CN108728443B - Bn-miR6 of ramie and application thereof - Google Patents
Bn-miR6 of ramie and application thereof Download PDFInfo
- Publication number
- CN108728443B CN108728443B CN201810660629.7A CN201810660629A CN108728443B CN 108728443 B CN108728443 B CN 108728443B CN 201810660629 A CN201810660629 A CN 201810660629A CN 108728443 B CN108728443 B CN 108728443B
- Authority
- CN
- China
- Prior art keywords
- ramie
- mir6
- sequence
- cadmium
- target gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Abstract
The invention discloses a Bn-miR6 of ramie and application thereof, wherein the nucleotide sequence of the Bn-miR6 is shown as a sequence 1; the precursor Bn-MIR6 is shown as a sequence 2; the DNA sequence of the gene for coding the precursor Bn-MIR6 is shown as a sequence 3; the nucleotide sequence of the Bn-miR6 regulated target gene comp37728_ c0 is shown in a sequence 4. The ramie miRNA (Bn-miR6) can regulate a target gene comp37728_ c0, and the target gene is related to the disease resistance and stress resistance of ramie, so that the aim of regulating and controlling the absorption of ramie to cadmium is fulfilled. The Bn-miR6 and the expression quantity of the target gene comp37728_ c0 of the ramie are in inverse proportion, and the reduction expression of the Bn-miR6 can promote the absorption of cadmium by the ramie, so that the Bn-miR6 regulates the cadmium absorption quantity of the ramie by regulating the expression of the target gene, and has potential application value in the cultivation of cadmium hyper-enrichment ramie varieties.
Description
Technical Field
The invention belongs to the technical field of botany, and particularly relates to Bn-miR6 of ramie and application thereof.
Background
Cadmium is a heavy metal element with the highest biological toxicity, which not only affects the ecological structure and functions of soil, but also inhibits the growth and development of crops, reduces the yield and quality, enters human bodies through food chains, causes various diseases and finally harms the health of the human bodies. The cadmium-polluted farmland area in China is nearly 1.33 million hectares, the pollution range relates to 25 areas in 11 provinces, and the pollution degree tends to increase year by year. The method for treating the cadmium-polluted soil is the most economical and effective method for reducing the cadmium content in the soil by planting crops capable of absorbing cadmium.
The ramie is an ancient natural fiber crop and a characteristic crop in China, and the cultivation area and the total yield of the ramie account for more than 90 percent of the world. The ramie has high absorption resistance to cadmium, has the advantages of strong adaptability, rapid growth, strong reproductive capacity, developed root system, high biological yield and the like, overcomes the defects of short and small plants, low growth speed, great influence of climate, difficulty in realizing practical application value and the like of the existing super-accumulation plants in many aspects, has good ecological benefit, and is an ideal plant for repairing cadmium-polluted soil. At present, regarding screening of different varieties of ramie to increase the absorption of cadmium in ramie, for example, in patent 201110025715.9, the varieties of ramie are classified into high-tolerance low-absorption type, high-tolerance high-absorption type, low-tolerance low-absorption type and low-tolerance high-absorption type by the ramie variety screening method, and it is directed that a ramie farmer plants different varieties in soil with different cadmium pollution degrees. Some other agents are added to cooperate with ramie to improve the absorption of ramie to cadmium, for example, in patent 201410718494.7, a biodegradable chelating agent EDDS is applied during the planting process of ramie to improve the absorption of ramie to cadmium.
microRNA (miRNA) is a kind of endogenous small molecular non-coding RNA with the length of 19-24 basic groups, regulates the expression of target genes through basic group complementation and participates in regulating and controlling the growth and development of plants and various abiotic and biotic stresses. However, the existing method for improving the absorption of ramie to cadmium is auxiliary improvement, and does not relate to the research on the molecular mechanism theory of ramie absorption of cadmium.
Disclosure of Invention
The invention aims to provide ramie Bn-miR6 and application thereof, which can control the down-regulation expression of the gene and improve the absorption of ramie on cadmium.
The nucleotide sequence of the ramie Bn-miR6 is shown as a sequence 1.
