CN110684824B - Immunomagnetic bead kit for detecting brucella antigen - Google Patents
Immunomagnetic bead kit for detecting brucella antigen Download PDFInfo
- Publication number
- CN110684824B CN110684824B CN201911093383.0A CN201911093383A CN110684824B CN 110684824 B CN110684824 B CN 110684824B CN 201911093383 A CN201911093383 A CN 201911093383A CN 110684824 B CN110684824 B CN 110684824B
- Authority
- CN
- China
- Prior art keywords
- brucella
- immunomagnetic
- beads
- kit
- immunomagnetic bead
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an immunomagnetic bead kit for detecting brucella antigen, belonging to the technical field of biology. The kit comprises: immunomagnetic beads, qPCR reaction mixed liquor, upstream primers, downstream primers and probes for detecting Brucella; the immunomagnetic beads are conjugates of mouse brucella resistance M5 antigen monoclonal IgG antibodies and magnetic beads. The kit disclosed by the invention is high in sensitivity, good in stability, rapid and effective, and compared with the traditional separation method, the kit overcomes the defects that the detection rate of brucella pathogens is low, brucella pathogens are easy to degrade in the direct-amplification antigen detection process, and the extracted DNA cannot meet the minimum requirement of qPCR detection due to the limited volume of liquid to be detected used in the pathogen DNA extraction process.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an immunomagnetic bead kit for detecting brucella antigens.
Background
Brucella is a facultative intracellular parasitic bacterium of gram-negative bacteria, has unique intracellular survival and immune mechanisms, and is a natural epidemic disease. The brucella is not only widely distributed, but also can be parasitized among a plurality of animal hosts, and can be infected to human hosts through animals, so that the human is infected with brucellosis, and the brucella is an allergic zoonosis which seriously harms human and animal health. Brucellosis can cause animal infection through various ways such as skin mucosa, digestive tract and vertical transmission, wherein the most dangerous infection source is pregnant animals suffering from diseases. Brucella can be associated with the expulsion of foetus, amniotic fluid and placenta during delivery or abortion, and milk is also one of the important sources of infection. The brucella mainly infects animals such as cattle, sheep, pigs, dogs and the like. Currently, the genus brucella is classified into 6 types of 19 biotypes according to differences in infected animals and differences in antigenicity, i.e., brucella melitensis (b.melitensis, 3 biotypes), brucella bovis (b.abortus, 8 biotypes), brucella suis (b.suis, 5 biotypes), brucella epididymides (b.ovis, 1 biotype), brucella suis sarrini (b.neotomae, 1 biotype), and brucella canis (b.caris, 1 biotype), by a typing method disclosed by WHO in 1985. Bortg isolated from marine mammals such as whales, dolphins, seals, etc. in 2007, brucella cetacea (b.cetii) and brucella finnii (b.pinipendialis) were isolated. Brucella species (b.microti) were found again in 2008. At present, Brucella abortus, Brucella melitensis and canis are pathogenic to human beings, and the pathogenicity of the Brucella abortus, melitensis and canis are different, so that the clinical significance of three infections of sheep, cattle and pig is the greatest, and the pathogenicity of the sheep is the strongest. In addition, the brucella can generate interference phenomenon in the process of infecting animals and human beings, and because the brucella has a plurality of types and different virulence, the interference phenomenon can occur in the parasitism process, thereby bringing great challenge to the prevention and control of brucellosis.
At present, the conventional detection and diagnosis methods aiming at the brucella infection are many, and the pathogenic diagnosis detection methods comprise: sample detection, enrichment culture, separation culture, animal test, staining microscopy, agglutination reaction, biochemical test, staining test, PCR test and the like. The brucella is slow in growth, high in nutrition requirement, easy to pollute sundry bacteria in the culture process, and greatly influenced by factors such as culture environment, operator technique and the like, so that the separation rate is low, the separation difficulty is high, the operation is complicated, the time consumption is long, certain biological safety problems exist, the brucella is not suitable for rapid diagnosis and treatment of a large number of samples, most tissue samples are required to be in a suspension shape through grinding, the bacterial concentration in the samples is diluted to a certain degree, and other components in the tissues can interfere with the experimental result, so that the false negative detection result is caused. Therefore, it is necessary to research and develop a highly sensitive brucella detection technique.
Disclosure of Invention
The invention aims to provide an immunomagnetic bead kit for detecting brucella antigens. The kit realizes that the lowest limit of the detection of the brucella is 105CFU/mL, negative to other bacteria detection, no cross reaction, and repeat coefficient of variation within the group of 0.97% -1.23%, repeat coefficient of variation between groups of 0.24% -1.23%, have better repeatability.
The invention provides an immunomagnetic bead kit for detecting Brucella, which comprises: immunomagnetic beads, qPCR reaction mixed liquor, upstream primers, downstream primers and probes for detecting Brucella; the immunomagnetic beads are conjugates of mouse brucella resistance M5 antigen monoclonal IgG antibodies and the magnetic beads; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2, and the probe is a substance of which the 5 'end of the nucleotide sequence is marked with FAM and the 3' end is marked with BHQ1, which are shown as SEQ ID NO. 3.
