CN112813181A - Reference gene suitable for gene expression analysis of different tissues of cigar and application thereof - Google Patents
Reference gene suitable for gene expression analysis of different tissues of cigar and application thereof Download PDFInfo
- Publication number
- CN112813181A CN112813181A CN202110156904.3A CN202110156904A CN112813181A CN 112813181 A CN112813181 A CN 112813181A CN 202110156904 A CN202110156904 A CN 202110156904A CN 112813181 A CN112813181 A CN 112813181A
- Authority
- CN
- China
- Prior art keywords
- gene
- rpl14a
- ubc27
- cigar
- different tissues
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an internal reference gene suitable for gene expression analysis of different tissues of cigars and application thereof. The expression stability of the RPL8, RPL14A, RPS16, UBC27, UBC28, UBC35, AC10, EIF2, PSAP and CPI ten candidate internal reference genes in different tissues (roots, stems, leaves, calyxes, corolla, stigma, ovary, stamen, pistil and seeds) of the cigar in different development stages is analyzed by three analysis software of geNorm, NormFinder and BestKeeper. The results show that the RPL14A and/or UBC27 genes are stably expressed in different tissues of cigar in different development stages, namely the RPL14A and/or UBC27 genes can be used as reference genes for fluorescence quantitative PCR of different tissues of cigar. The invention further provides qRT-PCR primers of the RPL14A gene and the UBC27 gene, and lays a foundation for accurate quantitative analysis of gene expression of different tissues of cigars.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to an internal reference gene suitable for gene expression analysis of different tissues of cigars and application thereof.
Background
Cigars (Nicotiana tabacum L) are round or square smoking cigarettes made of tobacco leaves, and are a special type of tobacco products. The cigar is a pure natural tobacco product, is made by rolling original tobacco leaves after the processes of modulation (air drying and air curing), fermentation and alcoholization, has pure and strong fragrance, comfortable taste and small content of main harmful ingredients (tar and salt and alkali), thereby having little harm to human body, wide market prospect and considerable economic value at present. According to the application in tobacco products, the cigar raw material tobacco leaves are generally called as outer wrappers, inner wrappers and core leaves in China, namely eggplant coats, eggplant sheaths and eggplant cores. Among these, the coat is the outer coat of a cigar, the most beautiful and expensive of cigars, and the only important part seen by consumers.
At present, high-quality cigar tobacco leaves are mainly produced in Guba, America, Ecuador, Indonesia and other countries in the world. The quality of the cigar coat produced in China can not reach the high-quality level, so that the shortage of the raw materials of the high-quality cigar coat in China severely restricts the rapid development of the cigar industry in China. The lack of good varieties and the degeneration of the existing varieties become the main problems of eggplant-coated tobacco leaves. With the rapid development of molecular biology and genetics, the research and improvement of the existing varieties become possible from the perspective of eggplant genes.
The gene expression level analysis by using real-time fluorescent quantitative PCR (qRT-PCR) is an important research means in modern molecular biology, and has the characteristics of accurate quantification, high sensitivity, high flux and the like. In qRT-PCR, analysis of the relative expression amount of a target gene is mainly determined by normalization of an internal reference gene, and therefore, it is very critical to select an appropriate internal reference gene. The ideal internal reference gene should be stably expressed in different developmental stages and different tissues and organs, and the expression level is not affected by other external factors and experimental conditions. The use of a reference gene is required in the analysis of cigar coat gene expression.
Generally, housekeeping genes are widely involved in basic biochemical reactions of organisms, and therefore are often used as reference genes. Currently, the commonly used reference genes include ACTIN family (ACTIN), Ribosomal protein gene (RPL), transcription Elongation factor gene (Elongation factors 1alpha, EF-1 alpha), polyubiquitin gene (UBQ), glyceraldehyde-3-phosphate dehydrogenase Gene (GAPDH), and β -tubulin gene (TUB). However, the expression of these widely used reference genes is not stable under different plant varieties and different experimental conditions; so far, there are few reports on the reference gene screening of cigar. Therefore, the selection of reference genes in cigars remains blind.
