centrifugation at 3500 min, adding 0.00-10 rpm, adding a supernatant, performing precipitation on a gel, and detecting the concentration of the supernatant in 0.9% of 100.00-10.00-10 ℃ agarose gel, and detecting the supernatant by using a UV-10.9-10 ℃ electrophoresis, and detecting the concentration of the supernatant by using a supernatant of the supernatant, and the supernatant of the supernatant, and detecting the supernatant by using a supernatant, and detecting the.

2. Reverse transcription

Reverse transcription was performed using TAKARA PrimeScript 1st Strand cDNA Synthesis kit, the procedure was the same as in example 3.

3. Fluorescent quantitative PCR amplification primer synthesis

4. Fluorescent quantitative PCR

The qPCR reaction system based on SYBR Green I dye is SsoFast EvaGreen Supermix 10. mu.L, upstream and downstream primers (10.0. mu.M) 1.0. mu.L, cDNA1.0. mu.L, ddH₂Make up to 20. mu.L of O. The reaction conditions for the fluorescent quantitative PCR amplification are as follows: pre-denaturation at 95 ℃ for 15 min; 40 cycles of denaturation at 95 ℃ for 10sec, annealing at 60 ℃ for 32sec were run, followed by dissolution profile phase at 95 ℃ for 15sec, 60 ℃ for 1min, 95 ℃ for 30sec, and 60 ℃ for 15 sec.

5. Results of the experiment

The specificity of an amplification product is judged by combining a melting curve (multisturve), a quantitative cycle (Cq) and an amplification curve (amplification plot) through carrying out quantitative PCR amplification on genome RNA samples of the myzus avenae at different development stages, such as 1st nymph, 2 nd nymph, 3 rd nymph, 4 th nymph and imago according to a quantitative PCR reaction program, and the specificity of the amplification product is judged by combining the melting curve, wherein the ideal melting curve is a unimodal curve, and the analysis of the melting curve of the primer shows that the SA-HEL gene detection of samples of the myzus avenae at different development stages, such as 1st nymph, 2 nd nymph, 3 nd nymph, 4 th nymph and imago shows a unimodal curve, no specific amplification of primer dimers and the like is generated, so that the amplification strip single of the fluorescent quantitative PCR amplification primers (ID No.4 and SEQ 5) related to the invention has strong specificity, no specific amplification of the SA-HEL gene analysis shows that the SA-HEL gene amplification bands of the single amplification band are not generated in the PCR amplification of the single-amplified genes of the samples of the myzus avenae at different development stages, and the SA-HEL gene expression of the different development stages is not obvious and can be used for quantitative PCR analysis of the samples of the myzus avenae at different development stages, and the PCR analysis of the PCR detection of the different development stages, the SA-SA can.

Example 5 fluorescent quantitative PCR detection of SA-RPL14 Gene at different Density treatment of Aphis gramineus

1. Extracting total RNA of the avenae:

treating 3-year-old Aphis citricola of Aphis graminicola with different densities according to 1 head/dish, 30 heads/dish and 60 heads/dish, collecting aphid samples after treating for 24 hours, and respectively extracting total RNA of the Aphis graminicola under each treatment by utilizing TRizol (Amion, USA), wherein the specific method is the same as that in example 1.

2. Reverse transcription

3. Fluorescent quantitative PCR amplification primer synthesis

Fluorescent quantitative PCR upstream primer (SEQ ID NO. 9): 5'-AAGCACCACAGTTCCAAGCG-3', respectively;

fluorescent quantitative PCR downstream primer (SEQ ID NO. 10): 5'-ACTCGGCCAGTTTCCACAAA-3' are provided.