The nucleotide sequence of the precursor sequence Bn-MIR6 of the ramie Bn-miR6 is shown as a sequence 2.
The DNA sequence of the precursor Bn-MIR6 gene is coded, and the nucleotide sequence is shown as sequence 3.
The nucleotide sequence of the Bn-miR6 regulated target gene comp37728_ c0 is shown as a sequence 4.
The Bn-miR6 is applied to regulation and control of cadmium absorption of ramie.
The Bn-miR6 is applied to culturing the cadmium-enriched ramie variety.
Wherein Bn in Bn-miR6 is the abbreviation of Boehmeria nivea in Latin, and miR represents miRNA.
The invention obtains a new miRNA (Bn-miR6) from ramie through screening, the expression of the miRNA is reduced under the stress of cadmium, a TargetFinder software is used for predicting a target gene of Bn-miR6, the target gene regulated by Bn-miR6 is comp37728_ c0, and the target gene is related to the disease resistance and stress resistance of ramie. Through analyzing the expression amounts of Bn-miR6 and comp37728_ c0, the result shows that Bn-miR6 and the expression amount of the target gene comp37728_ c0 are in inverse relation, so that the expression of Bn-miR6 is reduced, and the absorption of cadmium by plants can be promoted.
The invention has the beneficial effects that: the ramie miRNA (Bn-miR6) can adjust the target gene comp37728_ c0, thereby influencing the synthesis of ramie AGO2 protein and achieving the purpose of regulating and controlling the absorption of ramie to cadmium. The Bn-miR6 and the expression quantity of the target gene comp37728_ c0 of the ramie are in inverse proportion, and the reduction expression of the Bn-miR6 can promote the absorption of cadmium by the ramie, so that the Bn-miR6 regulates the cadmium absorption quantity of the ramie by regulating the expression of the target gene, and has potential application value in the cultivation of cadmium hyper-enrichment ramie varieties.
Drawings
FIG. 1 shows the secondary structure of Bn-MIR6 as a precursor sequence of Bn-miR 6.
FIG. 2 shows the cadmium absorption amount of different parts of ramie plant under cadmium stress treatment.
FIG. 3 shows the expression quantity change of Bn-miR6 in ramie leaves under cadmium stress.
FIG. 4 shows the expression level change of the target gene comp37728_ c0 of Bn-miR6 in the leaves of ramie under cadmium stress.
Detailed Description
Example 1
The invention will be further illustrated and described with reference to specific examples, without however restricting the scope of the invention thereto.
The experimental procedures in the following examples are, unless otherwise specified, conventional in the art. The materials, reagents and the like used are commercially available unless otherwise specified.
Example 1 screening and identification of miRNA
1. Preparation of plant materials and samples
Treatment group: taking the tender tips (10-15cm) of No. 1 ramie variety in ramie, sterilizing with carbendazim for 10s, cutting in a water circulation device, culturing in a greenhouse, treating with 10mg/L cadmium chloride when the root length reaches 10cm, collecting fully-unfolded ramie leaves after 20 days, quick freezing with liquid nitrogen, and freezing at-80 deg.C for later use.
Control group: the control group was prepared by changing the concentration of 10mg/L cadmium chloride in the treated group to water and leaving the other experimental conditions unchanged.
2. High-throughput sequencing of ramie miRNA
RNA extraction: grinding the leaves into powder in liquid nitrogen, and extracting RNA by adopting an EASYspin plant microRNA rapid extraction kit produced by Beijing Edley Biotechnology Limited; detecting the RNA quality by using a micro ultraviolet spectrophotometer and agarose gel electrophoresis, wherein the RNA OD60/OD80 is 1.8-2.2, and electrophoresis shows that 28S and 18S bands are clear and are not degraded, so that the RNA quality is qualified; RNA integrity was tested using an Agilent 2100Bioanalyzer and was greater than 8.0, indicating high RNA integrity.
Library construction: and (3) detecting qualified RNA to construct a miRNA library, wherein the construction of the miRNA library is carried out according to an Illumina sampleselection Protocol library construction method, and then HiSeq2500 high-throughput sequencing is adopted to finish the miRNA library by the Bekkiso Biotech company.
Identification of miRNA
After obtaining raw reads data by HiSeq2500 high-throughput sequencing, the obtained original data sequence is subjected to street removal, low-quality removal, removal of unknown base N content of more than or equal to 10%, decontamination, vector sequence removal, sequence removal shorter than 18 or longer than 30 nucleotides and other treatment, and clean sequences (clean reads) for subsequent analysis are obtained. Utilizing Bowtie software to respectively carry out sequence alignment on clearreads with a Silva database, a GtRNAdb database, a Rfam database and a Redbase database, and filtering ncRNAs such as ribosomal RNA (rRNA), transfer RNA (tRNA), small nuclear RNA (snRNA) and small nuclear RNA (snorNA) and repeated sequences to obtain Unnatted reads containing miRNA. Unnannatured Reads were aligned to the assigned ramie transcriptome using miRDeep2 software to obtain Mapped Reads. Aligning the nucleotide sequence of 18-30nt to a specific species in a miRBase database by using miRDeep2 software, and identifying the known miRNA of the species; and filtering the obtained reference genome, performing miRNA structure prediction by base number extension, and performing secondary structure analysis. The secondary structure in this example is shown in figure 1, which forms a stable stem-loop structure resembling the precursor of miRNA, indicating that this sequence can be identified as a novel miRNA in ramie. By the method, the ramie new miRNA induced by cadmium stress is identified and named as Bn-miR6, and the mature sequence of the ramie new miRNA is as follows: UUAGAUUCACGCUCAAACUCG (shown as a sequence 1), and the precursor sequence Bn-MIR6 is shown as a sequence 2.
Bn-miR6 differential expression analysis
The miRNA sequences from the control group and the treatment group treatment library are compared and analyzed by using DESeq software, and differential expression analysis between sample groups is carried out by using | log2(fold change) | ≧ 1 and Benjamini-Hochberg error discovery rate correction P-value <0.01 as screening conditions. The results show that the expression of Bn-miR6 in the treatment group is reduced in the ramie leaves.
Prediction of Bn-miR6 target genes
And (3) predicting the target gene of Bn-miR6 by using TargetFinder software, annotating the obtained target gene by bioinformatics, and comparing the predicted target gene sequence with the ramie genome to obtain the genome sequence of the target gene, wherein the sequence is shown as sequence 4 and is comp37728_ c0 gene.
Example 2 analysis of expression amount of Bn-miR6
1. Plant material and sample preparation was as in example 1, 1.
Analysis of expression level of Bn-miR6
Taking the extracted qualified RNA as a sample, carrying out reverse transcription by adopting a Specific Stem-loop RT Primer third-generation kit to obtain a cDNA first chain, taking cDNA as a template, carrying out q-PCR (polymerase chain reaction) detection on the expression quantity of Bn-miR6 by adopting a reverse Primer and a forward Primer F1 which are commonly used in the kit, carrying out q-PCR detection on 18SrRNA (internal reference gene) by adopting a Primer pair consisting of F2 and R2, and calculating the relative expression quantity of Bn-miR 6. The specific operation steps are as follows:
1) RNA extraction: taking a sample stored at-80 deg.C, grinding into powder with liquid nitrogen, collecting powder about 100mg, rapidly adding 1ml refrigerated trizol, and homogenizing with homogenizer for 2 min; adding chloroform according to the proportion of 200 mu L chloroform/1 mL Trizol, quickly mixing for 15s, and standing for 2-3min at room temperature; centrifuging at 12000g for 15min at 2-8 deg.C, and extracting upper water phase 600 μ l; adding isopropanol into the extracted water phase at a ratio of 1:1, gently blowing and mixing, and standing at room temperature for 10 min; centrifuging at 12000g for 10min at 2-8 deg.C, precipitating RNA at the bottom of the tube, and sucking out the upper layer waste liquid (sucking the liquid as clean as possible); adding 75% cold alcohol stored at-20 deg.C according to the ratio of 1mL 75% alcohol/1 mL Trizol, reversing for 3 times, suspending and precipitating, centrifuging at 2-8 deg.C for 5min at 7500g, discarding the upper layer waste liquid, and drying in air for 5-10 min; add 50 u L RNase free water to dissolve RNA, determine the concentration for use.
2) Reverse transcription: taking the extracted RNA as a template, and adopting a Specific Stem-loop RT Primer third-generation kit to carry out reverse transcription to form a cDNA first chain, wherein a reverse transcription system is as follows:
| item | Dosage of |
| Total RNA | ～200ng |
| Specific Stem-loop RT Primer Mix | 2μl |
| 5x M-MLV buffer | 4μl |
| 25mMdNTP | 0.4μl |
| Rnase inhibitor | 0.5μl |
| 200U/μL M-MLV | 0.5μl |
| Rnase Free H2O | Upto20μl |
Ice for 5min, 16 deg.C for 30min, 42 deg.C for 30min, 85 deg.C for 5min, 4 deg.C for 1 s. 18SrRNA reverse transcription:
preparing a reaction solution:
| total RNA stock solution | ～200ng |
| 100μMoligo(dT) | 1μl |
| Rnase Free H2O | To 12. mu.l |
Cooling at 70 deg.C for 10min, and rapidly cooling on ice for 2 min.
Reverse transcription system:
| item | Dosage of |
| The above reaction solution | 12μl |
| 5x M-MLV buffer | 4μl |
| 25mMdNTP | 0.4μl |
| Rnase inhibitor | 0.5μl |
| 200U/μL M-MLV | 0.5μl |
| Rnase Free H2O | Upto20μl |
The obtained cDNA was stored at 42 ℃ for 60min, 85 ℃ for 5min, 4 ℃ for 1s and-20 ℃.
3) q-PCR experiment
Forward primer F1: TTAGATTCACGCTCAAACTCG (SEQ ID NO: 5);
reverse primer R1: universal primers of the kit;
forward primer F2: ATGATAACTCGACGGATCGC (SEQ ID NO: 6);
reverse primer R2: CTTGGATGTGGTAGCCGTTT (seq id No. 7), PCR reaction was made on ice:
| item | Dosage of |
| cDNA | 0.2μl |
| 2×SYBR mix | 5μl |
| 0.5μMeachprimer | 4μl |
| ddH2O | Make up to 10. mu.l |
And (3) fully and uniformly mixing the PCR reaction solution, sucking the reaction solution into each PCR reaction hole, sealing a heat sealing film, and centrifuging for a short time to ensure that all reagents are thrown to the bottom of the reaction tube. Detecting target miRNA on Roche light cycler 480II PCR instrument, wherein the PCR reaction program is as follows:
| number of cycles | Step (ii) of | Temperature of | |
| 1 | Pre-denaturation/enzyme activation | 94℃ | 10min |
| 45 | Denaturation of the material | 82℃ | 20sec |
| Annealing/stretching | 60℃ | 20sec |
And (3) melting curve analysis:
18SrRNA reaction procedure:
| number of cycles | Step (ii) of | Temperature of | |
| 1 | Pre-denaturation/enzyme activation | 94℃ | 10min |
| 45 | Denaturation of the material | 94℃ | 20sec |
| Annealing/stretching | 60℃ | 30sec |
And analyzing the same target miRNA by using a melting curve. And calculating the relative expression quantity of the Bn-miR6 by taking the internal reference gene as reference. The relative expression of Bn-miR6 in the example is shown in FIG. 3, and the results show that under cadmium stress treatment in the treatment group, Bn-miR6 down-regulates expression in ramie leaves relative to a control (ramie which is not subjected to cadmium stress treatment), and the expression trend is consistent with the expression trend of the expression in sequencing analysis.
Example 3 analysis of expression level of the target Gene comp37728_ c0 of Bn-miR6
1. Plant material and sample preparation was as in example 1, 1.
Analysis of expression level of Bn-miR6 target Gene
A cDNA sample was prepared according to the method for reverse transcription of 18SrRNA in example 2, using the target gene forward primer F3: TGTGCTTGGACCTCATTGAA (SEQ ID NO: 8) and reverse primer F3: CATGTCAAACTGGCCATCAC (SEQ ID NO: 9) primer pair amplifies target gene, 18SrRNA is used as reference gene (forward primer F4: TGACGGAGAATTAGGGTTCGA (SEQ ID NO: 10) and reverse primer F4: CCGTGTCAGGATTGGGTAATTT (SEQ ID NO: 11), the expression level of target gene is detected on Roche light cycler 480II PCR instrument, the PCR reaction system and reaction procedure are as same as 18SrRNA in example 2, the expression level of target gene is shown in FIG. 4. the result shows that under the treatment of cadmium stress, the expression level of target gene comp37728_ c0 of Bn-miR6 is inversely proportional to the expression level of Bn-miR6, which shows that comp37728_ c0 is regulated by Bn-miR6, thereby regulating the absorption of cadmium by ramie.
Example 4 analysis of cadmium uptake of Ramie plants under cadmium stress
Treatment group: the method comprises the following steps of sterilizing young tips (10-15cm) of a No. 1 variety of ramie in ramie by carbendazim for 10s, cutting the young tips in a water circulation device, culturing the young tips in a climatic greenhouse, treating the young tips with 10mg/L cadmium chloride when the roots grow to 10cm, harvesting roots, stems and leaves after 20 days of treatment, drying the roots, grinding the stems and leaves into powder, and measuring the cadmium content of the young tips by using a SOLAR M6 atomic absorption spectrometer, wherein the result is shown in figure 2. As can be seen from FIG. 2, ramie has a high content of cadmium in its root, followed by a stem and, at a minimum, a leaf.
Control group: the control group changed the treatment of cadmium chloride to water treatment, and the other conditions were consistent with those of the treatment group. The cadmium content of the roots, stems and leaves of the control group is low, and the cadmium cannot be detected by adopting an atomic absorption method.
Sequence listing
<110> institute of hemp, national institute of agricultural science
<120> Bn-miR6 of ramie and application thereof
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213> Ramie ()
<400> 1
uuagauucac gcucaaacuc g 21
<210> 2
<211> 108
<212> RNA
<213> Ramie ()
<400> 2
cagguuugug cgugaaucua aaccaacacg auuaucuccu cucucuggau uuucuccggc 60
cuugaaaugu uuagauucac gcucaaacuc guaaucuucc uuuccaau 108
<210> 3
<211> 108
<212> DNA
<213> Ramie ()
<400> 3
caggtttgtg cgtgaatcta aaccaacacg attatctcct ctctctggat tttctccggc 60
cttgaaatgt ttagattcac gctcaaactc gtaatcttcc tttccaat 108
<210> 4
<211> 2112
<212> DNA
<213> Ramie ()
<400> 4
ttgctaaaaa ttttggaatt gatgtcaaca tgaatatgac tgctgtggaa ggccgggtaa 60
ttgggccgcc tgagttgaag ctaggtggtc aaaatggaaa gctaattact gtatcagttg 120
acagagacaa atgtcactgg aaccttgtta acaagtctgt ggtccaaggg aaacctattg 180
acaagtgggc tgtccttgac ttccgccaaa atgaacgagg ctataatcgg tttgatttag 240
atcccaatga attcattcca aagctcatca accgatgtga aaaattggga atcagaatgg 300
cggaacctct tttttatgaa cgcacttcaa tgcgtaaatt ctctagtgct gatatgctgc 360
gtgaacttct tgaaggcata agccaccagg cttataaatg ttgcgggggt cgtctacaac 420
ttcttgtttg tgcaatgaat aagagggatc ctggttacaa acttctcaaa tggatctgtg 480
aaacgaaaat tggtattgta acacagtgtt gtttgtccag tcatgcgact aaagcaagtg 540
accagtacct tgcaaatctc gctctgaaga tcaatgctaa gcttggaggc agtaacgtgg 600
agctgagccg gctgcccatc cctgctggtg caggccatgt gatgtttgtg ggggctgatg 660
tcaatcatcc taccggtggt acttggaact cgacaagccc ttcaatagca gctgttgttg 720
cctctgtgaa ttggcctgct gcaaaccgct atgctgcacg agtgcgagcc cagcgtcgcc 780
gatgcgaaga gattcttgat tttggggata tgtgcttgga cctcattgaa tcatatgtgc 840
ttctgaacag ggttaggccc gaaagaatca tcatatttcg tgatggagtg agtgatggcc 900
agtttgacat ggttctcaat gaagagttac ttgatctgcg aagggccctt gccaccataa 960
attatgctcc aatcatcact cttattgttg cccagaagcg ccatcaaacg cgtctgtttc 1020
cacagagcaa ggacgatggt tgctccactg gaaatgtgcc tccaggcaca gttgtggaca 1080
cgagagttgt tcaccccttc gagtttgact tctatctatg tagtcactac gggagccttg 1140
ggacgagcaa gcccacccac taccatgtct tgtacgacga gaatagattt acttctgatc 1200
aattgcagaa gctcatctat gacatgtgct tcaccatggc tcgttgcacc aagcctgtgt 1260
cgttggttcc accggtgtac tacgccgacc ttgccgctta caggggcaga atctatcacg 1320
aggcagtaac tgagtggaac tctccgccat caggtgggtc ttcgtcttca tcgctgcagg 1380
gatcatcgtc ctcggtggct tcctttgatg agaggttctt caagttgcac gccgaccttg 1440
agaatgaaat gttcttcgtc tgacagaacg cagcattggt gctggtatct tctgccatta 1500
ttctccgagg aaggaaggaa gaaagatggt agagaagagg aagtgagtag cagagaattt 1560
gttatgagaa ggtaataatt actagtcaag aacacccgga cgcaaatcca accttgtgtc 1620
gttttggtga cgcaccaatg agggcgagtt tgggcgtgaa tctaatgggt ctttgagtca 1680
ataacatctg gcttttccca cttttccgcg gattggtcca aggaatttcg aggaaagtcg 1740
agatgcttga agctggtttt cgattttctt gattttgttt ctttttaact ctagcacttt 1800
ggtaatgttt gcagtttgct tatggtttac gtcaagacct tgtagatttc tactatttct 1860
gtgactgtgc tagtttatta ttccagaaac ttggttgtta ttattatgct attgttgttt 1920
tttttttctt cttaatattg tgctattgta gtgtactgat ttatctgtgc ttgcacgtgc 1980
agttttagca atttgttcgt atttaactta ttccaggttt ttgctcagtt tattcatgcc 2040
atcgttccca tcatcaagct gggattaatt gtgataatag ttgcattgtt gtctatcagt 2100
agtgacagcc tc 2112
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence ()
<400> 5
ttagattcac gctcaaactc g 21
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence ()
<400> 6
atgataactc gacggatcgc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence ()
<400> 7
cttggatgtg gtagccgttt 20
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence ()
<400> 8
tgtgcttgga cctcattgaa 20
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence ()
<400> 9
catgtcaaac tggccatcac 20
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence ()
<400> 10
tgacggagaa ttagggttcg a 21
<210> 11
<211> 22
<212> DNA
<213> Artificial sequence ()
<400> 11
ccgtgtcagg attgggtaat tt 22
Claims (4)
1. The Bn-miR6 of ramie is characterized in that the nucleotide sequence of the Bn-miR6 is shown as a sequence 1.
2. The precursor Bn-miR6 gene of ramie Bn-miR6 according to claim 1, wherein the nucleotide sequence of the precursor Bn-miR6 gene is shown in sequence 2.
3. The nucleic acid molecule for encoding the precursor Bn-miR6 gene of claim 2, wherein the nucleotide sequence of the nucleic acid molecule is shown as sequence 3.
4. The Bn-miR 6-regulated target gene comp37728_ c0 as claimed in claim 1, wherein the nucleotide sequence of the comp37728_ c0 is shown as sequence 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810660629.7A CN108728443B (en) | 2018-06-25 | 2018-06-25 | Bn-miR6 of ramie and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810660629.7A CN108728443B (en) | 2018-06-25 | 2018-06-25 | Bn-miR6 of ramie and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108728443A CN108728443A (en) | 2018-11-02 |
| CN108728443B true CN108728443B (en) | 2021-08-03 |
Family
ID=63930437
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810660629.7A Active CN108728443B (en) | 2018-06-25 | 2018-06-25 | Bn-miR6 of ramie and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108728443B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101652381A (en) * | 2007-01-30 | 2010-02-17 | 维莱尼姆公司 | Be used to handle the enzyme of lignocellulose, encode their nucleic acid and methods for making and using same thereof |
| CN105274121A (en) * | 2015-12-04 | 2016-01-27 | 中国林业科学研究院亚热带林业研究所 | Gene capable of promoting cadmium accumulation and application of gene |
-
2018
- 2018-06-25 CN CN201810660629.7A patent/CN108728443B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101652381A (en) * | 2007-01-30 | 2010-02-17 | 维莱尼姆公司 | Be used to handle the enzyme of lignocellulose, encode their nucleic acid and methods for making and using same thereof |
| CN105274121A (en) * | 2015-12-04 | 2016-01-27 | 中国林业科学研究院亚热带林业研究所 | Gene capable of promoting cadmium accumulation and application of gene |
Non-Patent Citations (1)
| Title |
|---|
| 土壤重金属胁迫与植物相关miRNA的研究进展;张路;《北方园艺》;20171230;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108728443A (en) | 2018-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tang et al. | A convenient and efficient protocol for isolating high-quality RNA from latex of Hevea brasiliensis (para rubber tree) | |
| Gupta et al. | Assessment of genetic relatedness among three varieties of finger millet with variable seed coat color using RAPD and ISSR markers | |
| Chen et al. | Differential global gene expression changes in response to low nitrogen stress in two maize inbred lines with contrasting low nitrogen tolerance | |
| CN111455077A (en) | Mango bacterial angular leaf spot germ reference gene, primer, screening method and application | |
| CN113774065B (en) | Fluorescent quantitative internal reference gene for different adults of fall webworm, primer and application thereof | |
| CN112662806B (en) | Rhynchosia SSR molecular marker primer composition and application thereof | |
| CN103361346A (en) | Method for cloning and analyzing populus diversifolia micro RNAs (ribonucleic acids) precursor | |
| CN108823207B (en) | Bn-miR43 of ramie and application thereof | |
| CN108728443B (en) | Bn-miR6 of ramie and application thereof | |
| CN108823206B (en) | Bn-miR12 of ramie and application thereof | |
| CN108624593B (en) | Bn-miR52 of ramie and application thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN112695125B (en) | Katelia SSR molecular marker primer composition and application thereof | |
| CN110438135B (en) | Populus deltoides leaf rust resistant disease-resistant gene PdGsSRK, expression protein, cloning primer pair and application thereof | |
| CN108949780B (en) | The Ravenna grass genoid EfNAC44 that Ravenna grass wild species are expressed by low temperature stress | |
| CN106978499A (en) | The external source Insert Fragment flanking sequences of transgenic soybean event GC1 1 and its application | |
| CN108424975B (en) | Pueraria SSR marker primer pair developed based on transcriptome sequence and application thereof | |
| CN108841842B (en) | Festuca arundinacea gene EfWRKY62 expressed by wild species of the saccharum arundinacea under low temperature stress | |
| CN111304359B (en) | Molecular marker closely linked with salt tolerance of rice seed germination and application thereof | |
| CN107142321A (en) | A kind of specific microsatellite locus of mongolian amygdalus seed and its application | |
| CN107058334A (en) | One cultivate peanut the genes of transcription factor AhJ11 FAR1 5 clone and functional expression method | |
| Enguito et al. | Genetic variation of sago palm (Metroxylon sagu Rottb.) samples from Mindanao, Philippines using Internal Transcribed Spacer Analysis. | |
| Ismail et al. | Expression of Alpha Amylase and Osmotin-Like Protein under Drought Stress in Sugar Beet | |
| CN114934132A (en) | Gene marker set for magnesium deficiency nutrition diagnosis of tobacco and application thereof | |
| CN114457074A (en) | MiRNA related to woody plant ammonium nitrogen response and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |