CN105368948A - Primer for sex identification of Nile tilapia and PCR (polymerase chain reaction) identification method - Google Patents

Abstract

The invention discloses a primer for sex identification of Nile tilapia. The primer can specifically amplify AMH genes of Nile tilapia, a male individual generates two specifically amplified segments, lengths of the specifically amplified segments are 179bp and 412bp respectively, and a female individual generates a specifically amplified segment of 412bp in length. The primer is used to amplify genome DNA of Nile tilapia, the male individual generates the two specifically amplified segments of 179bp and 412bp in length, the female individual generates the specifically amplified segment of 412bp in length, and the male individual and the female individual can be distinguished obviously, so that sexes of Nile tilapia can be identified simply and accurately. The primer is high in specificity and does not amplify other segments except for a target segment. The invention further discloses a PCR (polymerase chain reaction) identification method using the primer. The PCR identification method is quick to operate and accurate in result, and the defect of unstable results caused by adopting conventional morphological methods to identify Nile tilapia different in sex is avoided.

Description

Bolti sex identification primer and PCR authentication method

Technical field

The present invention relates to biological detection authenticate technology, relate to specifically and the primer of PCR qualification is carried out to bolti sex and uses the PCR authentication method of this primer.

Background technology

Bolti belongs to Perciformes, Callichthyidae, and tilapia belongs to, and originate in the Lake Tanganyika of Jordan, China introduces in 1978 from Thailand and promotes cultivation, and present China has been tilapia producing country maximum in the world and export State.The tilapia kind that China mainly cultivates has bolti, Oreochromis aureus and Ao Ni Hybrid tilapia etc.Tilapia due to different varieties has very large morphological specificity overlapping, and this makes only to differentiate that different tilapia kind is very difficult from form.In addition, be easy to hybridization between tilapia kind, and cross-fertilize seed can educate, cross-fertilize seed form is very similar to parental trait again, therefore, is easy to cause tilapia kind matter to mix, cause excellent economic characters to be degenerated, this is also the outstanding problem restricting China's tilapia aquaculture development at present.Male and female Growth Op Tilapia obvious difference in breeding process, milter is faster than raun growth, usually causes pond specification to differ greatly, thus reduces the quality of marketable fish, decrease economic benefit.

Summary of the invention

The technical problem solved: in order to quick, precise Identification bolti sex, prevent in breeding process because the long obvious difference of male and female sashimi (raw fish) causes pond specification to differ greatly, thus reduce the quality of marketable fish, the invention provides a kind of bolti sex identification primer and PCR authentication method.

Technical scheme: a kind of bolti sex PCR qualification primer, described primer can carry out specific amplification to the AMH gene of bolti, male generates 2 specific amplification fragments, length is respectively: 179bp and 412bp, and female individuals generates the specific amplification fragment that 1 length is 412bp.

AMH gene is the abbreviation of anti-Miao Le Shi pipe hormone gene antiMullerianhormone, and its sequence number in Genebank database is: EF512167.

Preferably, the nucleotides sequence of described bolti sex PCR qualification primer is classified as:

Forward: 5 '-CAGGAGGGAGTCAGTTCCGTG-3 '

Reverse: 5 '-CTCTAGCGGCATCCACACTCC-3 '.

A kind of bolti sex PCR authentication method, the method for template, adopts primer to carry out pcr amplification with the genomic dna extracted in bolti blood sample, and according to 1.5% agarose gel electrophoresis result of determination.

Preferably, the PCR reaction system of described authentication method is: 10 × reaction MIX liquid 5 μ L, each 0.25 μ L of forward and reverse primer, concentration is the DNA profiling 1 μ L of 50ng/ μ L ~ 100ng/ μ L, complements to 10 μ L with sterilizing distilled water.

Preferably, the response procedures of the PCR of described authentication method is: denaturation 94 DEG C, 2min; 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations; Last 72 DEG C extend 5min, 4 DEG C of preservations.

A kind of bolti sex PCR identifier box, comprises the primer described in claim 1 or 2.

Beneficial effect: (1) uses the genomic dna of primer pair bolti of the present invention to increase, male generates 2 specific amplification fragments, length is respectively: 179bp and 412bp, female individuals generates the specific amplification fragment that 1 length is 412bp, obviously can distinguish, thus can simply, accurately identify the sex of bolti; (2) primer specificity of the present invention is strong, can not to other fragment amplification beyond target fragment; (3) the invention discloses the PCR authentication method using described primer, the method is swift to operate, result is accurate, avoids the defect of the unstable result adopting the bolti of traditional form method qualification different sexes to bring.

Accompanying drawing explanation

Fig. 1 is purebred bolti PCR sex identification electrophoresis detection result;

Wherein, M is DL1000; 1-5,11-17 are Ni Luoluofei milter; 6-10,18-23 are Ni Luoluofei raun.

Embodiment

Following examples further illustrate content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the amendment do the inventive method, step or condition and replacement, all belong to scope of the present invention.If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.

Embodiment 1

1st step, design of primers

According to the AMH gene order of bolti, utilize primer-design software Primer5.0 to design primer, primer sequence is:

Forward: 5 '-CAGGAGGGAGTCAGTTCCGTG-3 '

Reverse: 5 '-CTCTAGCGGCATCCACACTCC-3 '.

2nd step, extracting genome DNA

(1) get measuring samples 19 tail, sample is adopted by fishing ground, China Aquatic Science Research Academy Fresh Water Fishery Research Center Yixing;

(2) tail vein blood, uses the AxyPrep blood genomic dna small volume of reagent box that Axygen produces, and step extracting genomic dna to specifications.

3rd step, PCR authentication method are set up

(1) reaction system of PCR is: 10 × reaction MIX liquid 5 μ L, each 0.25 μ L of forward and reverse primer, and DNA profiling 1 μ L, complements to 10 μ L with sterilizing distilled water;

(2) response procedures of PCR is: denaturation 94 DEG C, 2min; 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations; Last 72 DEG C extend 5min, 4 DEG C of preservations;

(3) after PCR reaction terminates, the product sepharose of 1.5% carries out electrophoretic analysis, adopts gel imaging instrument Taking Pictures recording electrophoresis result.

As shown in Figure 1, electrophoresis detection finds, Ni Luoluofei raun all only has 1 length to be the specific amplification band of 412bp, and Ni Luoluofei milter has 2 specific amplified bands, length is respectively 179bp and 412bp, the male and female individual differentiation of bolti can be come by electrophoretogram.

As we know from the figure, when adopting bolti sex PCR qualification primer amplification genomic dna of the present invention, occur without other assorted bands, the primer of therefore the present invention's design can specific amplification target sequence.

EQUENCELISTING

<110> China Aquatic Science Research Academy Fresh Water Fishery Research Center

<120> bolti sex identification primer and PCR authentication method

<130>

<160>2

<170>PatentInversion3.3

<210>1

<211>21

<212>DNA

<213> artificial sequence

<400>1

caggagggagtcagttccgtg21

<210>2

<211>21

<212>DNA

<213> artificial sequence

<400>2

ctctagcggcatccacactcc21

Claims (6)

1. a bolti sex PCR qualification primer, it is characterized in that, described primer can carry out specific amplification to the AMH gene of bolti, male generates 2 specific amplification fragments, length is respectively: 179bp and 412bp, and female individuals generates the specific amplification fragment that 1 length is 412bp.

2. a kind of bolti sex PCR qualification primer according to claim 1, it is characterized in that, the nucleotides sequence of primer is classified as:

Forward: 5 '-CAGGAGGGAGTCAGTTCCGTG-3 '

Reverse: 5 '-CTCTAGCGGCATCCACACTCC-3 '.

3. a kind of bolti sex PCR authentication method described in claim 1 or 2, it is characterized in that, the method with the genomic dna extracted in bolti blood sample for template, adopt primer carry out pcr amplification, and according to 1.5% agarose gel electrophoresis result of determination.

4. a kind of bolti sex PCR authentication method according to claim 3, it is characterized in that, the reaction system of PCR is: 10 × reaction MIX liquid 5 μ L, the each 0.25 μ L of forward and reverse primer, concentration is the DNA profiling 1 μ L of 50ng/ μ L ~ 100ng/ μ L, complements to 10 μ L with sterilizing distilled water.

5. a kind of bolti sex PCR authentication method according to claim 3, it is characterized in that, the response procedures of PCR is: denaturation 94 DEG C, 2min; 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations; Last 72 DEG C extend 5min, 4 DEG C of preservations.

6. a bolti sex PCR identifier box, is characterized in that, comprises the primer described in claim 1 or 2.