4. Fluorescent quantitative PCR

5. Amplification efficiency of primers

6. Results of the experiment

The present invention performs quantitative PCR amplification on genomic RNA samples of Oncorhynchus avenae with and without wings according to a quantitative PCR reaction program to obtain a melting curve (shown in FIG. 6), a quantitative cycle (Cq) and an amplification curve (amplification plot). The specificity of the amplification product is judged by combining with the melting curve, and the ideal melting curve should be a unimodal curve. Primers from this experimentThe fusion curve analysis shows that SA-RPL14 gene detection of the samples of the winged aphids and the wingless aphids of the sitobilla avenae shows a single peak curve and no non-specific amplification such as primer dimer is generated, which indicates that the fluorescent quantitative PCR amplification primers (SEQ ID No.5 and 10) related to the invention amplify a single band with strong specificity and no non-specific amplification is generated²) At 0.9945, the slope of the fitted curve was substituted into the primer amplification efficiency calculation: (10) amplification efficiency (E)^{1/slope [ - ]]}-1) x 100, and calculating to obtain the amplification efficiency of 104%, wherein the amplification efficiency of the primer is about 100%, which indicates that the amplification efficiency of the primer is very high and meets the requirement of being used as an internal reference gene for fluorescent quantitative PCR detection of the sitobion avenae under different density treatment. Analysis of the expression of the SA-RPL14 gene in different density-treated samples of the Aphis citricola (as shown in FIG. 8), and statistical analysis of Cq values of the SA-RPL14 gene in 1, 30 and 60 samples of the Aphis citricola, found that the SA-RPL14 gene can be stably expressed and has no significant difference (P-RPL 14 gene is not significantly different) in different density-treated samples of the Aphis citricola (as shown in FIG. 8)>0.05), which shows that the SA-RPL14 gene can be used as an internal reference gene for fluorescence quantitative PCR detection of functional genes in different-density processed samples of the sitobion avenae.

Example 6 fluorescent quantitative PCR detection of SA-RPL11 Gene under treatment of Myzus avenae pheromone E- β -farnesene solution

1. Extracting total RNA of the avenae:

the method is as in example 1, and comprises the steps of treating adult Aphis gramineus of Aphis gramineus with pheromone E- β -farnesene solution, collecting aphid samples after treating for 24 hours, and respectively extracting total RNA of the treated Aphis gramineus by utilizing TRizol (Amion, USA).

2. Reverse transcription

3. Fluorescent quantitative PCR amplification primer synthesis

Fluorescent quantitative PCR upstream primer (SEQ ID NO. 14): 5'-CGTGTTGTTTCGCTTCGTCT-3', respectively;

fluorescent quantitative PCR downstream primer (SEQ ID NO. 15): 5'-CTTTAAGTCGGCGAGGACCA-3' are provided.

4. Fluorescent quantitative PCR

5. Amplification efficiency of primers

6. Results of the experiment

The present invention performs quantitative PCR amplification on genomic RNA samples of Oncorhynchus avenae with and without wings according to a quantitative PCR reaction program to obtain a melting curve (shown in FIG. 10), a quantitative cycle (Cq) and an amplification curve (amplification plot). The specificity of the amplification product is judged by combining with the melting curve, and the ideal melting curve should be a unimodal curve. The analysis of the primer melting curve in the experiment shows that the sitobion avenae has wings and does not have wingsThe invention can be seen from the fluorescence quantitative PCR amplification curves of the tubular aphids with wings and forming aphids and no wing and forming aphids, the primers are amplified under different dilution concentrations of the templates, the product amplification amount is subjected to amplification processes of a typical baseline, an exponential amplification period, a linear period, a platform period and the like, the gene can be used for amplifying SA-RPL11 genes in the tubular aphids with wings and forming aphids, the tubular aphids cDNA is subjected to -series 5-fold gradient dilution and then used as the template to perform real-time fluorescence quantitative PCR detection to obtain the Cq value of a -series template, the Cq value is used as a longitudinal coordinate, the dilution times are used as transverse coordinates, and the coefficient of the dilution is drawn as a 387y-equivalent curve (RPX: 64R 2-11) of the tubular aphids, and the coefficient is shown in a 387y-11-RPL 11-related map, namely a 387y curve, and the PCR amplification coefficient is matched with the PCR amplification primer dimer and the PCR amplification primer (SEQ ID No.14 and 15) amplification primer amplification band²) At 0.9997, the slope of the fitted curve was substituted into the primer amplification efficiency calculation: (10) amplification efficiency (E)^{1/slope [ - ]]}-1) x 100, the amplification efficiency of which is 91% obtained by calculation, the amplification efficiency of which is about 100%, which indicates that the amplification efficiency of the primer is very high and meets the requirement as an internal reference gene for fluorescent quantitative PCR detection of the sitobion avenae.analysis of the Cq values of the SA-SA-RPL11 gene in the sitobion avenae pheromone E- β -farnesene solution treatment sample and the SA-SA-RPL11 gene in the sitobion avenae pheromone E- β -farnesene solution treatment sample and a control group shows that the SA-SA-RPL11 gene can be stably expressed in the sitobion avenae pheromone E- β -farnesene solution treatment sample and has no significant difference (P-SA-RPL 3826 gene is not significantly different from the SA-SA-RPL11 gene in the sitobion>0.05), which shows that the SA-SA-RPL11 gene can be used as an internal reference gene for fluorescent quantitative PCR detection of functional genes in a sample treated by the aid of the nanotube pheromone E- β -farnesene solution.

Example 7 fluorescent quantitative PCR detection of SA-28S Gene under treatment with Amycolatopsis avenae antibiotic

1. Extracting total RNA of the avenae:

adult sitobion avenae is treated with rifampicin of 50 mug/ml for 24h, aphid samples are collected, and total RNA of the sitobion avenae under each treatment is extracted by TRizol (Amion, USA), and the specific method is the same as that in example 1.

2. Reverse transcription

3. Fluorescent quantitative PCR amplification primer synthesis

Fluorescent quantitative PCR upstream primer (SEQ ID NO. 19): 5'-TCTATCAACCGGCAACCACA-3', respectively;

fluorescent quantitative PCR downstream primer (SEQ ID NO. 20): 5'-TGGCGAATCTCGTTGCATTT-3' are provided.

4. Fluorescent quantitative PCR

5. Amplification efficiency of primers

6. Results of the experiment

The present invention quantitatively PCR-amplifies antibiotic-treated and control genomic RNA samples of myzus avenae according to a quantitative PCR reaction procedure to obtain a melting curve (fig. 13), a quantitative cycle (Cq), and an amplification curve (amplification plot). The specificity of the amplification product is judged by combining with the melting curve, and the ideal melting curve should be a unimodal curve. The analysis of the primer melting curve in the experiment shows that the SA-28S gene detection of the myzus persicae imago sample treated by the sitobion avenae antibiotic shows a single-peak curve, and the primer dimer is not contained, and the like, so that the yield is increased by non-specific amplificationThe invention can show that the pair of primers are amplified under different dilution concentrations of a template, the amplification increment of the product is subjected to typical amplification processes of a baseline, an exponential amplification period, a linear period, a plateau period and the like, the gene can be used for amplifying the SA-28S gene in the myzus persicae treated by the myzus persicae antibiotic, the cDNA of the myzus persicae imago is subjected to a series of 5-fold gradient dilution and then used as the template to carry out real-time fluorescent quantitative PCR detection to obtain the Cq value of a series of templates, the Cq value is used as a longitudinal coordinate, and the dilution multiple is used as a transverse coordinate to draw a fitting curve (shown in figure 14) of the SA-28S gene of the myzus persicae, wherein y is-3.0672 x +30.912, and the related coefficient (R30.912) is shown as²) At 0.9886, the slope of the fitted curve was substituted into the primer amplification efficiency calculation: (10) amplification efficiency (E)^{1/slope [ - ]]}-1) x 100, and calculating to obtain the amplification efficiency of 112%, wherein the amplification efficiency of the primer is about 100%, which indicates that the amplification efficiency of the primer is very high and meets the reference gene for fluorescent quantitative PCR detection of adult aphids treated by the sitobion avenae antibiotic.

Example 8 fluorescent quantitative PCR detection of SA-28S Gene under treatment of Amycolatopsis avenae insecticide

1. Extracting total RNA of the avenae:

applying pesticide (LC) with different concentrations to imago of Myzus avenae₂₀Lethality of 20% and LC₅₀Insecticide concentration with 50% mortality) were treated for 24h and aphid samples were collected. Selecting insecticides including imidacloprid, thiamethoxam and chlorpyrifos, performing bioactivity determination on the adult sitobion avenae, completely soaking wheat seedlings with the sitobion avenae in a test agent, standing for 10s, drying at room temperature for 5-10min, and placing in a 9cm culture dish. Using 0.1% Triton X-100 as control, collecting 4 tubes for each treatment, placing about 50 test insects in each tube, quick freezing in liquid nitrogen, and storing in refrigerator at-80 deg.C for short period. Total RNA of Myzus avenae was extracted from each of the treated Myzus avenae using TRizol (Amion, USA) in the same manner as in example 1.

2. Reverse transcription

3. Fluorescent quantitative PCR amplification primer synthesis

Fluorescent quantitative PCR upstream primer (SEQ ID NO 4): 5'-TCTATCAACCGGCAACCACA-3', respectively;

fluorescent quantitative PCR downstream primer (SEQ ID NO 5): 5'-TGGCGAATCTCGTTGCATTT-3' are provided.

4. Fluorescent quantitative PCR

5. Amplification efficiency of primers

6. Results of the experiment

The invention carries out quantitative PCR amplification on genomic RNA samples of winged adult aphids and wingless adult aphids of the sitobium avenae according to a quantitative PCR reaction program to obtain a melting curve (longitudinal curve), a quantitative cycle (Cq) and an amplification curve (amplification plot). the specificity of an amplification product is judged by combining the melting curve, an ideal melting curve should be a unimodal curve, and the SA-28S gene detection of the sitobium avenae insecticide-treated adult aphid sample shows the unimodal curve and the non-specific amplification such as No primer dimer and the like is generated by analyzing the primer melting curve of the experiment, thereby indicating that the fluorescent quantitative PCR amplification primers (SEQ ID No4 and 5) related to the invention have single amplification band , strong specificity and No non-specific amplificationThe invention can be seen from the fluorescent quantitative PCR amplification curve of the adult aphids treated by the pesticide of the tubular aphids, the pair of primers are amplified under different dilution concentrations of the template, the amplification increment of the product is subjected to typical amplification processes of baseline, exponential amplification period, linear period, platform period and the like, which shows that the gene can be used for amplifying SA-28S genes in the winged adult aphids and wingless adult aphids of the tubular aphids, the cDNA of the adult tubular aphids is subjected to series 5-fold gradient dilution and then taken as the template to carry out real-time fluorescent quantitative PCR detection to obtain the Cq value of series templates, the fitting curve of the SA-28S genes of the tubular aphids is drawn by taking the Cq value as the ordinate and the dilution multiple as the abscissa, wherein y is-3.0672 x +30.912, and the correlation coefficient (R is R) is²) At 0.9886, the slope of the fitted curve was substituted into the primer amplification efficiency calculation: (10) amplification efficiency (E)^{1/slope [ - ]]}-1) x 100, and calculating to obtain the amplification efficiency of 112%, wherein the amplification efficiency of the primer is about 100%, which indicates that the amplification efficiency of the primer is very high and meets the reference gene for fluorescent quantitative PCR detection treated as the pesticide of the sitobion avenae. Analysis of the expression of SA-28S gene in samples treated by different concentrations of pesticide of Aphis gramineus (as shown in FIG. 14), and statistical analysis of SA-28S gene in Mylopharyngodon piceus in LC₂₀、LC₅₀And Cq value in CK, the SA-28S gene is found to be stably expressed under different pesticide concentration treatments of the sitobion avenae, and the difference is not obvious (P)>0.05), which shows that the SA-28S gene can be used as an internal reference gene for the fluorescent quantitative PCR detection of a functional gene in a body of a pesticide-treated sample of the sitobion avenae.

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> partial sequence of internal reference gene of sitobion avenae, cloning method and application

<160>20

<210>1

<211>805

<212>DNA

<213> nucleotide sequence of SA-HEL Gene fragment

<400>1

ACTGGTTTGA ACGAATATGA AAAGGAAAAT GAAGAGTATA ATGAACTATC AAAAAAAGCT 60

TTACATGATT CAAATATGAG TTCTGTTGAT AGTATTTCTA ATGTAAATTC AGTGGCAGAT 120

CTGAAAGATT TGGATATAGA TGAAATTAAG CTTTTTGAAA ATTATAAATT CAAGGATCCA 180

TCGAATAAGT CTAATGATTT AGAAATTGCT GCATATAAAG ATAAGATAAT TTCAATTGTC 240

AATAGTAATA ATACAGTCGT GATATCTGGT GCTACCGGAT GTGGGAAAAG TACACAAGTT 300

CCTCAGTTTA TTTTAGATGA CTGTATGAGT AAAAAGAAAT ATTGTAATAT TATTGTTACT 360

CAACCTAGAC GTATAGCTGC AATTTCAGTA TCTAAACAAG TAAACAGAGA ACGTGGCTGG 420

AAAGATGGGC TTTTAGTCGG TTATCAAGTT GGGCGTAAAA AAGATTTTGA TCCTACCACA 480

ACAAAAATTT TATATTGCAC TACAGGAATT TTGTTACTAA GAATTATTAA AGCAAAGAGC 540

CTTGCTGAAT TTTCTCACAT TATCCTAGAC GAAGTTCATG AAAGAACACT TGAAATGGAT 600

TTTTTATTAT TAATTATAAA GAAGTTAAAA AAGAAAAACT ATGAGTCAAC TCGTGTAATA 660

CTAATGTCTG CCACAGCAGA CGCATTGAAA TTACAAGATT ATTTTGGTGA TTATTATGGA 720

CATCCTTATT ATAGACACGT AACAGCACCA TTAATTAAGA TCGAAAAGCC ATCTAACTAT 780

ACTATTCTTA CACACTATTT GGATG 805

<210>2

<211>19

<212>DNA

<213> PCR amplification upstream primer of SA-HEL

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>2

ACTGGTTTGAACGAATATG 19

<210>3

<211>20

<212>DNA

<213> PCR amplification downstream primer of SA-HEL

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>3

CATCCAAATAGTGTGTAAGA 20

<210>4

<211>20

<212>DNA

<213> qPCR amplification upstream primer of SA-HEL

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>4

TGCTACCGGATGTGGGAAAA 20

<210>5

<211>20

<212>DNA

<213> qPCR amplification downstream primer of SA-HEL

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>5

TCCAGCCACGTTCTCTGTTT 20

<210>6

<211>500

<212>DNA

<213> nucleotide sequence of SA-RPL14 Gene fragment

<400>6

AATGTGAGGT TATGATTGTC TTCTAAGCAC CACAGTTCCA AGCGTTTGGT TTCTCATTCT 60

TTTAGGTTCA ACAATCGACG TGTGAGAGAG CATTATTTCG GAAAAATGCC TTTCAAGAGG 120

TTTGTGGAAA CTGGCCGAGT GGTCTACGTT GTAGATGGTC CTTACAAAGG CAAAATTGTT 180

TCAATAGTCG ACTGCATCGA TCAAAAAACT GTTTTGGTAG ATGGACCAGA AACTGGAGTA240

CCCAGGTCAA AGATGCGTAT TAGCCAAATC CACTTGACCA AGTTTAAGAT TAATTTCCCT 300

TACAATGGAT CAACCAGGAC TGTTCGCCAA GCATGGAAAA AAGCCGATTT AAACAAATTG 360

TGGGTTCAAA GCAGGTGGGC AGAAAAAGCC GCCAACAGGG AGAAGCGTGC TTCTTTGGGC 420

GATTTTGAAA GATTTAAGCT TAAGAGAGCA AGAAAAATCA GAAACAAGAT CAGGACTAAC 480

GTCTACCAAG CACTGTTTAA 500

<210>7

<211>20

<212>DNA

<213> PCR amplification upstream primer of SA-RPL14

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>7

AATGTGAGGTTATGATTGTC 20

<210>8

<211>18

<212>DNA

<213> PCR amplification downstream primer of SA-RPL14

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>8

TTAAACAGTGCTTGGTAG 18

<210>9

<211>20

<212>DNA

<213> qPCR amplification upstream primer of SA-RPL14

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>9

AAGCACCACAGTTCCAAGCG 20

<210>10

<211>20

<212>DNA

<213> qPCR amplification downstream primer of SA-RPL14

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>10

ACTCGGCCAGTTTCCACAAA 20

<210>11

<211>418

<212>DNA

<213> nucleotide sequence of SA-RPL11 Gene fragment

<400>11

TTTCCTCGTT GGACGTGAGA TAGCCGCTAC GAATCCATCA TGGTCCTCGC CGACTTAAAG 60

AAAGGAGGCA ACAAGTCTTC TGAGAAAACG AAAAATCGTA TGCGCGAATT GAGGATTCGC 120

AAATTATGTC TGAACATTTG TGTCGGTGAA TCTGGTGACA AGCTCACCCG TGCCGCTAAG 180

GTGTTGGAAC AATTGACTGG CCAACAACCA GTGTTCTCTA AAGCTCGTTA TACAGTCAGA 240

TCTTTCAGTA TCAGAAGAAA TGAAAAAATT GCAGTGCACT GCACGGTTCG AGGTGCTAAG 300

GCTGAAGAAA TCTTGGAACG TGGATTAAAG GTTCGTGAAT ACGAATTGAG GCGAGAAAAC 360

TTCTCGGACA CCGGTAACTT CGGTTTTGGT ATTCAAGAAC ACATCGATTT GGGTATCA 418

<210>12

<211>20

<212>DNA

<213> PCR amplification upstream primer of SA-RPL11

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>12

TCGTGTTGTTTCGCTTCGTC 20

<210>13

<211>25

<212>DNA

<213> PCR amplification downstream primer of SA-RPL11

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>13

TGATACCCAAATCGATGTGTTCTTG 25

<210>14

<211>20

<212>DNA

<213> qPCR amplification upstream primer of SA-RPL11

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>14

CGTGTTGTTTCGCTTCGTCT 20

<210>15

<211>20

<212>DNA

<213> qPCR amplification downstream primer of SA-RPL11

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>1 5

CTTTAAGTCGGCGAGGACCA 20

<210>16

<211>617

<212>DNA

<213> nucleotide sequence of SA-28S Gene fragment

<400>16

CGAGTGAGCC AGAAACACAT TTTACAATAA TTTTTGTTAC ATATTTTCGA TATAATTTAT 60

TATTTGAGTA ACTAGGTTTT AAGAAAACTA TAACAATGTT TTTGAACACT ATTCGCACAT 120

TGTCGTCTAC ACTTTTCAAA GCATCAAGTG GTCTATCAAC CGGCAACCAC ATTGTGCCTA 180

AAAACGGAAG AAATGTCTAC ACAAACGTGG TCAAATATAA TGAATTATCA ACTAAAGATG 240

AAATGCAACG AGATTCGCCA AAAGATAGAT CGACTGTAAT TCCTGCCGAA ACAAGTATTG 300

AATATCTAAA AAGTGATGCA TACAAATCCA CTTATGGAGA TAATCCTGTT TGGAAAGAAT 360

ATCGCCGTAA TCATAAAGGA AGTATTCCAC CAAGAAAAAC TAGGAAAACG TGTATTAGAT 420

CTGATATGAT TGCAACTGGT AATCCATGTC CAGTATGTCG TGACGAATAC CTCATACTCG 480

ACTACAGAAA TGTGGATTTG CTCAAGCAGT TCATATCTCC TTATTCTGGA AAACTGTTAT 540

CCTATAAATT AACTGGAATT TGCCAAAAAC AGCATGAAAA TTTGATAGTT GCCGTAAAAA 600

AGGCCAAAGA CTGGGGA 660

<210>17

<211>20

<212>DNA

<213> PCR amplification upstream primer for SA-28S

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>17

CGAGTGAGCCAGAAACACAT 20

<210>18

<211>21

<212>DNA

<213> PCR amplification downstream primer for SA-28S

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>18

ATCCCCAGTCTTTGGCCTTTT 21

<210>19

<211>20

<212>DNA

<213> qPCR amplification upstream primer for SA-28S

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>19

TCTATCAACCGGCAACCACA 20

<210>20

<211>20

<212>DNA

<213> qPCR amplification downstream primer for SA-28S

<220>

<223> description of artificial sequences: artificially synthesized sequences

<400>20

TGGCGAATCTCGTTGCATTT 20

Claims

1, Amycos avenae gene segments, wherein the gene segments are SA-HEL gene segments, SA-RPL14 gene segments, SA-SA-RPL11 gene segments or SA-28S gene segments, and the nucleotide sequences of the gene segments are respectively shown as SEQ ID No.1, SEQ ID No.6, SEQ ID No.11 and SEQ ID No. 16.

The cloning method of kinds of sitobion avenae gene partial sequences comprises the steps of extracting the total RNA of the sitobion avenae genome, carrying out RT reaction by taking a mixed primer carried by a kit as a reaction primer, carrying out RT-PCR amplification by taking product chain cDNA as a template and respectively taking a primer pair SA-HEL-F/SA-HEL-R, SA-RPL14-F/SA-RPL14-R, SA-SA-RPL 11-F/SA-RPL11-R, SA-28S-F/SA-28S-R to obtain positive clones, and finally carrying out sequencing verification, wherein the sequences of the primer pair are as follows:

SA-HEL-F：5’ -ACTGGTTTGAACGAATATG-3’ ；

SA-HEL-R：5’ -CATCCAAATAGTGTGTAAGA-3’ ；

SA-RPL14-F：5’ -AATGTGAGGTTATGATTGTC-3’ ；

SA-RPL14-R：5’ -TTAAACAGTGCTTGGTAG-3’；

SA-SA-RPL11-F：5’ -TCGTGTTGTTTCGCTTCGTC-3’ ；

SA-SA-RPL11-R：5’ -TGATACCCAAATCGATGTGTTCTTG-3’；

SA-28S-F：5’-CGAGTGAGCCAGAAACACAT-3’ ；

SA-28S-R：5’-ATCCCCAGTCTTTGGCCTTTT-3’。

3. the cloning method of claim 2, wherein the PCR amplification reaction conditions are as follows:

pre-denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30sec, annealing at 60 ℃ for 30sec, and cooling to 0.5 ℃ and extension at 72 ℃ for 1mim for 30 cycles each; denaturation at 94 ℃ for 30sec, re-annealing at 45 ℃ for 30sec, and re-extension at 72 ℃ for 1mim for 10 cycles; finally, the temperature is leveled off at 72 ℃ for 7min, and the termination temperature is 8 ℃.

4, method for amplifying the partial sequence of the sitobion avenae gene by qPCR, extracting the total RNA of the sitobion avenae genome, carrying out RT reaction by taking a self-contained mixed primer of a kit as a reaction primer, carrying out fluorescent quantitative PCR amplification by taking the chain cDNA of a product as a template, wherein the fluorescent dye is SYBR Green1, the quantitative primers of the sitobion avenae in the quantitative PCR amplification have the sequences respectively as follows:

QSA-HEL-F：5’ - TGCTACCGGATGTGGGAAAA -3’ ；

QSA-HEL-R：5’ - TCCAGCCACGTTCTCTGTTT -3’ ；

QSA-RPL14-F：5’ - AAGCACCACAGTTCCAAGCG -3’ ；

QSA-RPL14-R：5’ - ACTCGGCCAGTTTCCACAAA -3’；

QSA-SA-RPL11-F：5’ - CGTGTTGTTTCGCTTCGTCT -3’ ；

QSA-SA-RPL11-R：5’ - CTTTAAGTCGGCGAGGACCA -3’；

QSA-28S-F：5’-TCTATCAACCGGCAACCACA-3’ ；

QSA-28S-R：5’-TGGCGAATCTCGTTGCATTT-3’。

5. the method of claim 4, wherein the reaction conditions for the fluorescent quantitative PCR amplification are as follows:

pre-denaturation at 95 ℃ for 15 min; 40 cycles of denaturation at 95 ℃ for 10sec, annealing at 60 ℃ for 32sec were run, followed by dissolution profile phase at 95 ℃ for 15sec, 60 ℃ for 1min, 95 ℃ for 30sec, and 60 ℃ for 15 sec.

6. The use of the sitobion avenae gene fragment of claim 1 as an internal reference gene.

7. The use of claim 6, wherein the SA-28S gene fragment is used for quantitative PCR detection of functional gene of sitobion avenae or gene expression in different development stages or gene expression in vivo of winged aphid or wingless aphid, the SA-RPL14 gene fragment is used for quantitative PCR detection of functional gene of sitobion avenae or gene expression in vivo under different density treatment, the SA-SA-RPL11 gene fragment is used for quantitative PCR detection of functional gene of sitobion avenae or gene expression in vivo under treatment of pheromone E- β -farnesene solution, and the SA-HEL gene fragment is used for quantitative PCR detection of functional gene of sitobion avenae or gene expression in vivo under treatment of pesticide or antibiotic.