CN115369096B

CN115369096B - Method for concentrating swine virus in water

Info

Publication number: CN115369096B
Application number: CN202210963674.6A
Authority: CN
Inventors: 吴斌; 樊杰; 彭忠; 陈宏建; 华琳; 宋文博
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-08-11
Filing date: 2022-08-11
Publication date: 2024-03-22
Anticipated expiration: 2042-08-11
Also published as: CN115369096A

Abstract

The invention belongs to the technical field of virus concentration and detection in water, and particularly relates to a method for concentrating swine-origin viruses in water. The invention prepares glass wool for effectively adsorbing viruses in water, and evaluates the recovery rate of virus nucleic acid by taking pathogen pseudorabies virus and porcine epidemic diarrhea virus which threaten the pig industry and public health safety as models; the infectious recovery of the virus was evaluated using the Salmonella phage ph2-2 as a model. The use condition and the optimal operation program of the invention are finally determined by evaluating the influence of factors such as different pH values, different water quality, different virus types and the like on the concentration efficiency. The concentration of 100L water can be raised to more than 1000-10000 times after the concentration of the virus. The method has important significance for perfecting the risk assessment of farm epidemic diseases and public health risk assessment.

Description

Method for concentrating swine virus in water

Technical Field

The invention belongs to the technical field of concentration of swine-origin viruses in water, and particularly relates to a method for concentrating swine-origin viruses such as pseudorabies viruses and porcine epidemic diarrhea viruses in water, and the method can concentrate other swine-origin viruses in water.

Background

The invention is based on the presence of viruses in water, in particular to porcine pseudorabies virus and porcine epidemic diarrhea virus in water.

(1) Presence of virus in water:

viruses widely exist in the natural world and invade organisms mainly through alimentary tracts, respiratory tracts, mucous membranes and close contact, water is one of important ways of virus transmission, more than 700 viruses can be transmitted through water, more than 140 viruses are discharged through human and animal excreta, then enter groundwater and surface water through ways of sewer, farmland fertilization, farm sewage discharge, household garbage and the like and stably exist, and then spread through a cross pipe network, so that the whole water body is polluted; when the viral load is high enough and not sufficiently spread, it may lead to outbreaks of disease in the population or animals in the area.

Worldwide, rotavirus, norovirus, astrovirus, human adenovirus, coronavirus, hepatitis a virus, hepatitis e virus, coxsackievirus, etc. are important pathogens that infect humans and cause disease; among them rotavirus and norovirus are the main causative agents of intestinal diseases in humans, causing millions of deaths each year. As new coronavirus infection spreads throughout the world, researchers assess regional infection dynamics by detecting new coronaviruses in urban wastewater and provide more accurate abundance than clinical detection (Karthikeyan, s., levy, j.i., de Hoff, p.et al. Water sequencing reveals early crypticSARS-CoV-2variant transmission.Nature (2022)), viral water transmission has become an important means of disease transmission.

And is also becoming a new research hotspot.

(2) Current situation of swine-derived virus study in water:

the annual pig sales of China are half of the world, and more than half of animal proteins are provided by pork, so the pig industry occupies an important place in the national economy and social life of China. Since the China pig industry enters an intensive development stage, the breeding efficiency is continuously improved, but diseases are always the primary threat of pig farm development, although the development of various novel vaccines improves the immune level of susceptible animals, the novel detection technology is used for identifying and eliminating infectious agents more quickly, and the transmission path is switched to be the most important mode one for controlling major diseases of pig groups, so that the prevention and control of all diseases are effective. Thus, intensive studies of the transmission of porcine-derived viruses are an important task in modern veterinary disciplines. Compared with the modes of direct contact, indirect contact, natural medium, air transmission and the like, the research on the transmission of swine-origin viruses in water is less, and more pig-origin viruses in the pig farm are directed to the transmission of the medium, so that the research on the distribution and transmission of the swine-origin viruses in water is of great significance, and the research on the prevention and control of the swine-origin viruses, especially the swine-origin viruses which threaten public health safety and cause great losses to the pig farm, are focused.

Pseudorabies virus (PRV) is one of important viruses affecting the development of the pig industry in China, and is expressed as symptoms such as sow abortion, newborn piglet death, fattening pig respiratory diseases and the like, and the total positive rate of gE wild virus antibodies in the pig group in China from 2011 to 2021 is investigated to reach 29.87% (Tan L, yao J, yang Y, et al current Status and Challenge of Pseudorabies Virus Infection in China. Virol sin.2021;36 (4): 588-607). The popularity of PR not only has a continuous impact on the pig industry in China, but also has a threat to public health safety. In 2018, detection of specific antibodies by NGS technology and ELISA technology has been studied, and cases of pseudorabies virus infection have been found successively, particularly Liu et al successfully isolated a PRV strain from an acute encephalitis patient, providing direct evidence for PRV infection in humans (Liu Q, wang X, xie C, et al A Novel Human Acute Encephalitis Caused by Pseudorabies Virus Variant stress. Although human infection with PRV is an occasional event, once the prognosis of infection is mostly poor, this also suggests that there is a need for enhanced self-protection in working environments with PRV distribution. Therefore, by detecting PRV virus distribution in water of specific places such as slaughterhouses and pig farms, the method can perform traceable analysis on PRV infected by pig groups, and has important significance in early warning and improving protection consciousness and enhancing disinfection for working groups in relevant places.

Porcine Epidemic Diarrhea (PED) is one of three major viral diseases (african swine fever, porcine reproductive and respiratory syndrome, porcine epidemic diarrhea) that seriously affect the healthy development of the domestic pig industry. Before 2010, pig farm PED in China is mainly sporadic and regional, and by 10 months in 2010, a plurality of provinces burst PED epidemic situations with acute diarrhea as clinical characteristics, the death rate of piglet PED is increased to 80% to 100%, the pig farm is strikingly hit, and a continuous epidemic situation is still present in China until now (Wang D, fang L, xiao S.Portine epidemic diarrhea in China Res.2016; 226:7-13). PEDV is mainly discharged along with the feces of the sick pigs, then is diffused along with personnel and tools in the field, and after the non-disinfected thoroughly feces with poison are discharged out of the field, the PEDV can be diffused along with water body to pollute the whole large environment, so that the research on the distribution and transmission conditions of the PEDV in water is of great significance to the regional prevention and control of pedd.

(3) The existing method for concentrating the viruses in water is as follows:

the virus concentration in water is low, false negative is easy to occur in direct detection, and even the most sensitive clinical detection method is adopted, the virus in drinking water cannot be detected, so that the virus in water needs to be concentrated firstly for researching the virus in water.

The control requirements of viruses in water are freshly regulated in various countries in the world, the sanitation limit value or the control requirement of the viruses are not regulated in the current sanitary standards for drinking water (GB 5749-2006) in China, and three concentration methods are provided in the standard detection method for water and wastewater (23 rd edition) issued by the American public health society and the like, namely, firstly, a microporous filter is used for adsorbing viruses (9510B/C) in a sample; secondly, adsorbing and precipitating virus by using aluminum hydroxide (9510D); thirdly, enriching the virus with polyethylene glycol (9510E); other researchers in the world also try to develop various methods for concentrating viruses in water, such as ultrafiltration, ultracentrifugation, activated carbon adsorption, hollow fiber ultrafiltration, anion exchange resin adsorption and the like, and high performance liquid chromatography and the like, and have certain effects, but the results of different experiments have large difference, and further verification is needed for the concentrating effects of different viruses.

And because the water volume is large before concentration, the virus cannot be directly detected after the first concentration, and the second concentration is necessary, so that the final volume of the virus sample is reduced to the volume of a clinical specimen. The second concentration method comprises flocculation precipitation, dialysis, ultracentrifugation and the like, and the flocculation precipitation method is mainly adopted at present. The flocculant has various types and different physicochemical properties, an ideal flocculant is found, an optimal flocculation method is established, specific analysis of specific problems is needed, and fine screening research is carried out.

(4) Method for detecting viruses in water

After the virus in water is concentrated, the virus needs to be further detected and analyzed, the detection methods commonly used in China at present mainly belong to the following categories, and some methods are also continuously invented and improved.

1) Cell culture method

The virus is effectively concentrated and then detected, one of the most classical methods is a cell culture method, and common cell lines include Hela, hep-2, vero, PK-15 and the like. The method is the most widely used method in the 90 th century of the 20 th century, but the method is relatively time-consuming, complex to operate, high in laboratory requirements, needs a specific cell line and is easy to pollute.

2) Molecular biology method

The method mainly detects the nucleic acid of the virus, including common PCR, RT-PCTR, nested PCR, multiplex PCR, qPCR and the like, and can be used for rapidly detecting the virus which is difficult to culture; the sensitivity of qPCR can reach tens or even hundreds times of that of common PCR, and the qPCR is the current mainstream molecular biology detection method. In addition, the molecular biology method also comprises loop-mediated isothermal amplification (LAMP), nucleic acid sequence-based amplification (NASBA), gene chip technology and the like, and the methods are based on nucleic acid amplification and hybridization technology, so that better sensitivity can be achieved.

Based on cell culture and molecular biology, a method of combining cell culture with PCR (ICC-PCR) was derived. The method utilizes PCR to rapidly detect mRNA generated by virus in host cells, completes detection of infectious virus, and has higher sensitivity.

3) High throughput sequencing technology

In 2005, an ultra-high throughput genome sequencing system based on pyrosequencing is invented and promoted by 454Life Sciences, and with the development of high throughput sequencing technology, an application platform is illuminea sequencing technology. The method is characterized in that the eastern Taihu lake water source water is used as a research object, a gradient-series-circulation-tangential flow ultrafiltration technology is used for enriching and concentrating viruses in the water body, and then high-throughput sequencing is adopted to obtain a large amount of sequence information of microorganisms in the water (Ge Yingliang, in water conservancy and Shikon, iwuma Miseq sequencing analysis is used for analyzing virus diversity [ J ]. Food science, 2018,39 (02): 287-292) in drinking water source water.

4) Immunological method

The method mainly uses the high specificity of antigen-antibody reaction to mark fluorescent groups, colloidal gold, peroxidase and other groups on antigen or antibody, and judges to a certain extent by reading or observing color reaction. However, immunological methods are relatively low in sensitivity and are not suitable for direct detection of viruses in water.

(5) Requirements for concentration method of virus in water

Because the outer membrane structures, the sizes and the isoelectric points of different viruses are different, the concentration efficiency of the viruses is greatly different by different concentration methods; the fine adjustment of the steps of the same method can also lead to the remarkable change of the virus concentration efficiency, so that the method for concentrating the swine-derived virus in water is screened and developed with high efficiency and practicability, and the following requirements are met: (1) short concentration time; (2) higher recovery rate; (3) the volume is small after concentration; (4) low cost; (5) can be used for larger volume concentration; (6) good repeatability. Because the equipment conditions and the personnel operation proficiency of different detection units are different, the virus detection needs the characteristics of low equipment threshold, easy operation, easy popularization and the like.

Disclosure of Invention

The invention aims to provide a method for concentrating porcine viruses such as pseudorabies virus and porcine epidemic diarrhea virus in water, and the method is also suitable for concentrating and detecting trace amounts of other porcine viruses in water.

The invention can directly concentrate most kinds of viruses, and the final concentration of the viruses is continuously increased along with the increase of the filtering volume of the sample. The invention can carry out the collection and filtration of clinical water samples in various scenes. If 100L of water can be completed within 1 hour, the operation is simple and rapid, and the concentration of the concentrated virus can be 1000-10000 times higher than that of the concentrated virus in the raw water.

The technical scheme of the invention is as follows:

a method of concentrating porcine viruses such as pseudorabies virus and porcine epidemic diarrhea virus in water comprising the steps of:

(1) Preparation of glass wool filter element

Weighing a proper amount of glass wool, processing, filling into a filter, sealing and preserving at 4 ℃, and tightly filling the glass wool in the filter.

(2) Filtration of clinical samples

And (3) extracting the clinical water sample by using a peristaltic pump through a negative pressure system, and concentrating and adsorbing viruses in the water on a filter element in the filter through a glass wool filter element.

(3) Elution of viruses

The eluent is prepared from beef extract powder (Cat: B8530, beijing Soy Bao biotechnology Co., ltd.) with pH of 9.0-10.0,3%, and mainly has strong dissociation effect in alkaline pH, so that the effect of eluting viruses can be achieved. Namely: the glass cotton filter core is soaked by 70ml of eluent, then the filter core is rinsed again by 80ml of eluent, and the two eluents are combined and collected to be 150ml in total.

(4) Preliminary concentration of eluent

Taking 40ml of the eluent obtained in the step (3), regulating the pH to 5.0, and adding 1%o of skimmed milk powder; then shaking the eluent at the speed of 200-220r/min for 1-2h, centrifuging at the speed of 4500r/m for 30min, discarding the supernatant, and reserving a precipitate.

(5) Resuspension concentrate

To the pellet obtained in step (4) was added 1ml of a 0.1M PBS (i.e., phosphate buffer; cat: BL601A, product of Beijing brand Gekko technology Co., ltd.) solution, and the pellet at the bottom of the centrifuge tube was sufficiently dissolved and homogenized by blowing or vortexing.

(6) Detection and analysis

If the resuspension of the concentrated skimmed milk powder is positive, further tests can be carried out according to the needs. Namely: adding 20-40ml of beef extract into a super-high speed centrifuge tube, adding 5ml of 30% sucrose solution into the bottom of the centrifuge tube to form a cushion layer, centrifuging for more than 2 hours under 30000r/min, and re-suspending with 0.1M PBS (pH 7.2-7.4), wherein the re-suspension can be used for virus separation and identification.

In the above method, the filter volume in the step (1) is about 120cm ³ The density of the filled wet glass wool was about 0.5g/cm ³ More than 1000L of water may be filtered.

In the method, the filtering speed of the peristaltic pump in the step (2) can be 1L-4L/min, and the filtering speed has no obvious influence on the adsorption effect.

In the method, the filter element in the step (3) can be stored for 48 hours at the temperature of 4 ℃ and then is sent to a laboratory for eluting, and the treatment effect of the eluent with the pH value of 9.0-10.0 is the best; the soaking time of the eluent is preferably 15-20min.

In the method, the effect is best and the observation is convenient when the concentration of the skimmed milk powder in the step (4) is 1 per mill; the shaking effect is optimal under the condition of 16-25 ℃.

In the above method, in step (5), the concentrated suspensions may be mixed and centrifuged again, and the precipitate may be resuspended in PBS again, with a final concentrated liquid volume of typically 0.5ml to 1ml.

In the method, the ultra-high speed centrifugation in the step (6) can preserve the activity of the concentrated virus to the greatest extent, and is convenient for carrying out the separation and identification of the virus and the high-throughput sequencing work.

The invention has the advantages that:

the prepared glass wool filter element is utilized to adsorb, elute and concentrate viruses in the water body, so that a large-volume front-end sample can be filtered; the invention can concentrate different viruses such as DNA virus, RNA virus and the like in water through establishing a model, for example, the final concentration of the virus in 100L water sample is improved by 1000-10000 times compared with that in raw water after filtration and concentration. The glass wool filter core can be used for sampling and concentrating under various scenes, has simple requirements on equipment and reagents, can be used in a basic laboratory, and has important significance in perfecting public health safety risk assessment and farm biological safety risk assessment.

Drawings

Fig. 1: PRV-gH-qPCR different concentration plasmid amplification profiles.

Fig. 2: PRV-gH-qPCR standard plots for plasmids at different concentrations.

Fig. 3: PEDV-RT-qPCR curves for plasmid amplification at different concentrations.

Fig. 4: PEDV-RT-qPCR standard graph.

Fig. 5: the main process flow of the invention relates to a filter equipment configuration schematic diagram.

Fig. 6: the concentration process steps of the invention are schematically represented in the block diagram.

Detailed Description

The invention is further described below by way of examples, which are mainly based on pseudorabies virus (PRV), porcine Epidemic Diarrhea Virus (PEDV) and salmonella phage ph 2-2. But are not limited to, the porcine viruses described above.

1. Preparation of glass wool filter element

(1) Before each batch of filter is manufactured, 1 permillage sodium hypochlorite solution or 5 permillage potassium hydrogen persulfate solution is used for sterilizing the filter, a pipeline, a beaker and the like; then 5%o sodium thiosulfate is used for soaking the filter and wiping the workbench surface to remove residual disinfectant.

(2) 25g of dry glass wool was weighed by an electronic balance and, after 30 minutes of immersion in distilled water, excess water was drained.

(3) Soaking glass wool in 0.5M hydrochloric acid for 15-20min, discharging excessive hydrochloric acid, and washing glass wool with distilled water for 3-5 times.

(4) Soaking glass wool with 0.5M sodium hydroxide for 15-20min, discharging excessive sodium hydroxide, and washing glass wool with distilled water for 3-5 times.

(5) Soaking glass wool in 0.1M PBS (pH adjusted to 6.7-7.0), and sealing and preserving in a filter with a size of about 120cm in this example ³ The method comprises the steps of carrying out a first treatment on the surface of the The concentration efficiency of the glass wool filter element is not obviously reduced after the glass wool filter element is stored for 3 months at the temperature of 4 ℃.

Establishment of three virus detection methods of PRV (porcine pseudorabies virus), PEDV (porcine epidemic diarrhea virus) and Ph2-2 (Phage)

2.1 Establishment of PRV-qPCR method

(1) PRV nucleic acid was extracted and stored at-20℃according to the procedure described in the commercial nucleic acid extraction kit (Cat: RM201-02, nanjinouzan Biotechnology Co., ltd.). (PRV used in this test was HB-98 vaccine strain, purchased from the university of Wohano Co., ltd., lot 20220112).

(2) Referring to the national standard of the people's republic of China, namely the fluorescent PCR detection method of pseudorabies virus, the standard number is GB/T35911-2018, primers for amplifying PRV-gH plasmid fragments are designed, the size of the amplified fragments is 313bp, and the amplified fragments are amplified by referring to the specification of 2x Rapid Taq Master Mix (Cat: P222-01, nanjinouzan biotechnology Co., ltd.).

TABLE 1 primer sequences for PRV-gH plasmid fragments

Primer name	Sequence (5-3)
		PRV-gH-plasmid-F	CTGCCGCTGGAGGTCATCA
PRV-gH-plasmid-R	CCGCCTCGGAGAAGACGA

TABLE 2 amplification System for PRV-gH plasmid fragments

Reagent(s)	Sample addition amount (μl)
		2x Rapid Taq Master Mix	25
PRV-gH-plasmid-F	2
		PRV-gH-plasmid-R	2
dd-H ₂ O	19
		Template	2
Total volume of reaction	50

Table 2 reaction procedure: the first step is that the mixture is pre-denatured for 5min at 95 ℃; the second step of denaturation at 95 ℃ for 15s, annealing at 52 ℃ for 15s and extension at 72 ℃ for 15s is carried out for 35 cycles; in the third step, the reaction was carried out at 72℃for 5min to obtain 50. Mu.l of a reaction product.

(3) Mu.l of the PCR product was taken and purified and recovered according to the procedure of the commercial gel recovery kit (REF: D2500-02, omega-tek Co., U.S.A.).

(4) The purified target fragment is connected with a PMD-19T vector, the connection product is transferred into escherichia coli DH5 alpha, positive clones are selected and sent to the Wohanoaceae biotechnology Co-Ltd for sequencing, and the sequencing result blast comparison shows that the positive recombinant is obtained.

(5) E.coli DH 5. Alpha. Positive clones were expanded in TSB medium (REF: 211825, BD Co., USA) and plasmids were extracted from 5ml of bacterial liquid and stored at-20℃under the direction of commercial plasmid extraction kit (Cat: DP103-03, tiangen Biochemical technology (Beijing) Co., ltd.).

(6) The OD value of the plasmid at 260nm was read by a spectrophotometer and converted to a plasmid concentration of 176. Mu.g/. Mu.l, which was determined as a standard in the test and converted to a copy number of 5.28X 10 ¹⁰ copies/μl。

(7) The plasmid standard is diluted with water to a copy number of 5.28 x 10 per mu l ¹⁰ 、5.28*10 ⁹ 、5.28*10 ⁸ To 5.28 x 10 ¹ And each. 2 μl of plasmid standard of each dilution gradient is taken as qPCR, and the measurement result establishes a related formula of a standard curve.

(8) The detection system and the program refer to the national standard of the people's republic of China, namely the method for detecting the pseudorabies virus by fluorescence PCR, with the standard number of GB/T35911-2018, and are specifically shown in tables 3 and 4.

TABLE 3 PRV-gH-qPCR primers and probes

TABLE 4 PRV-gH-qPCR amplification System

Table 4 reaction procedure: the first step is to make the temperature 95 ℃ for 5 minutes; the second step is denaturation at 95 ℃ for 15s and extension at 60 ℃ for 30s, the second step is 40 cycles and fluorescence signals are collected at 60 ℃, and a PRV-gH-qPCR standard curve is established according to the result; with ddH ₂ O is a negative control.

2.3 Establishment of PEDV-RT-qPCR method

(1) Extracting nucleic acid of the PEDV vaccine strain according to the operation procedure of the commercial nucleic acid extraction kit instruction (PEDV used in the test is AJ1102-R vaccine strain, purchased from the pre-biosystems of the family martial arts, lot number 20220318); and the resulting cDNA was subjected to reverse transcription according to the kit instructions (REF: RR036A, takara Bio-engineering (Dai Co.) and stored at-20 ℃.

(2) Plasmid fragment primers of PEDV-M plasmid fragments are designed on the PEDV-M gene conserved fragments, and the amplified fragments have 614bp.

TABLE 5 PEDV-M plasmid fragment primers

Primer name	Sequence (5-3)
		PEDV-M-plasmid-F	TTGGTGGTCTTTCAATCC
PEDV-M-plasmid-R	GGTCCTGTTCCGAGGTAG

Table 6 reaction procedure: the first step is that the mixture is pre-denatured for 5min at 95 ℃; the second step of denaturation at 95 ℃ for 15s, annealing at 52 ℃ for 15s and extension at 72 ℃ for 15s is carried out for 35 cycles; in the third step, the reaction was carried out at 72℃for 5min to obtain 50. Mu.l of a reaction product.

The intermediate step is the same as the method of steps (3), (4) and (5) in 2.1.

TABLE 6 PEDV-M plasmid fragment amplification System

Reagent(s)	Sample addition amount (μl)
		2x Rapid Taq Master Mix	25
PEDV-M-plasmid-F	2
		PEDV-M-plasmid-R	2
dd-H ₂ O	19
		DNA	2
Total volume of reaction	50

(6) The OD value of the plasmid at 260nm was read by a spectrophotometer, and the plasmid concentration was converted to 50. Mu.g/. Mu.l, which was determined as a standard for the test, and converted to a copy number of 1.4X 10 ¹⁰ copies/μl。

(7) The plasmid standard is diluted with water to a copy number of 1.4x10 per μl ¹⁰ 、1.4*10 ⁹ 、1.4*10 ⁸ To 1.4 x 10 ¹ And each. 2 μl of plasmid standard of each dilution gradient is taken as qPCR, and the measurement result establishes a related formula of a standard curve.

(8) The reaction system and procedure are described in detail in tables 7 and 8 with reference to the laboratory methods available in the applicant (Wang Xuanke. Establishment of a method for quantitative RT-PCR detection of TaqMan fluorescence of porcine epidemic diarrhea virus [ D ]. University of agriculture in China, 2013 (10-11)).

TABLE 7 PEDV-M-RT-qPCR primers and probes

Primer/probe name	Sequence (5-3)
		PEDV-M-Primer-F	CGTACAGGTAAGTCAATTAC
PEDV-M-Primer-F	GATGAAGCATTGACTGAA
		PEDV-M--Probe	TTCGTCACAGTCGCCAAGG

TABLE 8 PEDV-M-RT-qPCR amplification System

Table 8 reaction procedure: the first step is to make the temperature 95 ℃ for 5 minutes; the second step is denaturation at 95 ℃ for 15s and extension at 60 ℃ for 30s, the second step is 40 cycles and fluorescence signals are collected at 60 ℃, and a PEDV-RT-qPCR standard curve is obtained according to the result; ddH2O was used as a negative control.

2.3 determination of phage titers

(1) Preparing a host bacterium: the salmonella single colony is selected to be inoculated into 5ml of TSB culture medium, cultured for 16-18 hours at the temperature of 37 ℃ at 200r/min, and the host bacterial suspension is obtained and stored at the temperature of 4 ℃ after sub-packaging.

(2) Determination of phage titers: phage ph2-2 to be tested [ Salmonella paratyphi bacteriophage ], patent application No. 2021113907587, publication No. CN114107222A, publication No. 2022, no. 03, no. 07 ]. The samples were diluted to 10-1, 10-2 and 10-3 to 10-7CFU/ml with PBS (pH 7.2-7.4), respectively, for a total of 7 gradients.

(3) 300 μl of host bacteria suspension is taken in a sterile 10ml EP tube, melted 45 ℃ semisolid agar (2.5 g TSA+1.8g TSB+100ml water) culture medium is added into the EP tube until 8ml, a prepared dish with the bottom layer of TSA culture medium is quickly poured into the EP tube, the dish is inclined and rotated to uniformly distribute the culture medium, after agar is solidified, 10 μl phage virus liquid is respectively taken according to dilution and is spotted on the dish, and after the agar is dried, the agar is subjected to inversion culture at a constant temperature of 37 ℃ for overnight.

(4) Three replicates were made for each dilution, with sterile water added as a blank.

(5) Transparent plaques were observed and counted, and the average of three replicates was taken.

Wherein phage titer (PFU/ml) =average number of plaques per gradient x dilution x 100.

2.4 calculation of recovery

The recovery rate is one of the most important indexes of the concentration efficiency, is defined as the virus sown into a certain volume of water, and the ratio of the virus obtained after concentration to the sown virus is calculated by the following formula:

recovery = (eluent virus concentration x eluent volume)/total amount of seeding virus

Because the detection results of viruses in different solutions are different, the virus is sown and then is detected after being diluted by adding the virus into the eluent, so that the interference of different solution solutes on the virus concentration measurement is eliminated.

Influence of pH on recovery

Since the isoelectric point of the virus particles is mostly lower than 7.0, the virus is mostly negatively charged in neutral water, and it is presumed that the intensity of the negative charge of the virus is affected by pH, and the higher the pH, the stronger the charge load. After the glass wool is treated, the positive charge effect on the surface of the glass wool is enhanced, so that the adsorption capacity of the glass wool on negative charge viruses in water is improved, and four treatment groups of pH6.0, pH7.0, pH8.0 and H9.0 are set for comparison based on the fact that the pH of most clinical water samples is between 6.0 and 9.0 for understanding the influence of water with different pH on the effect of adsorbing viruses by the glass wool. In order to maintain the consistency of the total virus seeding amount in each batch of test, PRV and PEDV vaccine dry powder can be dissolved in advance and then mixed, then virus mixed solution is diluted by a certain multiple and split into centrifuge tubes, and the centrifuge tubes are placed at-80 ℃ for storage and taken along with use.

(1) Setting 5 treatment groups, preparing 4L PBS solution (pH 7.2-7.4) in each treatment group, and adding 5 permillage sodium thiosulfate to neutralize residual chlorine; the pH of the first 4 treatment groups is respectively adjusted to 6.0, 7.0, 8.0 and 9.0, and the last treatment group is a negative control group; each set of experiments was repeated 3 times.

(2) 200. Mu.l of the virus mixture was added to each of the first 4 different pH groups, and after stirring well, filtration was performed as described above.

(3) The negative control group is directly filtered without adding virus mixed solution, and 150ml of beef extract eluent is stored for standby.

(4) The eluate of the negative control group was taken in 5ml, and 200. Mu.l of the virus mixture was added as a virus total amount group.

(5) The 4 pH filter groups, the negative control group and the virus total group were each prepared by extracting nucleic acid from 200. Mu.l of the solution and reverse transcribing, and the virus copy number was detected and calculated as described above.

(6) The test is established if the negative control detection result is negative; the viral copy number and recovery rate were calculated according to the standard curve determined, and the results are shown in Table 9; taking the most common pH7.0 water sample concentration in clinical water samples as an example, the virus concentration before and after concentration is shown in Table 10.

TABLE 9 Effect of different pH on the recovery of two viruses from concentration

TABLE 10 concentration before and after concentration of two viruses at pH7.0 (viral concentration units: copies/. Mu.l)

Table 10 illustrates: recovery = (concentration of virus in concentrated eluate × 150 ml)/(total concentration of virus in sows × 5 ml)

The results show that the glass wool has a concentration effect on two viruses, but the recovery rate is different under different pH conditions: PRV was not significant with pH from pH6.0 to pH9.0, only 10% difference between the highest recovery and the lowest recovery; PEDV generally decreases in recovery from pH6.0 to pH9.0 with increasing pH, but the highest recovery differs by less than a factor of 2 from the lowest; therefore, the pH adjustment of the water sample is not generally required.

4. Influence of Water on recovery

The clinical water sample has different sources, and is rich in organic matters, salinity and microorganism, and five water qualities with representative significance are specially selected and measured according to the possible sources (sewage treatment, the periphery of a culturing farm, a main river and the like) of the sample in order to evaluate the application range of the method.

(1) Setting 6 groups, respectively selecting 5 different water matrixes of tap water (pH 8.0), city inland lake water (pH 9.0), yangtze river water (pH 7.9), suburban river (pH 7.84) and PBS (pH 7.4), wherein the last group is a negative control group; each set of experiments was repeated 3 times.

(2) 200 μl of the prepared and packaged virus mixture was added to the above 5 different water quality groups, and the mixture was stirred uniformly and filtered as described above.

(4) The eluate of the control group was taken in 5ml, and 200. Mu.l of the virus mixture was added as a virus total amount group.

(5) 200 μl of each of the 5 different water quality groups, the negative control group and the virus total amount group was taken and subjected to reverse transcription, and the virus concentration was detected and calculated according to the above method.

(6) The test is established if the negative control detection result is negative; the viral copy number and recovery rate were calculated according to the standard curve determined, and the results are shown in Table 11; for a typical suburban river, the virus concentration before and after concentration is shown in Table 12.

TABLE 11 Effect of different Water quality on the recovery of two Virus concentrates

TABLE 12 concentration of two viruses before and after concentration in suburban river water in Wuhan (viral concentration units: copies/. Mu.l)

Description of Table 12: recovery = (eluent virus concentration ×150 ml)/(total virus group concentration ×5 ml)

The result shows that the glass wool has better concentration effect on two viruses in different water qualities, but the difference of the water qualities can cause the recovery rate to fluctuate within a certain range. The test shows that the method is applicable to various water qualities and has a wider application range.

5. Suitability study of concentration method for other porcine viruses

On the basis that glass wool has better recovery effect on PRV and PEDV, carrying out preliminary evaluation on recovery effect of other common porcine virus (porcine epidemic encephalitis virus), porcine respiratory and reproductive syndrome virus and porcine parvovirus in water; the three viruses are respectively referred to Zhejiang province local standard (the method for detecting the epidemic encephalitis B virus by fluorescence quantitative RT-PCR) with the standard number of DB33/T2246-2020; the standard number of the PRC import and export industry standard of the PRC is SN/T1919-2016; the national standard of the people's republic of China (pig reproduction and respiratory syndrome virus fluorescent RT-PCR detection method) has the standard number of GB/T35912-2018; and (3) establishing a qPCR method for detection, and performing preliminary evaluation through the difference of CT values before and after concentration.

(1) Setting 2 groups, preparing 4L-9L PBS solution (pH 7.2-7.4), and adding 5%o sodium thiosulfate to neutralize residual chlorine; the 1 st and 2 nd runs were 3L, the 3 rd run was 9L PBS.

(2) 200. Mu.l of a mixed solution of porcine epidemic encephalitis virus, porcine reproductive and respiratory syndrome virus and porcine parvovirus vaccine strain (SA 14-14-2 strain, JXA1-R strain and WH-1 strain, respectively, were used in the present test, and presented by the WH-family Probiotics Co., ltd.) was added to the group 1, and after stirring, filtration was carried out according to the method described above.

(3) Group 2 is a negative control group, in which no virus mixture was added, and the mixture was directly filtered, and 150ml of beef extract eluate was stored for use.

(4) The nucleic acid was extracted from 200. Mu.l of each of the filter group and the negative control group, and reverse transcribed, and detected as described above.

(6) The test is established if the negative control detection result is negative; the effect was initially assessed by differences in CT values before and after concentration.

TABLE 13 Effect of concentration of different viruses in Water

Virus species	ΔCT1(3L)	ΔCT2(3L)	ΔCT3(9L)
				PRRSV	1.325	1.365	2.078
PPV	1.220	1.324	2.560
				JEV	1.205	0.875	1.715

Table 13 illustrates: the three viruses in the table do not draw a standard curve for quantitative calculation, and the concentration effect is primarily estimated through the difference of CT values (namely delta CT); according to qPCR reaction principle and standard curve of PRV and PEDV, the concentration of virus is about 2 times different when CT value is 1, and the concentration is 2 times different when N is N ^N Multiple times.

The test result shows that the porcine epidemic encephalitis B virus, porcine reproductive and respiratory syndrome virus and porcine parvovirus can be effectively concentrated by glass wool, and the concentration of the virus before and after concentration is obviously improved; the final concentration of the compound is gradually increased along with the increase of the volume, and the compound shows a concentration rule similar to PRV and PEDV; this suggests that the present method is also effective for concentrating other types of viruses in water.

6. Infectious recovery effect of concentration method

qPCR or RT-qPCR is the most commonly used method for detecting viruses in water at present, but can only detect nucleic acid but cannot identify the infectivity of the viruses, and cannot identify the influence of a concentration method on the activity of the viruses; however, in the research, the concentrated pathogen is often required to be further analyzed, and the separation and identification work is carried out on the infectious live virus; it is therefore necessary to evaluate the effect of the present invention on recovery of viral infectivity.

Because the filter element material is prepared under the open condition, the filter element material does not have aseptic operation condition; when the virus in the concentrated solution is subjected to cell culture, a 0.22 mu m filter is needed to be used for filtering in advance, so that the virus content is lost to different degrees, and the recovery rate statistics is inaccurate; therefore, the method adopts phage as an infectious recovery model, and can accurately measure the infectious recovery rate on the basis of avoiding bacterial pollution.

(1) Test and negative control groups were set: an amount of ph2-2 phage virus solution was added to 4L-20L of PBS (pH 7.2-7.4) solution as a test group, and filtered as described above; the other group was a negative control group.

(2) The negative control group is directly filtered without phage virus liquid, and 150ml of beef extract eluent is stored for standby.

(3) The eluate of the negative control group was taken in 5ml, and 200. Mu.l of ph2-2 virus solution was added to the eluate as the total amount of virus sowing.

(4) Phage titers were determined according to the 2.3 method for the test group, negative control group, and virus seed group, and the results are shown in Table 14.

TABLE 14 Effect of recovery of infectivity of phage ph2-2 (phage concentration units: PFU/ml)

Description of Table 13: recovery = (eluent phage concentration × 150 ml)/(phage seeding total concentration × 5 ml)

The results showed that the phage virus liquid was recovered by filtration at about 5% -12% recovery and that the virus concentration after concentration increased with increasing sample volume. The titer of the concentrated solution is improved by 2 times after 4L of water is filtered, 7 times after 16L of water is filtered, and about 10 times after 20L of water is filtered, the virus concentration of 100L of water can be improved by about 40-50 times after the glass wool is filtered; the method can effectively recover the live viruses and improve the concentration of the live viruses in the concentrated solution.

7. Comparison of two-stage concentration

No matter the volume of the front end of the water sample, the volume of the 150ml beef extract eluent obtained after the filtration of the glass wool is still larger, and the beef extract eluent needs to be subjected to secondary concentration. The invention compares the three methods of skim milk powder, PEG-NaCl and ultra-high speed centrifugation, and screens out the methods applicable to different scenes.

Passing 4LPBS (pH 7.2-7.4) through glass cotton filter element, soaking and washing with 150ml beef extract eluent to obtain eluent 150ml and preserving; 200. Mu.l of the virus mixture (PRV and PEDV) and 200. Mu. lph2-2 phage, which had been prepared in aliquots, were added to 150ml of the eluate as samples before secondary concentration, and the virus recovery evaluation was performed 3 times per group.

In each test, 40ml of sample liquid (1% skim milk powder added and pH adjusted to 5.0) was taken as a skim milk powder group; taking 40ml of sample liquid (adding 10% PEG-8000,0.2M Nacl,pH to adjust the concentration to be between 6.5 and 7.5) as a PEG-NaCl group; taking 40ml of sample liquid as an ultra-high speed centrifugal group (30000 r/m for 2 h); the concentration and detection were performed as described above, and finally 0.5ml of PBS resuspension was obtained as a secondary concentrate. The secondary concentration method was compared in terms of both nucleic acid and infectious recovery, see in particular tables 15, 16 and 17.

TABLE 15 PRV two-stage concentration method recovery (viral concentration units: copies/. Mu.l)

Description of Table 15: recovery = (viral concentration after secondary concentration 0.5 ml)/(viral concentration before secondary concentration 40 ml) table 16 recovery of PEDV by secondary concentration method (viral concentration unit: copies/. Mu.l)

Description of Table 16: recovery = (virus concentration after secondary concentration 0.5 ml)/(virus concentration before secondary concentration 40 ml)

TABLE 17 recovery of infectivity by phage ph2-2 secondary concentration method (concentration unit: PFU/ml)

Description of Table 17: secondary concentration method recovery = (concentration of phage after secondary concentration 0.5 ml)/(concentration of phage before secondary concentration 40 ml)

In the process of qPCR detection of virus nucleic acid, the concentration efficiency of the skim milk powder method on PRV is obviously superior to that of the PEG-NaCl method, although the concentration efficiency of the skim milk powder method on PEDV is 1 time lower than that of the PEG-NaCl method, and the factors such as operation steps, equipment requirements, reagent loss, result observation and the like are considered, so that the skim milk powder method is selected for clinical preliminary detection, and is more concise and accurate. However, when the virus is further studied, a method of ultra-high speed centrifugation can be adopted to obtain as many active virus particles as possible; the PEG-NaCl method can be used if the ultra-high speed centrifugation condition is not provided.

8. Discussion of recovery effects

Since the final volume of the sample after glass wool and secondary concentration is 0.5-1ml, when the overall recovery rate is N, the concentration multiple of the sample=n×sample volume/1 ml; the concentration can be increased 1000-fold with an overall recovery of 1% and the final concentration can be increased 10000-fold with a recovery of 10% calculated as a sample volume of 100L (100000 ml). The invention verifies that the glass wool has better concentration effect on two different types of porcine viruses and one bacteriophage, and also explores the concentration effect on other viruses, and the result shows that the invention has concentration effect on most viruses in water. Has important application and popularization values.

Claims

1. A method for concentrating porcine virus in water, wherein the porcine virus is pseudorabies virus, comprising the following steps:

(1) Preparing a glass wool filter, and respectively soaking with 0.5-1M hydrochloric acid and sodium hydroxide;

(2) Sampling and filtering: extracting 50-100L or more of clinical water sample at a speed of 1-1.5L/min by a peristaltic pump, and adsorbing viruses in the water onto glass wool;

(3) Eluting virus: placing the filter at 4deg.C for 48 hr, delivering to laboratory, soaking in 3% beef powder soaking solution with pH of 9.0-10.0 for 15min, washing, and adding hydrochloric acid to adjust pH to neutrality to maintain virus activity;

(4) Concentration of eluent: adding 1%of skimmed milk powder into the eluent of the previous step, adjusting the pH to 5.0, shaking at room temperature for 2h at 200r/min, centrifuging for 30min, discarding the supernatant, and collecting precipitate for resuspension;

(5) If the target virus nucleic acid is detected as positive by the heavy suspension after the concentration of the skimmed milk powder, the eluent is concentrated by using a super-high speed centrifugation method, so that the complete virus particles as much as possible are obtained.