Disclosure of Invention
The invention aims to provide an internal reference gene suitable for gene expression analysis of different tissues of cigars, wherein the internal reference gene is RPL14A gene or UBC27 gene, has good stability in different tissues of cigars in different growth periods, and lays a foundation for accurately determining quantitative analysis of transcription expression levels of functional genes of cigars.
The second purpose of the invention is to provide the application of the RPL14A gene or UBC27 gene as a reference gene in qRT-PCR detection of gene transcription expression levels of different tissues of cigars.
In order to achieve the purpose, the invention adopts the following technical scheme:
in one aspect, the invention provides an internal reference gene suitable for gene expression analysis of different tissues of cigars, wherein the internal reference gene is an RPL14A gene or a UBC27 gene, and the nucleotide sequence of the RPL14A gene is shown as SEQ ID No.1 in a sequence table; the nucleotide sequence of the UBC27 gene is shown as SEQ ID NO.2 in the sequence table.
Further, the amplification primers of the RPL14A gene are as follows:
F:ATGCCGTTCAAGAGGTTCG
R:TTAAGCAGCGGTCTTCTTAAG
the amplification primers of the UBC27 gene are as follows:
F:ATGGTGGACTTGGCAAG
R:CTAGCCAGAGCACAGCTTTTC
in another aspect, the invention provides the use of the RPL14A gene and/or UBC27 gene as reference genes in qRT-PCR detection of gene transcription expression levels of different tissues of cigars.
Specific primers for the RPL14A gene were:
F:TCCTCCGCAGCTTCACAA(SEQ ID NO.3)
R:TTTATCTGGCTCCTCACC(SEQ ID NO.4)
specific primers for the UBC27 gene were:
F:CTGGACTGAAACTTTTGC(SEQ ID NO.5)
R:TGGCTTCCAAAGTACTCCT(SEQ ID NO.6)
preferably, a forward primer with a nucleotide sequence shown as SEQ ID NO.3 and a reverse primer with a nucleotide sequence shown as SEQ ID NO.4 are adopted to carry out specific amplification on the RPL14A gene; the UBC27 gene is specifically amplified by using a forward primer with a nucleotide sequence shown as SEQ ID NO.5 and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 6.
Preferably, the qRT-PCR is carried out by sequentially adding the following reagents into a reaction system of 20 mu L: 10 μ L of 2 XSSYBR I Master, 0.5 μ L of each of the upstream and downstream primers, 50ng of cDNA plus ddH2O to 20. mu.L.
Preferably, the reaction procedure of qRT-PCR is as follows: pre-denaturation at 94 ℃ for 30 s; denaturation at 94 ℃ for 5s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 10s, for 45 cycles.
The invention has the following beneficial effects:
the present invention analyzes the expression stability of ten candidate internal reference genes including ribosomal protein genes (RPL8, RPL14A and RPS16), ubiquitin-conjugating enzyme genes (UBC27, UBC28 and UBC35), actin family gene (AC101), transcription elongation factor gene (EIF2), sphingolipid activating protein element (PSAP) and Cysteine Protease Inhibitor (CPI) in different tissues (root, stem, leaf, calyx, corolla, stigma, ovary, stamen, pistil and seed) during different development stages of cigar based on the transcriptome sequencing data of the previous stage and by three analysis software of geNorm, NormFinder and bestkoeper. The result shows that the RPL14A and UBC27 genes are stably expressed in different tissues of cigar in different development periods, namely the RPL14A or UBC27 genes can be used as reference genes of qRT-PCR to normalize the expression level of target genes, and the problem that the genes of different tissues of cigar lack proper reference genes in the aspect of gene expression analysis is solved. In addition, the internal reference genes RPL14A and UBC27 provided by the invention are both derived from transcriptome data of cigars, and compared with the internal reference genes obtained by a traditional homologous comparison method, the internal reference screened by the transcriptome data has the characteristics of high-amount expression and stable expression.
The invention also provides application of the RPL14A gene or the UBC27 gene as a reference gene in qRT-PCR detection of gene transcription expression levels of different tissues of the cigar, and the application can be used for expression analysis of key genes in the cigar development process and can obviously improve the accuracy of obtained data. The invention further provides qRT-PCR primers of the RPL14A gene and the UBC27 gene, and the primers have no non-specific amplification and high specificity amplification efficiency.
Drawings
FIG. 1 is a melting curve of 10 candidate reference genes of cigar;
FIG. 2 is a standard curve of each candidate reference gene primer of cigar during qRT-PCR experiment;
FIG. 3 shows Ct values of qRT-PCR in all samples for the reference gene candidate for cigar.
Detailed Description
The invention will be further described with reference to specific embodiments, but the scope of the invention is not limited thereto; the equipment and reagents used in the examples are, unless otherwise specified, conventionally available commercially.
Example 1 screening of candidate reference genes
1. Screening of candidate reference genes of cigar
10 gene sequences with high expression and consistent expression of roots, stems and leaves are selected from transcriptome sequencing data (uploaded to Chinese nucleic acid database https:// bigd.big. ac.cn/gsa. retrieval number: CRA003020) to serve as candidate internal reference genes (Table 1). Primer design was performed using Primer Premier 5.0 (table 2).
TABLE 1 information on candidate reference genes
Name of Gene | Description of genes | Seq ID |
RPL8 | 60S ribosomal protein L8 | transcript_19714 |
RPL14A | 60S ribosomal protein L14-1 | transcript_22219 |
RPS16 | 40S ribosomal protein S16 | transcript_22287 |
UBC27 | Ubiquitin-conjugating enzyme E2 27 | transcript_20180 |
UBC28 | Ubiquitin-conjugating enzyme E2 28 | transcript_20220 |
UBC35 | Ubiquitin-conjugating |
transcript_21000 |
EIF2 | Eularotic translation initiation factor 2subunit beta | transcript_19181 |
CPI | Cysteine proteinase inhibitor | transcript_22854 |
AC101 | Actin-101 | transcript_16513 |
PSAP | Prosaposin | transcript_19206 |
2. Sampling of different tissues of cigars and total RNA extraction
Tissues of cigars used in the experiment are collected in 2019, and the seedling stage (roots, stems and leaves), the vigorous growth stage (roots, stems and leaves), the full-bloom stage (roots, stems, leaves, calyx, corolla, stigma, ovary, stamen and pistil) and seeds of the cigars are respectively taken. After harvesting, the roots were carefully washed with clean water and blotted dry with filter paper. All samples were frozen immediately after collection with liquid nitrogen and stored in a-80 ℃ freezer.
Taking different tissues of 100mg cigars, quickly grinding the tissues into powder in liquid nitrogen, and extracting RNA of the different tissues of the cigars by using a plant RNA extraction kit. mu.L of the original sample RNA was diluted 10-fold or 100-fold, and 5. mu.L of the diluted sample was subjected to 1% agarose gel electrophoresis to examine the integrity of the RNA sample. And 1. mu.L RNA was used to determine the purity and concentration of RNA samples using a micro-UV spectrophotometer (NanoDrop 2000). And (4) storing qualified samples at-80 ℃ for later use.
3. Reverse Transcription (RT)
Taking total RNA of each tissue of cigar as a template, and sequentially adding the following reagents in the setting of a reverse transcription system of 20 mu L and the reaction process: mu.g RNA, 1. mu.L Oligo (dT) Primer (20. mu. mol/L), plus RNase-free H2O to 13 μ L; after 10min of incubation at 65 ℃, the centrifuge tube is quickly placed in an ice bath, 4 mu L of Transcriptor Reverse Transcriptase 5. about. Buffer, 0.5 mu L of Detector RNase Inhibitor, 2 mu L of Deoxinucleotide Mix and 0.5 mu L of Transcriptor Reverse Transcriptase are added again, after slow mixing, the centrifuge tube is incubated for 30min at 55 ℃, incubated for 5min at 85 ℃, the centrifuge tube is quickly placed in an ice bath, and after 5-10 times of dilution by adding water, the centrifuge tube is preserved at-20 ℃.
4. Polymerase Chain Reaction (PCR)
And (3) designing primers for cloning 10 candidate genes by using the cDNA obtained in the step (3) as a template, wherein the cloning primers are shown in a table 2.
TABLE 2 cloning primers for candidate reference genes
The following 20. mu.L reaction system was used for PCR: 50ng template, 1. mu.L of forward and reverse primers, 1. mu.L of Hifi taq enzyme (all-type gold Biotech Co., Ltd.), and water were added to 20. mu.L.
The PCR reaction program was set up as follows: pre-denaturation at 94 deg.C for 4min, denaturation at 94 deg.C for 30s, annealing at 56 deg.C for 30s, and extension at 72 deg.C for 1min, for 30 cycles, final extension at 72 deg.C for 10min, and storing at 4 deg.C. The PCR product was subjected to 1% agarose gel electrophoresis to detect the desired fragment.
5. Cloning and sequencing of the Gene of interest
And (3) performing gel cutting recovery on the target fragment, connecting the purified DNA fragment to a pMD18-T simple vector, transferring the DNA fragment into an escherichia coli competent cell DH5 alpha, and sequencing the positive clone through PCR detection.
Example 2 primer design and qRT-PCR for candidate reference genes
The sequence of the gene is obtained by a third generation sequencing combined transcriptome sequencing method, and then specific qPCR primers are designed, wherein the sequences of the candidate reference gene primers are shown in Table 3. The cDNAs of 10 samples (roots, stems, leaves, calyx, corolla, stigma, ovary, stamen, pistil) and seeds) were mixed in equal amounts as templates and diluted in 5-fold gradient, i.e., the concentration of each template was 1 and 10 respectively-1、10-2、10-3、10-4In total, 5 gradients were used for fluorescent quantitative PCR to generate a standard curve (FIG. 2).
RT-qPCR amplification reaction is carried out by using a Roche Light Cycler 96 real-time fluorescent quantitative PCR instrument, and the following reagents are sequentially added into a 20 mu L reaction system: 10 μ L of 2 XSSYBR I Master, 0.5 μ L of each of the upstream and downstream primers, 50ng of cDNA plus ddH2O to 20. mu.L. The PCR reaction program is: pre-denaturation at 94 ℃ for 30 s; denaturation at 94 ℃ for 5s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 10s, for 45 cycles.
After the reaction is complete, the cycle threshold (CT value, as shown in FIG. 3) is calculated by 2-ΔΔCTThe method calculates the relative expression level of the reference gene. The amplification efficiency of the primers was calculated using the formula (10-1/K-1) × 100%. Where E is the amplification efficiency and K is the slope of the standard curve. Each reaction was set to 3 replicates and the data obtained was analyzed by Excel and the results are shown in table 3.
TABLE 3 candidate reference Gene qPCR primers and related information
As can be seen from the table, the correlation coefficient R of the standard curve of 10 candidate reference genes2More than 0.981, the amplification efficiency is between 91% and 107%, the dissolution curves only generate single melting peaks, and no non-specific amplification interference exists, so that the linear analysis and the amplification efficiency of each candidate internal reference gene meet the requirements.
As can be seen from FIG. 1, the average C of 10 candidate reference genestThe value is between 21.39(RPL8) and 29.93(PSAP), and the expression graduation distribution range is wide. Among the 10 candidate reference genes, the expression levels of UBC28, UBC35 and AC101 genes were more enriched, and the average C of all samplestValues are 24.00, 24.66 and 25.21, respectively; the expression level of the RPL8 gene was most dispersed, with a maximum of 27.51, a minimum of 21.39, and an average Ct value of 24.4.
Example 3 stability analysis of candidate reference genes
To screen for the best reference gene, the stability of each candidate reference gene was evaluated analytically by three software, geonorm, NormFinder and Bestkeeper. Wherein, the geNorm software is CtThe value is original data, expression stability of the candidate reference gene is judged by calculating expression stability values (M) of the candidate reference gene in different samples, the larger the M value is, the lower the gene stability is, and conversely, the smaller the M value is, the higher the gene stability is. Generally, when the M value is 1.5 or less, the gene expression is considered to be stable, and the gene is suitable for use as an internal reference gene. Among the 10 candidate genes, RPL14A and UBC27 were the most stable, PSAP the least stable.
NormFinder software is similar to geNorm, also CtThe value is original data, the expression stability is judged by calculating the expression stability value of the candidate reference gene, and the smaller the stability value is, the more suitable the value is for serving as the reference gene. From the results of NormFinder, UBC27 and RPL14A were also the most stable, and were substantially consistent with the results of the analysis by the geNorm software.
Bestkeeper software average C in samples according to different candidate reference genestValues were calculated for the Standard Deviation (SD), correlation coefficient (r) and coefficient of variation (coe) that produced pairings between pairs of genesAnd (CV) comparing the values, and finally selecting the reference gene with good stability. The larger the correlation coefficient, the smaller the standard deviation and the coefficient of variation, the better the stability of the reference gene. When SD>1, the expression of the reference gene is unstable. The results of the Bestkeeper software analysis showed that RPL14A and UBC27 were the most stable, consistent with the results of the geonorm and NormFinder analyses.
TABLE 4 stability analysis of the three software
In conclusion, through various evaluation and analysis methods, two optimal reference genes suitable for the gene expression analysis of cigars in different tissues are finally screened, namely RPL14A and UBC 27.
<110> Zhengzhou tobacco institute of China tobacco general Co
<120> reference gene applicable to gene expression analysis of different tissues of cigar and application thereof
<160> 42
<170> PatentIn version 3.5
<210> 1
<211> 402
<212> DNA
<213> cigar (Nicotiana tabacum L.)
<221> RPL14A Gene
<400> 1
atgccgttca agaggttcgt ggagattgga agggtagcct taatcaacta cggaaaggaa 60
tatggcaagc tggtcgttat agtcgatgtc atcgaccaaa atagggctct tgttgatgct 120
ccagacatgg tgaggagcca gattaacttc aagagacttt cactcacaga tatcaaaatt 180
gacatcaaaa gaatcccaaa gaagaagacc ttggtcgagg ctatggaagc tgctgatgtg 240
aagaccaagt gggagaacag ttcatgggga aggaagttga tagtgcagaa gaggagggct 300
gcacttaacg attttgacag gttcaagctt atgttggcaa agattaagag ggccggagtt 360
gtgagacagg agcttgcaaa gcttaagaag accgctgctt aa 402
<210> 2
<211> 579
<212> DNA
<213> cigar (Nicotiana tabacum L.)
<221> UBC27 Gene
<400> 2
atggtggact tggcaagggt acaaaaggag ctgcaagagt gcaacagaga tgttggggtt 60
tcaggaataa gtgtaaccct taaaggtgac agtctcactc acttgattgg tacaatccct 120
ggtcctcttg gtactcctta tgaaggtggt tctttcaaga tcgatatcac tcttactgat 180
ggctacccat tcgagcctcc aaaaatgaga tttgccacaa aagtttggca tcctaatata 240
agtagccaaa gtggagcaat atgcctagac atcctgaaag accagtggag cccagcgcta 300
actctcaaga cagctctcct ttctatacaa gcattactct ctgctcctga acctgatgat 360
ccacaagatg cagttgttgc acaacagtat ctcagagacc atcagacctt tgttggcaca 420
gctcgttact ggactgaaac atttgcgaaa acacttggca ccgaggagaa gatacaaaag 480
cttgtggaaa tggggtttcc agaagctcaa gtgaggagta ctttggaagc cacaggttgg 540
gatgaaaaca tggcacttga aaagctgtgc tctggctag 579
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence
<221> qRT-PCR primer F for RPL14A gene
<400> 3
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence
<221> qRT-PCR primer R for RPL14A gene
<400> 4
<210> 5
<211> 18
<212> DNA
<213> Artificial sequence
<221> UBC27 Gene qRT-PCR primer F
<400> 5
<210> 6
<211> 19
<212> DNA
<213> Artificial sequence
<221> UBC27 Gene qRT-PCR primer R
<400> 6
tggcttccaa agtactcct 19
<210> 7
<211> 19
<212> DNA
<213> Artificial sequence
<221> RPL8 Gene cloning primer F
<400> 7
atgggtcgtg taatcagag 19
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<221> RPL8 Gene cloning primer R
<400> 8
<210> 9
<211> 19
<212> DNA
<213> Artificial sequence
<221> RPL14A Gene cloning primer F
<400> 9
atgccgttca agaggttcg 19
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence
<221> RPL14A Gene cloning primer R
<400> 10
ttaagcagcg gtcttcttaa g 21
<210> 11
<211> 18
<212> DNA
<213> Artificial sequence
<221> RPS16 Gene cloning primer F
<400> 11
atgggtcgtc gtggagtc 18
<210> 12
<211> 18
<212> DNA
<213> Artificial sequence
<221> RPS16 Gene cloning primer R
<400> 12
<210> 13
<211> 18
<212> DNA
<213> Artificial sequence
<221> UBC27 Gene cloning primer F
<400> 13
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<221> UBC27 Gene cloning primer R
<400> 14
ctagccagag cacagctttt c 21
<210> 15
<211> 19
<212> DNA
<213> Artificial sequence
<221> UBC28 Gene cloning primer F
<400> 15
atggcttcga aacgaatat 19
<210> 16
<211> 21
<212> DNA
<213> Artificial sequence
<221> UBC28 Gene cloning primer R
<400> 16
tcatcccttt ccatatgaaa c 21
<210> 17
<211> 18
<212> DNA
<213> Artificial sequence
<221> UBC35 Gene cloning primer F
<400> 17
atggcgaaca gcaatcttc 19
<210> 18
<211> 21
<212> DNA
<213> Artificial sequence
<221> UBC35 Gene cloning primer R
<400> 18
tcatgcacca ctagcatata g 21
<210> 19
<211> 20
<212> DNA
<213> Artificial sequence
<221> EIF2 Gene cloning primer F
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence
<221> EIF2 Gene cloning primer R
<400> 20
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence
<221> CPI Gene cloning primer F
<400> 21
atggcaactc taggaggaat 20
<210> 22
<211> 19
<212> DNA
<213> Artificial sequence
<221> CPI Gene cloning primer R
<400> 22
ttaagcacta gcggcatcc 19
<210> 23
<211> 18
<212> DNA
<213> Artificial sequence
<221> primer F for cloning AC101 Gene
<400> 23
<210> 24
<211> 21
<212> DNA
<213> Artificial sequence
<221> primer R for cloning AC101 Gene
<400> 24
ttagaagcat ttccggtgaa c 21
<210> 25
<211> 19
<212> DNA
<213> Artificial sequence
<221> PSAP Gene cloning primer F
<400> 25
atgctatttc ttgaatctgg 20
<210> 26
<211> 19
<212> DNA
<213> Artificial sequence
<221> PSAP Gene cloning primer R
<400> 26
<210> 27
<211> 19
<212> DNA
<213> Artificial sequence
<221> RPL8 Gene qRT-PCR primer F
<400> 27
gacggtctca aatccgatc 19
<210> 28
<211> 18
<212> DNA
<213> Artificial sequence
<221> RPL8 gene qRT-PCR primer R
<400> 28
<210> 29
<211> 20
<212> DNA
<213> Artificial sequence
<221> RPS16 Gene qRT-PCR primer F
<400> 29
<210> 30
<211> 18
<212> DNA
<213> Artificial sequence
<221> RPS16 gene qRT-PCR primer R
<400> 30
<210> 31
<211> 21
<212> DNA
<213> Artificial sequence
<221> UBC28 Gene qRT-PCR primer F
<400> 31
tagtgtcaag ccaaaggaaa c 21
<210> 32
<211> 18
<212> DNA
<213> Artificial sequence
<221> UBC28 Gene qRT-PCR primer R
<400> 32
<210> 33
<211> 18
<212> DNA
<213> Artificial sequence
<221> UBC35 Gene qRT-PCR primer F
<400> 33
<210> 34
<211> 21
<212> DNA
<213> Artificial sequence
<221> UBC35 Gene qRT-PCR primer R
<400> 34
gaggctgaag ctgttgaaac g 21
<210> 35
<211> 19
<212> DNA
<213> Artificial sequence
<221> EIF2 gene qRT-PCR primer F
<400> 35
gaatatgagg agcttctgg 19
<210> 36
<211> 19
<212> DNA
<213> Artificial sequence
<221> EIF2 gene qRT-PCR primer R
<400> 36
tgtgccttca cgaagaact 19
<210> 37
<211> 18
<212> DNA
<213> Artificial sequence
<221> qRT-PCR primer F for CPI gene
<400> 37
<210> 38
<211> 18
<212> DNA
<213> Artificial sequence
<221> qRT-PCR primer R for CPI gene
<400> 38
<210> 39
<211> 18
<212> DNA
<213> Artificial sequence
<221> qRT-PCR primer F for AC101 gene
<400> 39
<210> 40
<211> 18
<212> DNA
<213> Artificial sequence
<221> qRT-PCR primer R for AC101 gene
<400> 40
<210> 41
<211> 19
<212> DNA
<213> Artificial sequence
<221> PSAP Gene qRT-PCR primer F
<400> 41
ctgagagaaa tatcgagag 19
<210> 42
<211> 19
<212> DNA
<213> Artificial sequence
<221> PSAP Gene qRT-PCR primer R
<400> 42
gtggatcagt atgttcgtc 19
Claims (5)
1. The reference gene suitable for gene expression analysis of different tissues of cigars is characterized in that the reference gene is RPL14A gene or UBC27 gene, and the nucleotide sequence of the RPL14A gene is shown as SEQ ID No.1 in a sequence table; the nucleotide sequence of the UBC27 gene is shown as SEQ ID NO.2 in the sequence table.
Application of RPL14A gene or UBC27 gene as reference gene in qRT-PCR detection of gene transcription expression levels of different tissues of cigar.
3. The use according to claim 2, characterized in that the RPL14A gene is specifically amplified using a forward primer having a nucleotide sequence as shown in SEQ ID No.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID No. 4; the UBC27 gene is specifically amplified by using a forward primer with a nucleotide sequence shown as SEQ ID NO.5 and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 6.
4. The use of claim 3, wherein the qRT-PCR is performed by sequentially adding the following reagents into a 20 μ L reaction system: 10 μ L of 2 XSSYBR I Master, 0.5 μ L of each of the upstream and downstream primers, 50ng of cDNA plus ddH2O to 20. mu.L.
5. The use of claim 3, wherein the reaction sequence of qRT-PCR is: pre-denaturation at 94 ℃ for 30 s; denaturation at 94 ℃ for 5s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 10s, for 45 cycles.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110156904.3A CN112813181B (en) | 2021-02-04 | 2021-02-04 | Reference gene suitable for gene expression analysis of different tissues of cigar and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110156904.3A CN112813181B (en) | 2021-02-04 | 2021-02-04 | Reference gene suitable for gene expression analysis of different tissues of cigar and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112813181A true CN112813181A (en) | 2021-05-18 |
CN112813181B CN112813181B (en) | 2022-07-26 |
Family
ID=75861356
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110156904.3A Active CN112813181B (en) | 2021-02-04 | 2021-02-04 | Reference gene suitable for gene expression analysis of different tissues of cigar and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112813181B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113604599A (en) * | 2021-08-19 | 2021-11-05 | 浙江农林大学 | Fluorescent quantitative PCR reference gene stably expressed in different tissues of cinnamomum camphora and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008078969A1 (en) * | 2006-12-27 | 2008-07-03 | Snu R&Db Foundation | Data processing, analysis method of gene expression data to identify endogenous reference genes |
CN105132417A (en) * | 2015-09-07 | 2015-12-09 | 安徽农业大学 | Tea tree miRNA fluorescent quantitative PCR reference gene under low temperature stress as well as screening method and application of reference gene |
CN110734912A (en) * | 2019-07-08 | 2020-01-31 | 中国农业科学院植物保护研究所 | Partial sequence of internal reference gene of sitobion avenae, cloning method and application |
-
2021
- 2021-02-04 CN CN202110156904.3A patent/CN112813181B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008078969A1 (en) * | 2006-12-27 | 2008-07-03 | Snu R&Db Foundation | Data processing, analysis method of gene expression data to identify endogenous reference genes |
CN105132417A (en) * | 2015-09-07 | 2015-12-09 | 安徽农业大学 | Tea tree miRNA fluorescent quantitative PCR reference gene under low temperature stress as well as screening method and application of reference gene |
CN110734912A (en) * | 2019-07-08 | 2020-01-31 | 中国农业科学院植物保护研究所 | Partial sequence of internal reference gene of sitobion avenae, cloning method and application |
Non-Patent Citations (4)
Title |
---|
ESEUL BAEK ET AL.: "Validation of reference genes for quantifying changes in gene expression in virus-infected tobacco", 《VIROLOGY》 * |
GENBANK: "PREDICTED: Nicotiana sylvestris ubiquitin-conjugating enzyme E2 27 (LOC104229371),mRNA,Genbank,XM_009782014.1", 《GENBANK》 * |
GENBANK: "PREDICTED: Nicotiana tabacum probable 60S ribosomal protein L14 (LOC107807698), mRNA,Genbank,XM_016632134.1", 《GENBANK》 * |
张慧等: "雪茄烟叶(BESNO H382)不同组织器官及盐胁迫条件下内参基因的筛选", 《烟草科技》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113604599A (en) * | 2021-08-19 | 2021-11-05 | 浙江农林大学 | Fluorescent quantitative PCR reference gene stably expressed in different tissues of cinnamomum camphora and application thereof |
CN113604599B (en) * | 2021-08-19 | 2023-09-22 | 浙江农林大学 | Fluorescent quantitative PCR reference gene stably expressed in different tissues of Cinnamomum camphora and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN112813181B (en) | 2022-07-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107190062B (en) | Screening and application of fluorescent quantitative reference genes of pear fruits in different development periods | |
CN112575010A (en) | Reference gene for fluorescence quantification of different tissues of Chinese yam as well as primer and application thereof | |
CN112877465B (en) | Fluorescent quantitative reference genes of different tissues of cryptomeria fortunei, special primers and application thereof | |
CN111100945B (en) | Reference gene of toona sinensis, primer and application thereof | |
CN112813181B (en) | Reference gene suitable for gene expression analysis of different tissues of cigar and application thereof | |
CN114196772B (en) | Real-time quantitative PCR reference gene under different tissues and stress treatment conditions of tilia miqueliana as well as screening method and application thereof | |
CN113774065B (en) | Fluorescent quantitative internal reference gene for different adults of fall webworm, primer and application thereof | |
CN108085409B (en) | Screening method of fir reference gene in different tissues and application of screening gene as reference gene | |
CN112760405B (en) | Internal reference gene suitable for cigar gene expression analysis under salt stress condition and application thereof | |
CN106754965B (en) | One kind reference gene relevant to poplar adversity gene expression regulation and its application | |
CN114292901B (en) | Screening method of blueberry real-time fluorescence quantitative PCR reference genes | |
CN113755497B (en) | Screening of reference genes in development process of taro corms and application thereof | |
CN112980989A (en) | MiRNA fluorescent quantitative reference gene of different tissues of cryptomeria fortunei as well as primer and application thereof | |
Tao et al. | Quantitative analysis of ATP sulfurylase and selenocysteine methyltransferase gene expression in different organs of tea plant (Camellia sinensis) | |
CN112481404A (en) | Adenophora bungeana internal reference gene, primers and screening method under saline-alkali cultivation condition | |
CN112760403B (en) | Reference gene of towel gourd, primer and application thereof | |
CN116219052B (en) | Marker gene Pt7G61650 for identifying different periods of nutrient growth of slash pine and application method thereof | |
CN114438243B (en) | Screening and application of taro bulb development internal reference gene CeRPL28 | |
García-Valencia et al. | High quality RNA isolation and exogenous reference gene for real-time PCR in Cedrela odorata seed physiology studies | |
CN116064576B (en) | Internal reference gene of oat under ultraviolet stress, primer sequence and application of internal reference gene | |
CN116497150A (en) | Fluorescent quantitative reference gene of different tissues of Betula alnoides and root systems of ECM fungi in different colonisation periods and primers thereof | |
CN117887734B (en) | Pt9G41650 gene and application of protein thereof in judging dormancy degree of Chinese pine seeds | |
CN108728443B (en) | Bn-miR6 of ramie and application thereof | |
CN110982928B (en) | Reference gene of red Chinese toon leaf and stem tissues under insect pest stress, primer and application thereof | |
Xu et al. | Screening of suitable reference genes for gene expression using quantitative real-time PCR in Gynura bicolor DC. |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |