CN110734959A - Screening method and application of reference gene stably expressed by sitobion avenae at different temperatures - Google Patents
Screening method and application of reference gene stably expressed by sitobion avenae at different temperatures Download PDFInfo
- Publication number
- CN110734959A CN110734959A CN201910608032.2A CN201910608032A CN110734959A CN 110734959 A CN110734959 A CN 110734959A CN 201910608032 A CN201910608032 A CN 201910608032A CN 110734959 A CN110734959 A CN 110734959A
- Authority
- CN
- China
- Prior art keywords
- gene
- sitobion avenae
- quantitative pcr
- avenae
- internal reference
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a screening method and application of a reference gene stably expressed by sitobion avenae at different temperatures, and belongs to the field of molecular biology. The method takes the sitobion avenae processed at different temperatures as an experimental material to carry out fluorescence quantitative PCR research, and each candidate reference gene quantitative PCR data is input into a RefFinder to carry out stability analysis on the reference gene, so that the reference gene-NADH which is most suitable and most stably expressed in the sitobion avenae processed at different temperatures is screened out. On the basis, the inventor takes the sitobion avenae subjected to high-temperature stress as a sample, takes the sitobion avenae heat shock protein hsp90 as a target gene, screens out an NADH gene as an internal reference gene, and researches the expression rule of the sitobion avenae hsp90 gene under the high-temperature stress.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a screening method and application of a reference gene stably expressed by sitobion avenae at different temperatures.
Background
The Aphis graminicola (Sitobion avenae Fabricius) belongs to the homoptera, Aphidae, is which is the main pest of wheat crops in China, has more host types, is harmful to gramineae crops such as wheat, barley, oat and the like, is harmful to gramineae and cyperaceae weeds such as rice, sorghum, corn, sugarcane and the like, and is also harmful to gramineae and cyperaceae weeds such as blue grass, alopecurus, digitaria sanguinalis, club grass, green bristlegrass and aegilops tauschii, has the characteristics of large quantity and strong fertility in distribution , influences the normal growth of wheat plants, causes serious reduction of the wheat yield, causes huge loss to agricultural production, can reduce the yield of the wheat by 5.1-16.5% in years, reduces the yield of the wheat by more than 40% in the large-occurring years, is generally wingless, can be regulated by external environmental conditions and biological factors to generate winged aphids, winged individuals can fly to virus plants in a long distance, and also find the aphid which is an important aphid spreading besides directly sucking the host.
The wingless parthenogenetic female aphid of the sitobion avenae has a length of 3.1mm, a width of 1.4mm, a long oval shape, a green grass to an orange red color, a slightly gray head and a gray green color spot on the ventral side. The tentacles, rostral distal nodes, tarsal nodes, abdominal ducts were black, and the tails were light in color. The sixth to eighth segments of the abdomen and the abdomen have cross reticulate pattern without edge tumor. The middle chest and abdomen fork short handle. The forehead tumour is markedly extroversion. The antenna is long and thin, the overall length is shorter than the body length, and the base of the third section has 1-4 secondary sensory circles. The beak is thick and larger than the midfoot node, and the end section is conical and 1.8 times wider than the base. The abdominal tube is cylindrical, 1/4 long and body long, and has tens of rows of cross-hatching at the end. The tail piece is in a long cone shape, the length of the tail piece is 1/2 of the abdominal tube, and 6-8 curly hairs are arranged. The winged parthenogenetic female aphid body is 3.0mm long, oval, green and black in tentacle, and 8-12 sensory circles are arranged in the third section to form 1 row. The beak does not reach the midfoot. The abdominal tube is long cylindrical and black, and the end part of the abdominal tube is provided with 15-16 rows of cross-line reticulate patterns. The anterior wing, the middle vessel, trifurcate, is widely divergent.
The quantitative PCR technology has the advantages of real-time detection, strong specificity, rapid sensitivity and accurate quantification, realizes the leap of traditional PCR from qualitative to accurate quantification when the qRT-PCR test is carried out, the internal Reference Gene has to be stably expressed under given experimental conditions, obtains more accurate Expression data, screens relatively stable internal Reference Genes are essential basic work for facilitating Gene Expression research, the ideal internal Reference Genes are not influenced by any external environmental factors and can be stably expressed under different experimental conditions, however, a large number of researches show that no absolutely stably expressed Genes (Xun, Z. the collection and Evaluation Genes for Expression Genes are used for Expression of the Gene Expression Genes, the Gene Expression of the Gene Expression Genes is not expressed in the Gene Expression of the Gene, the Gene Expression of the Gene is not expressed in vivo, the Gene Expression of the Gene Expression of the Gene of the insect is not identical to the Gene of the insect, the Gene of the insect is not identical to the Gene of the insect, the Gene of the insect, the insect is not only the Gene of the insect, the Gene of the insect, the Gene of the insect, the Gene of the insect of the Gene of the insect of the Gene of the insect of the protein of the insect of the protein of the insect of the protein of the insect of the protein of the insect of the protein of the insect of interest of the insect of the protein of interest of the insect of the protein of the insect of interest of the insect of the.
Disclosure of Invention
The invention provides a screening method and application of kinds of internal reference genes stably expressed by myzus avenae under different temperature treatment, wherein the myzus avenae subjected to high-temperature stress are taken as a sample, a heat shock protein hsp90 of the myzus avenae is taken as a target gene, and a screened NADH gene is taken as the internal reference gene, so that the expression rule of the hsp90 gene of the myzus avenae under the high-temperature stress is researched, the screening problem of the internal reference genes of the myzus avenae under different temperature environments is solved, and the real-time fluorescent quantitative PCR detection method of different internal reference genes under the internal temperature stress of the myzus avenae imagoes can be established by using the method and the basis is provided for selecting the internal reference genes under the different temperature treatment of the myzus avenae.
The technical scheme provided by the invention is as follows: the screening method of the internal reference gene of the sitobion avenae under different temperature treatments comprises the following steps: taking 20 ℃ raised sitobion avenae as a control, setting 3 temperature gradients to treat the sitobion avenae imagoes, immediately extracting total RNA after treatment, carrying out reverse transcription to synthesize cDNA, then carrying out real-time fluorescent quantitative PCR verification, and carrying out stability analysis on an internal reference gene by adopting RefFinder, thereby screening the internal reference gene which is most suitable and stably expressed in the sitobion avenae body under different temperature treatment.
The screening method of the reference gene of the sitobion avenae under different temperature treatment comprises the following steps:
(1) and (3) feeding the sitobion avenae: the method comprises the following steps of taking the myzus avenae as a laboratory breeding population, breeding and using an artificial climate box under the breeding conditions of 20 +/-2 ℃, humidity of 60-80% and illumination of 16 h: dark for 8 h;
(2) 3 temperature gradients were set to treat the adult sitobion avenae, 18 ℃, 24 ℃ and 30 ℃ respectively.
(3) Designing fluorescent quantitative primers of the genes: obtaining nucleic acid partial sequences of the candidate reference genes of the Mylopharyngodon Act, Rps27S, v-ATPase, NADH dehydrogenase (NADH), 18S ribosomal RNA (18S) and ligation factor1alpha (EF1a) and heat shock protein heat-shock protein (HSP90) from GneBanck data and Mylophaga elongata transcriptome; the secondary structure of the nucleic acid part sequence of each gene was analyzed using unaford online software (http:// mfold. rna. albany. edu/: a melttempoperation, 60 ℃; DNA sequence, linear; na + concentration, 50 mM; mg (magnesium)2+concentration, 3 mM; other options are initial settings; after obtaining the locus containing the stem-loop structure of each gene template sequence, a Primer is designed by using NCBI-Primer-BLAST online software (http:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST/index. cgi: primer longtemperature, 57-63 ℃; primer GC content, 40-60%(ii) a PCR product size, 150-300 basepair; isolated regions, stem-loop structural sites; other options are initial settings; designing and obtaining specific real-time fluorescent quantitative PCR primers of each gene, determining the amplification specificity of the primers by using a quantitative PCR dissolution curve method, respectively carrying out quantitative PCR according to 5-fold diluted cDNA to establish a standard curve, and determining the amplification efficiency of each pair of primers;
(4) respectively selecting wingless sitobion avenae treated at 18 ℃, 24 ℃ and 30 ℃ for 24 hours as experimental materials, extracting total RNA, carrying out RT reaction by taking a self-contained mixed primer of the kit as a reaction primer, and carrying out fluorescent quantitative PCR amplification by taking th chain cDNA of a product as a template, wherein a fluorescent dye is SYBR Green 1;
(5) and inputting the fluorescence quantitative PCR experimental data into RefFinder software for analyzing the stability of the internal reference gene.
The reaction conditions and procedures of the fluorescent quantitative PCR amplification in the step (4) are respectively as follows:
reaction conditions for fluorescent quantitative PCR amplification: 10 XPCR Buffer 2.5. mu.L, 2.5mmol/L dNTP 2.0. mu.L, 25.0mmol/L MgCl22.0. mu.L, 5.0U/. mu.L TaqDNA polymerase 0.5. mu.L, 10.0. mu.M upstream and downstream primers 1.0. mu.L each, cDNA 2.5. mu.L, ddH2Make up to 25. mu.L of O.
Reaction procedure for fluorescent quantitative PCR amplification: pre-denaturation at 95 ℃ for 15 min; 40 cycles of denaturation at 95 ℃ for 10sec, annealing at 60 ℃ for 32sec were run, followed by dissolution profile phase at 95 ℃ for 15sec, 60 ℃ for 1min, 95 ℃ for 30sec, and 60 ℃ for 15 sec. 4 quantitative PCR replicates were set for each sample.
The primers of the candidate reference gene and the heat shock protein hsp90 gene respectively have the following base sequences:
meanwhile, the invention provides the application of the method in the aspect of researching the expression and the function of the related genes of the sitobion avenae processed at different temperatures by utilizing the fluorescent quantitative PCR technology.
The application takes the sitobion avenae treated at different temperatures as a sample, takes the sitobion avenae heat shock protein hsp90 as a target gene, and takes the screened gene as an internal reference gene to discuss the expression rule of hsp90 under the temperature treatment of the sitobion avenae.
The temperature for processing the avenae is 18 ℃, 24 ℃ and 30 ℃, and the processing time is 24 hours.
The NADH gene is used as an internal reference gene in real-time fluorescent quantitative PCR analysis of the sitobion avenae under different temperature treatments.
The invention utilizes fluorescence quantitative PCR technology to establish a screening method of kinds of internal reference genes of the sitobion avenae under different temperatures, the sitobion avenae treated at different temperatures are taken as experimental materials to carry out fluorescence quantitative PCR research, quantitative PCR data of each candidate internal reference gene is input into RefFinder to carry out internal reference gene stability analysis, and the internal reference gene-NADH which is most suitable and stably expressed in the sitobion avenae under different temperature treatment is screened.
Compared with the prior art, the invention has the following advantages:
1. the invention verifies and compares partial gene sequences of 6 reference genes for the first time;
2. the invention firstly proposes the quantitative PCR detection of adult myzus avenae processed at different temperatures by taking the NADH gene of the myzus avenae as an internal reference gene;
3. the invention firstly proposes that the NADH gene of the sitobion avenae as the reference gene can relatively quantify the relative expression level of the gene in the adult treated at different temperatures;
4. the detection primer provided by the invention has specificity, optimizes a PCR amplification program, greatly improves the detection efficiency, shortens the detection time and improves the reliability of a detection result.
Drawings
FIG. 1 shows Ct values of 6 reference genes in a fluorescent quantitative PCR experiment;
FIG. 2 shows the results of stability analysis of 6 reference genes by RefFinder;
FIG. 3 is a relative quantitative expression diagram of the sitobion avenae hsp90 gene after different temperature stresses by using NADH as an internal reference gene.
Detailed Description
A specific embodiment of the present invention will be described in step , wherein molecular biology-related operations are performed according to molecular cloning protocols (scientific Press, third edition, Huang Pei Tang, 2002) written by Sambrook J, Russell DW, primer synthesis is performed by Shanghai Biometrics Ltd, and quantitative PCR is performed according to the protocols of instrumentation protocols and fluorescent quantitation reagents.
1. And (5) breeding the sitobion avenae source.
The method comprises the following steps of taking the myzus avenae as a laboratory breeding population, breeding and using an artificial climate box under the breeding conditions of 20 +/-2 ℃, humidity of 60-80% and illumination of 16 h: dark for 8 h.
2. Temperature treatment of avenae
Selecting adult sitophila avenae to carry out different temperature treatment, wherein the treatment method comprises the following steps: setting the temperature of the incubator to a treatment temperature, placing the adult aphids into the incubator to be treated for 24 hours, immediately collecting, and extracting total RNA. The treatment temperatures were 18 deg.C, 24 deg.C and 30 deg.C, respectively, and adult aphids raised at 20 deg.C were used as controls.
3. Extracting total RNA of the avenae:
total RNA of Aphis gramineus was extracted using TRizol (Amion, USA) as follows: taking a 30mg wingless adult aphid avenae sample, fully grinding the wingless adult aphid avenae sample in liquid nitrogen, then quickly adding 1ml of Trizol lysate, fully oscillating for 20s, and standing for 5-10 minutes; adding 200 μ L chloroform, shaking for 20s, standing for 5min, and centrifuging at 4 deg.C at 12,000rpm for 15 min; adding the supernatant into a centrifugal tube containing 2.5 times of anhydrous ethanol, reversing, mixing, standing for 10min, and storing in a refrigerator at-80 deg.C for 2-4 hr; taking out the sample, and centrifuging at 7500rpm at 4 ℃ for 10 min; discarding the supernatant, adding 1ml of 75% ethanol, washing the precipitate twice, and centrifuging at 4 ℃ at 12,000rpm for 10 min; adding 30 mu L of RNase-free water to dissolve the precipitate; detecting the integrity of RNA by using 1% agarose gel electrophoresis, detecting the concentration and the mass of the extracted total RNA by using an ultramicro ultraviolet spectrophotometer Beckman DU 700, wherein an RNA sample with a mass parameter of 1.9 < A260/280 < 2.1 and 2.0 < A260/230 < 2.4 is a qualified sample, and storing the qualified sample in a refrigerator at-80 ℃ for later use.
4. Reverse transcription
The reverse transcription is carried out by utilizing TAKARA PrimeScript 1st Strand cDNA synthesis kit, and the specific operation steps are as follows: adding 1 mu g of total RNA of the Aphis avenae into a sterile PCR tube, adding 1 mu of LOlogo dT Primer and 1 mu of LdNTPmix, and supplementing 10 mu of sterile deionized water without RNase; mixing, heating at 65 deg.C for 5min, and rapidly cooling on ice; to 10. mu.L of the reaction mixture were added 4. mu.L of 5 XPrimeScript Buffer, 0.5. mu.L of RNase Inhibitor, 1.0. mu.L of PrimeScript RTase, and 4.5. mu.L of RNase free H2And O, carrying out reverse transcription reaction on a PCR instrument, wherein the reaction procedure is that after 60min of warm bath at 42 ℃, inactivation at 95 ℃ is carried out for 5min, ice is placed on the reaction product after the reaction is finished, and the synthesized th chain cDNA is placed at the temperature of 20 ℃ below zero for short-term storage or the temperature of 80 ℃ below zero for long-term storage.
5. Design and verification analysis of real-time fluorescent quantitative PCR (polymerase chain reaction) reference gene primer
Nucleic acid partial sequences of Myzus avenae pT-actin 1(ACT), ubiquitin ribosomal protein S27A fusion protein (RpS27S), vacuolar-type H + -ATPase (v-ATPase), NADH dehydrogenase (NADH), 18S ribosomal RNA (18S) and ligation factor1 (EF1a) candidate internal reference genes and heat shock protein heat-shock protein (HSP90) were obtained from GneBanck data and Myzus avenae transcriptome. The secondary structure of the nucleic acid part sequence of each gene was analyzed using unaford online software (http:// mfold. rna. albany. edu/: a long temperature, 60 ℃; DNAsequence, linear; na + concentration, 50 mM; mg (magnesium)2+concentration, 3 mM; the other option is initial setup. After obtaining the locus containing the stem-loop structure of each gene template sequence, the NCBI-Primer-BLAST online software (http:// www) is utilizedNbi.n lm.nih.gov/tools/primer-blast/index. cgi? LINK _ LOC ═ BlastHome) design primers, the software settings are as follows: a primer long temperature, 57-63 ℃; primer GCcontent, 40-60%; PCR product size, 150-; isolated regions, stem-loop structural sites; the other option is initial setup.
The primers of the candidate reference gene and the heat shock protein hsp90 gene respectively have the following base sequences:
6. fluorescent quantitative PCR
The qPCR reaction system based on SYBR Green I dye is SsoFast EvaGreen Supermix 10. mu.L, upstream and downstream primers (10.0. mu.M) each 1.0. mu.L, cDNA 1.0. mu.L, ddH2Make up to 20. mu.L of O. The reaction conditions for the fluorescent quantitative PCR amplification are as follows: pre-denaturation at 95 ℃ for 15 min; 40 cycles of denaturation at 95 ℃ for 10sec, annealing at 60 ℃ for 32sec were run, followed by dissolution profile phase at 95 ℃ for 15sec, 60 ℃ for 1min, 95 ℃ for 30sec, and 60 ℃ for 15 sec.
7. Amplification efficiency of primers
series of gradient dilutions were performed using the Myzus avenae wingless adult cDNA as a template, and real-time fluorescence quantitative PCR was performed to prepare a standard curve of amplification efficiency of primers, which was calculated as follows, amplification efficiency (E) ═ 101/slope [ - ]]-1)×100。
And carrying out fluorescence quantitative PCR on the wheat aphid experiment samples processed at different temperatures according to the method, and deriving the cycle threshold Ct value of the fluorescence quantitative PCR of each candidate reference gene in each processed sample. See fig. 1.
8. RefFinder software analysis of fluorescence quantitative data
And importing the Ct value into software according to the requirements of online analysis software RefFinder, and performing stability analysis. See fig. 2. The stability ranking was: NADH > RPS27>18S > EF1a > V-ATPase > ACT.
According to the invention, the 6 internal reference genes of the sitobion avenae processed at different temperatures are subjected to quantitative PCR verification and stability verification according to the quantitative PCR requirement, and the most stable internal reference gene NADH processed at different temperatures of the sitobion avenae is finally screened, so that a solid foundation is provided for accurate quantitative research of related functional genes in adult aphids processed at different temperatures of the sitobion avenae in the future.
9. Application of internal reference gene
Taking the wingless sitobion avenae adult aphids which are respectively treated at different temperatures of 18 ℃, 24 ℃ and 30 ℃ for 24 hours as samples, taking the adult aphids raised at 20 ℃ as a control, taking NADH as an internal reference gene, and monitoring the expression condition of the sitobion avenae hsp90 gene under each treatment by real-time fluorescence ticket ordering PCR. Fluorescence quantification system and reaction procedure four technical replicates were set up for three biological replicates with reference to step 6. Relative quantitative data processing Using 2-ΔΔCtAccording to the method, a delta Ct (total percent of total. As shown in FIG. 3, after treatment at different temperatures, the hsp90 gene in the adult aphids was increased in expression level with increasing temperature, and the expression level was up-regulated from 24 ℃ by 2.5 times compared with the control, and was highest at 30 ℃ and 4.5 times compared with the control.
Nucleotide sequence listing
<110> institute of plant protection of Chinese academy of agricultural sciences
<120> screening method and application of reference gene stably expressed by sitobion avenae at different temperatures
<160>14
<210>1
<211>20
<212>DNA
<213> PCR amplification upstream primer for Sa-18S
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>1
TCATATGCTTGTCTCAAAGA 20
<210>2
<211>20
<212>DNA
<213> PCR amplification downstream primer for Sa-18S
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>2
CTGATTTAATGAGCCTTTCG 20
<210>3
<211>20
<212>DNA
<213> PCR amplification upstream primer for SA-ACT
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>3
TGGGAATGGAATCTTGCGGT 20
<210>4
<211>21
<212>DNA
<213> qPCR amplification downstream primer of SA-ACT
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>4
CGGAGAGTACAGTGTTACCGT 21
<210>5
<211>20
<212>DNA
<213> qPCR amplification upstream primer of SA-EF1a
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>5
GCTGTGCTTATTGTCGCTGC 20
<210>6
<211>20
<212>DNA
<213> qPCR amplification downstream primer of SA-EF1a
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>6
TACACCCAAGGTGAAAGCCA 20
<210>7
<211>22
<212>DNA
<213> qPCR amplification upstream primer of SA-RpS27a
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>7
TGTGAAGACGTTGACTGGGAAA 22
<210>8
<211>22
<212>DNA
<213> qPCR amplification downstream primer of SA-RpS27
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>8
CGTTGCTGATCCGGAGGAATAC 22
<210>9
<211>21
<212>DNA
<213> qPCR amplification upstream primer of SA-V-ATPase
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>9
CGAAATGAACGTCTTCCAGCG 21
<210>10
<211>21
<212>DNA
<213> qPCR amplification downstream primer of SA-V-ATPase
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>10
AACATGCACGTGGTCTTTGTG 21
<210>11
<211>22
<212>DNA
<213> qPCR amplification upstream primer for SA-NADH
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>11
CGAGGAGAACATGCTCTTAGAC 22
<210>12
<211>23
<212>DNA
<213> qPCR amplification downstream primer of SA-NADH
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>12
GATAGCTTGGGCTGGACATATAG 23
<210>13
<211>24
<212>DNA
<213> qPCR amplification upstream primer of SA-HSP90
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>13
CACATTAAAATCATCCCCAATGCG 24
<210>14
<211>21
<212>DNA
<213> qPCR amplification downstream primer of SA-HSP90
<220>
<223> description of artificial sequences: artificially synthesized sequences
<400>14
AGATCAGCTTTGGTCATACCG 21
Claims (8)
- The screening method of the internal reference genes of the sitobion avenae under different temperature treatments is characterized in that the sitobion avenae raised at 20 ℃ is used as a control, 3 temperature gradients are set to treat the sitobion avenae imagoes, total RNA is extracted immediately after treatment, reverse transcription is carried out to synthesize cDNA, then real-time fluorescence quantitative PCR verification is carried out, RefFinder is adopted to carry out stability analysis on the internal reference genes, and therefore the internal reference genes which are most suitable for and stably expressed in the sitobion avenae under different temperature treatments are screened out.
- 2. The screening method of the internal reference gene of the sitobion avenae under different temperature treatment according to claim 1, which is characterized by comprising the following steps:(1) and (3) feeding the sitobion avenae: the method comprises the following steps of taking the myzus avenae as a laboratory breeding population, breeding and using an artificial climate box under the breeding conditions of 20 +/-2 ℃, humidity of 60-80% and illumination of 16 h: dark for 8 h;(2) 3 temperature gradients are set to treat the adult sitobion avenae, wherein the temperature is 18 ℃, 24 ℃ and 30 ℃ respectively;(3) designing fluorescent quantitative primers of the genes: obtaining nucleic acid partial sequences of candidate reference genes of the wheat length aphid ACT, Rps27S, v-ATPase, NADH, 18S and EF1a and a heat shock protein HSP90 from GneBanck data and a wheat length aphid transcriptome, and analyzing the secondary structure of the nucleic acid partial sequences of the genes by using UNAFold online software, wherein the software is set as follows: a melttempoperation, 60 ℃; DNA sequence, linear; na + concentration, 50 mM; mg (magnesium)2+concentration, 3 mM; other options are initial settings; after obtaining the locus containing the stem-loop structure of each gene template sequence, the primers are designed by using NCBI-Primer-BLAST online software, and the software is set as follows: primer longtemperature, 57-63 ℃; primer GC content, 40-60%; PCR product size, 150-300 basepair; isolated regions, stem-loop structural sites; other options are initial settings; designing specific real-time fluorescent quantitative PCR primer of each gene,determining the amplification specificity by using a quantitative PCR dissolution curve method, respectively carrying out quantitative PCR on the cDNA diluted by 5 times to establish a standard curve, and determining the amplification efficiency of each pair of primers;(4) respectively selecting wingless sitobion avenae treated at 18 ℃, 24 ℃ and 30 ℃ for 24 hours as experimental materials, extracting total RNA, carrying out RT reaction by taking a self-contained mixed primer of the kit as a reaction primer, and carrying out fluorescent quantitative PCR amplification by taking th chain cDNA of a product as a template, wherein a fluorescent dye is SYBR Green 1;(5) and inputting the fluorescence quantitative PCR experimental data into RefFinder software for analyzing the stability of the internal reference gene.
- 3. The screening method of the internal reference gene of the sitobion avenae under different temperature treatments according to claim 2, wherein the reaction conditions and procedures of the fluorescent quantitative PCR amplification in the step (4) are respectively as follows:reaction conditions for fluorescent quantitative PCR amplification: 10 XPCR Buffer 2.5 muL, 2.5mmol/L dNTP 2.0 muL, 25.0mmol/L MgCl22.0 muL, 5.0U/muL TaqDNA polymerase 0.5 muL, 10.0 muM upstream and downstream primers are 1.0 muL, cDNA2.5 muL, ddH2Complementing the O to 25 muL;reaction procedure for fluorescent quantitative PCR amplification: pre-denaturation at 95 ℃ for 15 min; running 40 cycles of denaturation at 95 ℃ for 10sec, annealing at 60 ℃ for 32sec, and then running the dissolution curve stage at 95 ℃ for 15sec, 60 ℃ for 1min, 95 ℃ for 30sec, and 60 ℃ for 15 sec; 4 quantitative PCR replicates were set for each sample.
- 4. The method for screening an internal reference gene of sitobion avenae under different temperature treatment according to claim 2, wherein the primers of the candidate internal reference gene and the heat shock protein hsp90 gene respectively have the following base sequences:。
- 5. the use of the screening method of claim 1 for studying the expression and function of temperature treatment-related genes using fluorescence quantitative PCR technology.
- 6. The use of claim 6, wherein: and (3) taking the sitobion avenae treated at different temperatures as a sample, taking the heat shock protein hsp90 of the sitobion avenae as a target gene, and taking the screened gene as an internal reference gene to discuss the expression rule of hsp90 under the temperature treatment of the sitobion avenae.
- 7. Use according to claim 6, characterized in that: the temperature for processing the avenae is 18 ℃, 24 ℃ and 30 ℃, and the processing time is 24 hours.
- And 8, taking the NADH gene as an internal reference gene in real-time fluorescent quantitative PCR analysis of the sitobion avenae under different temperature treatment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910608032.2A CN110734959A (en) | 2019-07-08 | 2019-07-08 | Screening method and application of reference gene stably expressed by sitobion avenae at different temperatures |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910608032.2A CN110734959A (en) | 2019-07-08 | 2019-07-08 | Screening method and application of reference gene stably expressed by sitobion avenae at different temperatures |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110734959A true CN110734959A (en) | 2020-01-31 |
Family
ID=69237798
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910608032.2A Pending CN110734959A (en) | 2019-07-08 | 2019-07-08 | Screening method and application of reference gene stably expressed by sitobion avenae at different temperatures |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110734959A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112746115A (en) * | 2021-02-09 | 2021-05-04 | 中国农业科学院植物保护研究所 | Reference gene for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of Aphis graminicola and amplification primer and application thereof |
| CN113549706A (en) * | 2021-07-02 | 2021-10-26 | 长江大学 | Ginger reference genes and application thereof |
| CN116987809A (en) * | 2023-07-24 | 2023-11-03 | 广东海洋大学 | Bojioocyst algae reference gene and its amplification primer and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178564A (en) * | 2014-06-11 | 2014-12-03 | 广西壮族自治区农业科学院植物保护研究所 | Screening method and applications of brown planthopper reference genes under high temperature stress |
| CN105274239A (en) * | 2015-11-19 | 2016-01-27 | 浙江省农业科学院 | Method for screening reference genes for chilo suppressalis under temperature stress and application of reference genes |
| CN106591316A (en) * | 2016-12-02 | 2017-04-26 | 中国农业科学院植物保护研究所 | Reference gene BT-beta-TUB for bemisia tabaci to respond to different temperature stress expressions and application of reference gene BT-BETA-TUB |
-
2019
- 2019-07-08 CN CN201910608032.2A patent/CN110734959A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178564A (en) * | 2014-06-11 | 2014-12-03 | 广西壮族自治区农业科学院植物保护研究所 | Screening method and applications of brown planthopper reference genes under high temperature stress |
| CN105274239A (en) * | 2015-11-19 | 2016-01-27 | 浙江省农业科学院 | Method for screening reference genes for chilo suppressalis under temperature stress and application of reference genes |
| CN106591316A (en) * | 2016-12-02 | 2017-04-26 | 中国农业科学院植物保护研究所 | Reference gene BT-beta-TUB for bemisia tabaci to respond to different temperature stress expressions and application of reference gene BT-BETA-TUB |
Non-Patent Citations (2)
| Title |
|---|
| CHENG QU等: "Selection and evaluation of reference genes for expression analysis using quantitative real-time PCR in the Asian Ladybird Harmonia axyridis (Coleoptera: Coccinellidae)", 《PLOS ONE》 * |
| 阎维巍等: "麦长管蚜实时定量PCR内参基因的筛选", 《植保科技创新与农业精准扶贫——中国植物保护学会2016年学术年会论文集》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112746115A (en) * | 2021-02-09 | 2021-05-04 | 中国农业科学院植物保护研究所 | Reference gene for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of Aphis graminicola and amplification primer and application thereof |
| CN113549706A (en) * | 2021-07-02 | 2021-10-26 | 长江大学 | Ginger reference genes and application thereof |
| CN113549706B (en) * | 2021-07-02 | 2022-02-22 | 长江大学 | Ginger reference genes and application thereof |
| CN116987809A (en) * | 2023-07-24 | 2023-11-03 | 广东海洋大学 | Bojioocyst algae reference gene and its amplification primer and application |
| CN116987809B (en) * | 2023-07-24 | 2024-04-05 | 广东海洋大学 | Bojioocyst algae reference gene and its amplification primer and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110734959A (en) | Screening method and application of reference gene stably expressed by sitobion avenae at different temperatures | |
| Zhang et al. | Identification of miRNAs and their target genes using deep sequencing and degradome analysis in trifoliate orange [Poncirus trifoliate (L.) Raf] | |
| Wang et al. | Reference genes identified in the silkworm Bombyx mori during metamorphism based on oligonucleotide microarray and confirmed by qRT‐PCR | |
| CN110863058B (en) | RPA primer for identifying potato rot stem nematode and application thereof | |
| CN107868816A (en) | The method for determining the amount of nucleic acid interested in untreated sample | |
| CN104962643B (en) | Stablize reference gene, its screening technique and the application of expression in white backed planthopper different tissues position | |
| CN103509789A (en) | Primer for amplifying short-chain RNA (ribonucleic acid) and related method thereof | |
| CN103866009A (en) | Method for detecting miRNA (micro Ribose Nucleic Acid) by improved stem-lop primer qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) | |
| CN110438213A (en) | A kind of detection method in Vitamin A Metabolism associated gene mutation site | |
| CN108070678A (en) | Constant temperature detects the RPA kits of II type carp herpesvirals and its primer special and probe in real time | |
| CN108165622A (en) | A kind of modified universal stem ring primer quantitative for miRNA and its quantitative approach | |
| CN107354227A (en) | MicroRNA probe one-step method real-time fluorescent quantitative PCR detecting methods | |
| CN116555334A (en) | Mechanism for regulating and controlling ascorbic acid content of kiwi fruits and application thereof | |
| CN110387440B (en) | Reagent for multiple detection of salmon and trout viruses and application thereof | |
| CN113862275B (en) | Partial sequence, cloning method and application of reference gene RPL14 stably expressed under different density treatments of wheat long tube aphid | |
| CN113846108B (en) | Screening and application of taro high-expression internal reference gene Ce047468 | |
| CN114292901B (en) | Screening method of blueberry real-time fluorescence quantitative PCR reference genes | |
| CN107937407B (en) | Specific human gene fragment, primer and probe for detecting specific human gene fragment and application of specific human gene fragment | |
| GuoLiang et al. | Selection of suitable reference genes for RT-qPCR normalisation in sweet potato (Ipomoea batatas L.) under different stresses | |
| CN113755497B (en) | Screening of reference genes in development process of taro corms and application thereof | |
| CN104946657B (en) | Reference gene, its screening technique and the application of the stable expression of white backed planthopper different larval instar | |
| CN114381551A (en) | Real-time fluorescent RAA primer, probe and kit for detecting iridovirus of micropterus salmoides | |
| CN113136438A (en) | Nucleic acid molecule, PCR primer pair and kit for detecting avian trichomonas beta-tubulin gene | |
| CN109609661A (en) | A kind of combination of kidney-yang deficiency exogenous disease mouse model lung tissue qPCR reference gene and its screening technique | |
| CN113234804B (en) | Internal reference gene for detecting milRNA of banana fusarium wilt and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200131 |
|
| RJ01 | Rejection of invention patent application after publication |