Preferably, the kit further comprises a PBS buffer.
Preferably, the immunomagnetic beads are stored in the form of immunomagnetic bead suspension, and the concentration of the immunomagnetic beads in the immunomagnetic bead suspension is 1 mg/mL; the solvent of the immunomagnetic bead suspension comprises PBS buffer.
Preferably, the preparation method of the immunomagnetic beads comprises the following steps:
1) washing and resuspending the magnetic beads to obtain washed and resuspended magnetic beads;
2) mixing excessive mouse anti-brucella M5 antigen monoclonal IgG antibody with the washed and resuspended magnetic beads obtained in the step 1), and shaking for 15-60 min at 37 ℃ to obtain an immunomagnetic bead suspension;
3) and 2) carrying out magnetic adsorption on the immunomagnetic bead suspension obtained in the step 2), removing the supernatant, washing and resuspending to obtain the immunomagnetic beads.
Preferably, the mass ratio of the monoclonal IgG antibody against Brucella M5 antigen in step 2) to the magnetic beads in step 1) is 100. mu.g/6 mg or more.
Preferably, the washing and resuspending of steps 1) and 3) uses PBS buffer; the PBS buffer was 10mM PBS buffer at pH 7.4.
Preferably, the method for using the immunomagnetic bead kit comprises the following steps:
(1) mixing immunomagnetic beads and a sample to be detected in a centrifuge tube, and carrying out oscillation reaction at 37 ℃ for 20-60 min;
(2) performing magnetic adsorption, removing the supernatant, washing and resuspending to obtain brucella-enriched immunomagnetic bead resuspension;
(3) processing the immune magnetic bead resuspension enriched with the Brucella in the step (2) by a thermal cracking method to obtain released Brucella DNA;
(4) mixing the Brucella DNA released in the step (3) with qPCR reaction mixed liquor, upstream primers, downstream primers and probes for detecting Brucella, and performing qPCR amplification;
(5) when the CT value is less than 28, the brucella is judged to be positive, and when the CT value is more than or equal to 28, the brucella is judged to be negative.
Preferably, the mixing volume ratio of the sample to be tested and the immunomagnetic beads in the step (1) is 4-6.
Preferably, the reaction procedure of the thermal cracking method in the step (3) is as follows: cracking at 95 deg.C for 10min, and ice-cooling for 3 min.
Preferably, the reaction system for qPCR amplification in step (4) comprises, per 20 μ L:
probe qPCR Supermix 10. mu.L; 5 mu L of DNA template; RNase Free dH2O2.6 mu L; upstream primer 0.8 μ L; 0.8 mu L of downstream primer and 0.8 mu L of probe primer;
the reaction procedure for the qPCR amplification was: 5min at 95 ℃; denaturation at 95 ℃ for 10s and renaturation at 60 ℃ for 30s for 40 cycles; storing at 4 ℃.
The invention provides an immunomagnetic bead kit for detecting brucella antigen. The kit can solve the problem that in the prior art, the brucella antigen is easy to degrade in the brucella antigen detection process, and the extracted DNA cannot meet the minimum requirement of qPCR detection due to the limited volume of the venom to be detected in the pathogen DNA extraction process, so that a false negative result occurs. The specific primer in the kit provided by the invention takes the Omp19 gene fragment as a target spot to realize the detection of the Brucella, and the kit further comprises specific immunomagnetic beads which can be used for enriching the Brucella pathogen, so that the high-efficiency detection of the Brucella can be realized, and an effective technical means is provided for the detection of the Brucella antigen. The test result shows that the lowest limit of the kit for detecting the brucella is 105CFU/mL, negative to other bacterium detection, no cross reaction, and repeated coefficient of variation within the group of 0.97% -1.23%, repeated coefficient of variation between groups of 0.24% -1.23%, have better repeatability; the method can also overcome the defects of long cycle time, complicated steps, time and labor waste and the like of the traditional detection method, greatly shortens the detection time, and meets the detection requirements of time and labor saving, rapidness and sensitivity.
Drawings
FIG. 1 shows the purification result of monoclonal IgG antibody against Brucella M5 antigen provided by the present invention; wherein, M: a protein Marker; 1: flowing through the liquid; 2: washing 1; 3: washing 2; 4: washing 3; 5: washing 4; 6: eluting 1; 7: eluting 2; 8: eluting 3;
FIG. 2 shows the result of detecting the specificity of immunomagnetic beads by qPCR method according to the present invention; wherein, S1: m5 vaccine liquid; s2: a19 vaccine bacterial liquid; s3: s2 vaccine liquid; s4: e.coli; s5: yersinia enterocolitica; s6: staphylococcus aureus bacteria; s7: salmonella liquid;
FIG. 3 shows the result of detecting the sensitivity of immunomagnetic beads by qPCR method according to the present invention; wherein, the concentration of M5 bacterial liquid is 1 × 10 respectively8、1×107、1×106、1×105、1×104、1×103、1×102、10CFU/mL。
Detailed Description
The invention provides an immunomagnetic bead kit for detecting Brucella, which comprises: immunomagnetic beads, qPCR reaction mixed liquor, upstream primers, downstream primers and probes for detecting Brucella; the immunomagnetic beads are conjugates of mouse brucella resistance M5 antigen monoclonal IgG antibodies and the magnetic beads; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2, and the probe is a substance of which the 5 'end of the nucleotide sequence is marked with FAM and the 3' end is marked with BHQ1, which are shown as SEQ ID NO. 3. The invention preferably takes an Omp19 gene fragment (shown in SEQ ID NO: 4) as a target point, the selection of the Omp19 gene can ensure the reliability and stability of detection, and the primer pair for detecting the Brucella antigen is designed and synthesized. In the present invention, the nucleotide sequence of the upstream primer (Omp19F) is CCCGGTGAACTGGCTAATC (shown in SEQ ID NO: 1); the downstream primer (Omp19R) is TCGTAAAGGACGAGTTGCTTG (shown in SEQ ID NO: 2), and the Probe (Probe) is: FAM-CCTCCTGGGCCGTCAATGGCAAG-BHQ1, and the nucleotide sequence of the probe is CCTCCTGGGCCGTCAATGGCAAG (shown in SEQ ID NO: 3).
In the present invention, the kit further comprises a PBS buffer. In the present invention, the PBS buffer acts as a washing solution. In the present invention, the PBS buffer is preferably 10mM PBS buffer having a pH of 7.4.
In the invention, the immunomagnetic beads are stored in the form of immunomagnetic bead suspension, and the concentration of the immunomagnetic beads in the immunomagnetic bead suspension is 1 mg/mL; the solvent of the immunomagnetic bead suspension comprises PBS buffer. In the present invention, the PBS buffer is preferably 10mM PBS buffer having a pH of 7.4.
In the invention, the preparation method of the immunomagnetic beads comprises the following steps:
1) washing and resuspending the magnetic beads to obtain washed and resuspended magnetic beads;
2) mixing excessive mouse anti-brucella M5 antigen monoclonal IgG antibody with the washed and resuspended magnetic beads obtained in the step 1), and shaking for 15-60 min at 37 ℃ to obtain an immunomagnetic bead suspension;
3) and 2) carrying out magnetic adsorption on the immunomagnetic bead suspension obtained in the step 2), removing the supernatant, washing and resuspending to obtain the immunomagnetic beads.
The magnetic beads are washed and resuspended to obtain the washed and resuspended magnetic beads. The present invention preferably uses PBS buffer for washing and heavy suspension operation. In the present invention, the washing and resuspension operations are preferably performed in EP tubes. In the present invention, the magnetic beads are preferably magnetic nanospheres, and the magnetic nanospheres of the present invention are preferably purchased from wuhan jia source quantum dot technology development llc, cargo number: MNS-800). In the present invention, the stock solution of magnetic beads preferably contains 6mg of magnetic beads per 200. mu.L volume. In the invention, the time of magnetic adsorption is preferably 3-5min, and the magnetic adsorption is preferably carried out by adopting a magnetic frame. The source of the magnetic force frame is not particularly limited in the present invention, and a conventional commercially available magnetic force frame known to those skilled in the art may be used. In the present invention, the number of washing is preferably 2 to 4, and more preferably 3. In the present invention, the washing and resuspension are preferably performed using PBS buffer; the PBS buffer was 10mM PBS buffer at pH 7.4. When the present invention is performed for every 6mg of magnetic beads, it is preferable to perform resuspension using 600. mu.L PBS buffer.
After the washed and resuspended magnetic beads are obtained, mixing the excessive monoclonal IgG antibody of the mouse brucella resistance M5 antigen with the washed and resuspended magnetic beads, and shaking for 15-60 min at 37 ℃ to obtain an immunomagnetic bead suspension. In the present invention, the mass ratio of the monoclonal IgG antibody to the mouse anti-brucella M5 antigen to the magnetic beads is preferably 100 μ g/6mg or more. In the present invention, the time of the oscillation is preferably 30 min.
After the immunomagnetic bead suspension is obtained, the immunomagnetic bead suspension is subjected to magnetic adsorption, the supernatant is removed, and the immunomagnetic beads are obtained after washing and resuspension. In the present invention, the washing and resuspension are preferably performed using PBS buffer; the PBS buffer was 10mM PBS buffer at pH 7.4. In the present invention, the final concentration of the immunomagnetic beads is preferably 1 mg/mL.
In the invention, the use method of the immunomagnetic bead kit comprises the following steps:
(1) mixing immunomagnetic beads and a sample to be detected in a centrifuge tube, and carrying out oscillation reaction at 37 ℃ for 20-60 min;
(2) performing magnetic adsorption, removing the supernatant, washing and resuspending to obtain brucella-enriched immunomagnetic bead resuspension;
(3) processing the immune magnetic bead resuspension enriched with the Brucella in the step (2) by a thermal cracking method to obtain released Brucella DNA;
(4) mixing the Brucella DNA released in the step (3) with qPCR reaction mixed liquor, upstream primers, downstream primers and probes for detecting Brucella, and performing qPCR amplification;
(5) when the CT value is less than 28, the brucella is judged to be positive, and when the CT value is more than or equal to 28, the brucella is judged to be negative.
The invention mixes the immunomagnetic beads and a sample to be detected in a centrifuge tube, and vibrates and reacts for 20-60 min at 37 ℃. The enrichment of brucella (pathogen) is realized. In the present invention, the centrifuge tube is preferably a 1.5mL EP tube. In the present invention, the mixing volume ratio of the sample to be tested and the immunomagnetic beads is preferably 4 to 6, and more preferably 5, i.e., the amount of the immunomagnetic beads used for detecting each 100 μ L of the sample to be tested is preferably 20 μ L.
The invention enriches pathogeny, then carries out magnetic adsorption, discards supernatant, washes and re-suspends to obtain the brucella enriched immunomagnetic bead re-suspension. And completing washing of the pathogen-enriched immunomagnetic beads. In the present invention, the number of washing is preferably 2 to 4, and more preferably 3. In the present invention, the resuspension is preferably performed by adding PBS buffer solution with the volume 2-5 times that of the magnetic beads.
After obtaining the brucella enriched immunomagnetic bead resuspension, the invention adopts a thermal cracking method to process the brucella enriched immunomagnetic bead resuspension to obtain the released brucella DNA. In the present invention, the reaction procedure of the thermal cracking method in step 3) is: cracking at 95 deg.C for 10min, and ice-cooling for 3 min.
After the released Brucella DNA is obtained, the released Brucella DNA is mixed with qPCR reaction mixed liquor, upstream primers, downstream primers and probes for detecting Brucella, and qPCR amplification is carried out. In the present invention, the qPCR reaction mixture preferably comprises: (
Probe qPCR Supermix and RNase Free dH2And O. Specifically, the qPCR amplification reaction system of the present invention preferably comprises, per 20 μ L:
probe qPCR Supermix 10. mu.L; 5 mu L of DNA template; RNase Free dH2O2.6 mu L; upstream primer 0.8 μ L; 0.8 μ L of downstream primer and 0.8 μ L of probe primer. In the present invention, the reaction procedure of the qPCR amplification is preferably: 5min at 95 ℃; denaturation at 95 ℃ for 10s and renaturation at 60 ℃ for 30s for 40 cycles; storing at 4 ℃.
After amplification, the invention judges whether the sample contains the Brucella according to the CT value result of the qPCR reaction system. When the CT value is less than 28, the brucella is judged to be positive, and when the CT value is more than or equal to 28, the brucella is judged to be negative.
The immunomagnetic bead kit for detecting brucella antigen according to the present invention is further described in detail with reference to the following specific examples, and the technical solution of the present invention includes, but is not limited to, the following examples.
Example 1
Designing and synthesizing a primer pair for detecting brucella antigen by taking an Omp19 gene fragment (shown in SEQ ID NO: 4) as a target point, and designing a specific primer pair aiming at the Omp19 gene according to a genome sequence (accession number: KP101384.1) of a Brucella abortus strain BRS 19kDa outer membrane protein (Omp19) in GenBank, wherein the sequences of the primer pair are as follows:
an upstream primer: CCCGGTGAACTGGCTAATC (SEQ ID NO: 1);
a downstream primer: TCGTAAAGGACGAGTTGCTTG (SEQ ID NO: 2);
and (3) probe: FAM-CCTCCTGGGCCGTCAATGGCAAG-BHQ1 (shown in SEQ ID NO: 3);
ATGGGAATTTCAAAAGCAAGTCTGCTCAGCCTCGCGGCGGCTGGCATTGTCCTGGCCGGGTGCCAGAGCTCCCGGCTTGGTAATCTCGATAATGTTTCGCCTCCGCCGCCGCCTGCACCGGTCAATGCTGTTCCGGCAGGCACGGTGCAGAAAGGCAATCTTGATTCTCCCACACAATTCCCCAATGCGCCCTCCACGGATATGAGCGCGCAATCCGGCACACAGGTCGCAAGCCTGCCGCCTGCATCCGCACCGGACCTGACGCCCGGCGCCGTGGCTGGCGTCTGGAGCGCCTCGCTTGGTGGTCAGAGCTGCAAGATCGCGACGCCGCAGACCAAATATGGCCAGGGCTATCGCGCAGGCCCGCTGCGCTGCCCCGGTGAACTGGCTAATCTTGCCTCCTGGGCCGTCAATGGCAAGCAACTCGTCCTTTACGATGCGAACGGCGGTACGGTTGCCTCGCTCTATTCTTCAGGACAGGGCCGCTTCGATGGCCAGACCACCGGCGGGCAGGCCGTGACGCTGTCGCGCTGA (shown in SEQ ID NO: 4).
The primer pair was synthesized by bio-corporation.
Example 2
Preparation of immunomagnetic beads
Purification of ascites IgG as a monoclonal antibody against brucella murine M5 antigen (brucella M5 antigen from Qinghai biopharmaceutical manufacturers, ltd):
the method specifically comprises the following operation steps of an AKTA FPLC protein purification system of Swedish FamaXia company:
1) respectively putting infusion inlets (A, B) of the instrument into corresponding required buffer solutions, starting a computer, selecting UNICON software, selecting a manual pump wash FPLC to select an inlet A used in a system control interface, and executing functions to wash and purify pipelines and pumps of the system;
2) connecting a protein G affinity chromatography protein purification column;
3) system setting: in a system control interface, selecting a 'manual pump Flow' input Flow rate, and inputting the pressure of a pump in 'insert alarm & mon alarm pressure';
4) and (3) balancing and purifying the column: equilibrating the pH of the column with Tris-HCl buffer 1MpH 9.0.0;
5) loading: preparation of monoclonal antibody ascites from mice immunized with M5 antigen (brucella M5 antigen) with distilled water as a solvent (1): 5, adding 10mL of the diluted sample solution into a sample adding tube, controlling the conductance of Binding Buffer at 50-60mS/cm, pH 7.0-7.4, controlling the flow rate at 1.0mL/min, flowing through for about 0.5h, collecting the flow-through solution, collecting 1 tube per 2mL, and sequentially naming as flow-through solution 1 and flow-through solution 2.
6) And (3) elution: after the absorption peak is stable, adding an Elution Buffer, controlling the pH value of the Elution Buffer to be about 2.5-3.0, and controlling the flow rate to be 1.0mL/min, observing the absorption peak, controlling a sample receiver to receive eluent when the absorption peak rises rapidly, collecting one tube per 2mL of eluent when collecting the eluent, sequentially naming the tube as eluent 1, immediately adding a Tris-HCl Buffer solution with the pH value of 9.0 to neutralize the pH value of the eluent after the eluent 2 … … is collected, and keeping the pH value of the eluent at neutral or alkalescent.
7) After the elution is finished, the pump and the pipeline are washed by distilled water, and then the pump and the pipeline are continuously washed by 20 percent ethanol.
8) The recovered purified IgG concentration was determined by NanoDrop 2000A 280 and the purified IgG purity was analyzed by SDS-PAGE, and the purification results are shown in FIG. 1. The flow-through sample, the washing sample and the elution sample are selected to carry out SDS-PAGE to identify the purification effect, and the result is shown in figure 1, so that the protein is better purified.
(II) preparation of immunomagnetic beads
1) Washing of magnetic beads: taking a magnetic bead stock solution in an EP tube, adsorbing for 3-5min by using a magnetic frame, washing for 3 times by using PBS (phosphate buffer solution), and finally resuspending by using the PBS;
2) coupling of the antibody: adding excessive mouse anti-brucella M5 antigen monoclonal IgG antibody into the magnetic beads after the heavy suspension in the step 1), uniformly mixing, and oscillating for 30-60min at 37 ℃ to obtain a suspension containing immunomagnetic beads;
3) separation of immunomagnetic beads: adsorbing the suspension obtained in the step 2) by using a magnetic frame for 3-5min, removing the supernatant, washing the suspension for 3 times by using PBS (phosphate buffer solution), and finally resuspending the suspension by using the PBS buffer solution to obtain the required immunomagnetic beads, wherein the concentration of the immunomagnetic beads is 1 mg/mL.
Wherein the PBS buffer used is 10mM PBS buffer with pH value of 7.4.
And (III) specific detection of the immunomagnetic beads:
1) 20 μ L of each prepared immunomagnetic bead was put into 7 EP tubes of 1.5mL, and 100 μ L M5 vaccine (S1), A19 vaccine (S2), S2 vaccine (S3), Escherichia coli (S4), Yersinia enterocolitica (S5), Staphylococcus aureus (S6) and Salmonella (S7) were added. Sucking and stirring uniformly by using a liquid transfer gun, reacting at 37 ℃ for 30min or reacting overnight at 4 ℃ (uniformly mixing by using the liquid transfer gun irregularly in the reaction process);
2) after full reaction, taking out the EP tube, placing the EP tube on a magnetic frame for adsorption for 3-5min, and completely sucking out the supernatant by using a pipette;
3) the EP tube was removed from the magnetic frame, washed with 600. mu.L of pH 7.4 PBS, mixed well, re-placed on the magnetic frame for adsorption for 3-5min, the supernatant was aspirated off with a pipette, the washing was repeated 3 times, and finally the beads were resuspended in 50. mu.L of pH 7.4 PBS.
4) The method of the invention is used for qPCR amplification. The results are shown in FIG. 2, and the detection results of the method on the M5 vaccine, the A19 vaccine and the S2 vaccine are positive, which indicates that the method can be used for detecting various Brucella; the detection result of other bacteria is negative, no cross reaction occurs, which indicates that the method has higher specificity, and the result indicates that the immunomagnetic beads can well combine with brucella pathogeny.
Example 3
Repeatability experiment of kit of the invention in detecting Brucella (antigen)
1. Test sample
Brucella vaccine (the vaccine is purchased from Jinyubao Ling biological medicine, Inc., and the bacterial content is about 1 × 10) after 1:10 times dilution8CFU/mL)。
2. Method of producing a composite material
1) And (3) pathogen enrichment: taking 20 mu L of immunomagnetic beads (1mg/mL) to be put into a 1.5mL EP tube, adding 100 mu L of diluted brucella vaccine, and carrying out shake reaction at 37 ℃ for 30 min;
2) washing of magnetic beads: after pathogen enrichment is finished, placing the EP tube on a magnetic frame for adsorption for 3-5min, discarding the supernatant, washing for 3 times by using PBS (phosphate buffer solution), and then adding 50 mu L of PBS to re-suspend the virus-enriched immunomagnetic beads;
3) extraction of pathogen DNA: destroying pathogenic structure by thermal cracking method, and releasing pathogenic DNA; the procedure for obtaining pathogenic DNA by thermal cracking is as follows: cracking at 95 deg.C for 10min, and rapidly ice-cooling for 3 min;
4) qPCR amplification: qPCR amplification was performed using the method described in the present invention (amplification system as shown in Table 1);
TABLE 1 amplification reaction System for qPCR
5) The amplification procedure is as in table 2:
TABLE 2 amplification procedure
6) And judging whether the sample contains the Brucella according to the CT value result of the qPCR reaction system. When the CT value is less than 28, the brucella is judged to be positive, and when the CT value is more than or equal to 28, the brucella is judged to be negative. The results are shown in Table 3, which shows that the method of the present invention can amplify brucella pathogens well with good repeatability.
TABLE 3 repeatability results
Example 4
Sensitivity test of the kit of the present invention
After the Brucella vaccine is diluted by 1:10 times (the bacterial content is about 1 × 10)8CFU/mL), 1mL of pathogen diluent is diluted by ten times, and the dilution ratio is 10 respectively8、107、106、105、104、103And 102CFU/mL was subjected to a tenfold fold ratio dilution, to which immunomagnetic bead enrichment was applied, and then qPCR amplification was performed in the same manner as in example 3, with the results shown in FIG. 3. The method has a Brucella vaccine concentration of 108CFU/mL～102Detecting the concentration of the solution between CFU/mL and the concentration of 105CFU/mL～104When CFU/mL is detected, the CT value is between 27 and 29, and the result shows that the lowest detectable sample pathogen concentration is 10 by adopting the method5CFU/mL。
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences
<120> immunomagnetic bead kit for detecting brucella antigen
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cccggtgaac tggctaatc 19
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tcgtaaagga cgagttgctt g 21
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cctcctgggc cgtcaatggc aag 23
<210> 4
<211> 534
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atgggaattt caaaagcaag tctgctcagc ctcgcggcgg ctggcattgt cctggccggg 60
tgccagagct cccggcttgg taatctcgat aatgtttcgc ctccgccgcc gcctgcaccg 120
gtcaatgctg ttccggcagg cacggtgcag aaaggcaatc ttgattctcc cacacaattc 180
cccaatgcgc cctccacgga tatgagcgcg caatccggca cacaggtcgc aagcctgccg 240
cctgcatccg caccggacct gacgcccggc gccgtggctg gcgtctggag cgcctcgctt 300
ggtggtcaga gctgcaagat cgcgacgccg cagaccaaat atggccaggg ctatcgcgca 360
ggcccgctgc gctgccccgg tgaactggct aatcttgcct cctgggccgt caatggcaag 420
caactcgtcc tttacgatgc gaacggcggt acggttgcct cgctctattc ttcaggacag 480
ggccgcttcg atggccagac caccggcggg caggccgtga cgctgtcgcg ctga 534
Claims (8)
1. An immunomagnetic bead kit for detecting brucella, the kit comprising: immunomagnetic beads, qPCR reaction mixed liquor, PBS buffer solution, upstream primers for detecting Brucella, downstream primers and probes; the immunomagnetic beads are conjugates of mouse brucella resistance M5 antigen monoclonal IgG antibodies and the magnetic beads; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2, the probe is shown as SEQ ID NO. 3, wherein the 5 'end of the probe is marked with FAM, and the 3' end of the probe is marked with BHQ 1; the immunomagnetic beads are stored in the form of immunomagnetic bead suspension, and the concentration of the immunomagnetic beads in the immunomagnetic bead suspension is 1 mg/mL; the solvent of the immunomagnetic bead suspension comprises PBS buffer.
2. The immunomagnetic bead kit of claim 1, wherein the immunomagnetic bead is prepared by the following steps:
1) washing and resuspending the magnetic beads to obtain washed and resuspended magnetic beads;
2) mixing excessive mouse anti-brucella M5 antigen monoclonal IgG antibody with the washed and resuspended magnetic beads obtained in the step 1), and shaking for 15-60 min at 37 ℃ to obtain an immunomagnetic bead suspension;
3) and 2) carrying out magnetic adsorption on the immunomagnetic bead suspension obtained in the step 2), removing the supernatant, washing and resuspending to obtain the immunomagnetic beads.
3. The immunomagnetic bead kit of claim 2, wherein the mass ratio of the monoclonal IgG antibody against Brucella M5 antigen in step 2) to the magnetic bead in step 1) is 100 μ g/6mg or more.
4. The immunomagnetic bead kit of claim 2, wherein the washing and resuspending of step 1) and step 3) are independently performed using PBS buffer; the PBS buffer was 10mM PBS buffer at pH 7.4.
5. The immunomagnetic bead kit according to any one of claims 1 to 4, wherein the use method of the immunomagnetic bead kit comprises the following steps:
(1) mixing immunomagnetic beads and a sample to be detected in a centrifuge tube, and carrying out oscillation reaction at 37 ℃ for 20-60 min;
(2) performing magnetic adsorption, removing the supernatant, washing and resuspending to obtain brucella-enriched immunomagnetic bead resuspension;
(3) processing the immune magnetic bead resuspension enriched with the Brucella in the step (2) by a thermal cracking method to obtain released Brucella DNA;
(4) mixing the Brucella DNA released in the step (3) with qPCR reaction mixed liquor, upstream primers, downstream primers and probes for detecting Brucella, and performing qPCR amplification;
(5) when the CT value is less than 28, the brucella is judged to be positive, and when the CT value is more than or equal to 28, the brucella is judged to be negative.
6. The immunomagnetic bead kit according to claim 5, wherein the mixing volume ratio of the sample to be tested and the immunomagnetic beads in step (1) is 4-6.
7. The immunomagnetic bead kit of claim 5, wherein the reaction procedure of the thermal cracking process of step (3) is as follows: cracking at 95 deg.C for 10min, and ice-cooling for 3 min.
8. The immunomagnetic bead kit of claim 5, wherein the reaction system of qPCR amplification in step (4) comprises, per 20 μ L:
probe qPCR Supermix 10. mu.L; 5 mu L of DNA template; RNase Free dH2O2.6 mu L; upstream primer 0.8 μ L; 0.8 mu L of downstream primer and 0.8 mu L of probe primer;
the reaction procedure for the qPCR amplification was: 5min at 95 ℃; denaturation at 95 ℃ for 10s and renaturation at 60 ℃ for 30s for 40 cycles; storing at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911093383.0A CN110684824B (en) | 2019-11-11 | 2019-11-11 | Immunomagnetic bead kit for detecting brucella antigen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911093383.0A CN110684824B (en) | 2019-11-11 | 2019-11-11 | Immunomagnetic bead kit for detecting brucella antigen |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110684824A CN110684824A (en) | 2020-01-14 |
| CN110684824B true CN110684824B (en) | 2021-06-01 |
Family
ID=69116112
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911093383.0A Active CN110684824B (en) | 2019-11-11 | 2019-11-11 | Immunomagnetic bead kit for detecting brucella antigen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110684824B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102584957A (en) * | 2012-02-27 | 2012-07-18 | 江苏出入境检验检疫局动植物与食品检测中心 | Specific antibody of Brucella specificity multi-epitope artificial polypeptide, immunomagnetic beads coated with specific bodies, and application of beads |
| CN103675289A (en) * | 2013-09-06 | 2014-03-26 | 内蒙古科技大学 | Method for detecting brucella in bodies of human beings and livestock |
| CN104862405A (en) * | 2015-06-01 | 2015-08-26 | 何洪彬 | Primer, probe and reagent kit for identifying Brucella S2 vaccine strains in aerocolloid |
| CN106086239A (en) * | 2016-07-08 | 2016-11-09 | 中国农业科学院兰州兽医研究所 | Immunomagnetic beads test kit for PPR virus Detection of antigen and application thereof |
| CN106771141A (en) * | 2016-11-29 | 2017-05-31 | 百奥森（江苏）食品安全科技有限公司 | A kind of rapid assay methods of brucellosis |
| CN107300618A (en) * | 2017-06-16 | 2017-10-27 | 吉林大学 | The simultaneously and rapidly detection kit of a variety of Amphixenosis pathogens |
| CN107765000A (en) * | 2017-03-13 | 2018-03-06 | 中国农业科学院兰州兽医研究所 | A kind of method based on the O-shaped foot and mouth disease virus of immunomagnetic beads specific enrichment |
-
2019
- 2019-11-11 CN CN201911093383.0A patent/CN110684824B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102584957A (en) * | 2012-02-27 | 2012-07-18 | 江苏出入境检验检疫局动植物与食品检测中心 | Specific antibody of Brucella specificity multi-epitope artificial polypeptide, immunomagnetic beads coated with specific bodies, and application of beads |
| CN103675289A (en) * | 2013-09-06 | 2014-03-26 | 内蒙古科技大学 | Method for detecting brucella in bodies of human beings and livestock |
| CN104862405A (en) * | 2015-06-01 | 2015-08-26 | 何洪彬 | Primer, probe and reagent kit for identifying Brucella S2 vaccine strains in aerocolloid |
| CN106086239A (en) * | 2016-07-08 | 2016-11-09 | 中国农业科学院兰州兽医研究所 | Immunomagnetic beads test kit for PPR virus Detection of antigen and application thereof |
| CN106771141A (en) * | 2016-11-29 | 2017-05-31 | 百奥森（江苏）食品安全科技有限公司 | A kind of rapid assay methods of brucellosis |
| CN107765000A (en) * | 2017-03-13 | 2018-03-06 | 中国农业科学院兰州兽医研究所 | A kind of method based on the O-shaped foot and mouth disease virus of immunomagnetic beads specific enrichment |
| CN107300618A (en) * | 2017-06-16 | 2017-10-27 | 吉林大学 | The simultaneously and rapidly detection kit of a variety of Amphixenosis pathogens |
Non-Patent Citations (3)
| Title |
|---|
| Brucella abortus outer membrane lipoprotein (omp19) gene, complete cds;ID:L27997.1;《GenBank》;19960820;origin * |
| Novel identification and differentiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae suitable for both conventional and real-time PCR systems;V.Hinić et,al.;《Journal of Microbiological Methods》;20081031;第75卷(第2期);第375-378页 * |
| 牛肉和牛奶中布氏杆菌免疫磁珠富集方法的建立;易梅芳等;《药物生物技术》;20141231;第21卷(第6期);第538-542页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110684824A (en) | 2020-01-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kirkland et al. | Identification of a novel virus in pigs—Bungowannah virus: a possible new species of pestivirus | |
| CN107176977B (en) | Application of mycoplasma bovis Mbovp730 protein in natural infection and vaccine immune identification | |
| CN103898203B (en) | The detection method of Cryptosporidum parvum and detection kit | |
| CN107056898A (en) | 3 type of carp herpesviral, 1301 plants of ORF136 DNA recombinant expressions albumen, antibody and its application | |
| CN112481401A (en) | Kit for simultaneously detecting streptococcus pneumoniae, legionella pneumophila and moraxella catarrhalis | |
| CN102586157A (en) | Method for enriching and capturing vibrio patahaemolyticus with high throughput | |
| CN110819625A (en) | Method for extracting genome DNA (deoxyribonucleic acid) suitable for bacteria and/or fungi | |
| CN106086240B (en) | immunomagnetic bead kit for detecting peste des petits ruminants virus antigen and application thereof | |
| CN110684824B (en) | Immunomagnetic bead kit for detecting brucella antigen | |
| CN101367870A (en) | Bovine rotavirus recombinant VP6 protein antigen and method of preparing the same | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| CN106148568B (en) | Immunomagnetic bead kit and application thereof in detection of peste des petits ruminants virus antigen | |
| CN106086239B (en) | Immunomagnetic bead kit for detecting peste des petits ruminants virus antigen and application thereof | |
| CN106544432A (en) | A kind of drug resistance of Staphylococcus aureus and virulence method for quick and test kit | |
| CN116287139A (en) | Method for detecting staphylococcus aureus | |
| CN104894136B (en) | Aptamer capable of specifically detecting rotavirus and kit | |
| CN112795621A (en) | Method for efficiently removing host nucleic acid in blood stream infection sample | |
| CN106191304B (en) | Immunomagnetic bead kit for detecting peste des petits ruminants virus antigen and application thereof | |
| CN109337908B (en) | Nucleic acid aptamer group specifically binding to gliotoxin and application thereof | |
| CN113150160A (en) | Aflatoxin M1Anti-idiotype nano antibody and preparation method thereof | |
| CN111575299A (en) | Preparation method of bovine capsular A type pasteurella multocida immunomagnetic beads | |
| CN1186458C (en) | Method for detecting plant pathogenic bacteria sensitivity by improving PCR technology | |
| CN117229421B (en) | African swine fever virus outer envelope protein CD2v extracellular domain target antigen specific epitope, antibody and application thereof | |
| CN117186190B (en) | African swine fever virus outer envelope protein p12 target epitope antigen and application thereof in early detection and diagnosis | |
| CN115369096B (en) | Method for concentrating swine virus in water |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |