CN104894136B - Aptamer capable of specifically detecting rotavirus and kit - Google Patents

Abstract

The invention discloses a nucleic acid aptamer capable of specifically detecting rotavirus and a kit. The aptamer SEQ ID No1-2 provided by the invention has better affinity with rotavirus VP4 protein. The aptamer of the invention can be used for capturing rotavirus in a solution and detecting VP4 protein of the rotavirus in the solution, and the aptamer can be prepared into a corresponding kit, which is beneficial to rotavirus serodiagnosis and blood screening. The aptamer for rotavirus detection has the advantages of high sensitivity, low cost, easy preparation and easy storage.

Description

Aptamer capable of specifically detecting rotavirus and kit

Technical Field

The invention belongs to the field of medical detection, and particularly relates to a nucleic acid aptamer and a kit capable of specifically detecting rotavirus.

Background

Rotavirus is one of the most common pathogens of severe diarrhea diseases of infants and young children worldwide, and mainly infects epithelial cells of small intestine to cause cell damage and cause diarrhea. The rotavirus is epidemic in summer, autumn and winter every year, the infection route is a way of excreting one mouth, the clinical manifestation is acute gastroenteritis and permeable diarrhea, the disease course is generally 7 days, the fever lasts for 3 days, the vomiting lasts for 2-3 days, the diarrhea lasts for 5 days, and the dehydration symptom is seriously appeared.

The rotavirus is seven kinds in total, and the numbers of the rotavirus are A, B, C, D, E, F, G and the like respectively by English letters. Humans are primarily infected with rotavirus species a, B and C, with rotavirus species a being the most common of these. These seven rotaviruses all cause disease in other animals.

There are different virus strains among rotavirus species a, called serovars (serovars). Similar to influenza viruses, rotaviruses use a dual classification system based on two structural proteins on the surface of the virion. Glycoprotein VP7 defines form G. Whereas the protein VP4, which is sensitive to proteases, defines the P-type. Type P will be indicated by a number for serotype P and the corresponding genotype P will be indicated by a number inside the square bracket. The representation of serotype G is also very similar, but the number of genotypes G will be the same as for serotype G. For example, the "rotavirus strain Wa" (rotavrus straln Wa) will be designated as "P1A [8] G1". Because the two genes that determine the G and P types can be transmitted separately to produce progeny, different combinations of the two genes will produce different strains of virus.

Rotavirus is distributed around the world, group A, B, C can cause diarrhea in humans and animals, and group D-G only causes diarrhea in animals. The major prevalent serotypes in group a are G1P8, G2P4, G3P8 and G4P8, accounting for over 80% of all cases visited. Older children and adults often present with asymptomatic infections, commonly referred to as virus carriers. Diarrhea caused by group a RV has a high incidence in developed or developing countries, and is an important cause of morbidity and mortality in infants. Second only to the second cause of respiratory infections, lethal to infants in developing countries. Fecal-oral is the primary route of RV transmission, and in addition, water source contamination, respiratory air transmission, intimate contact in hospitals and nursery houses and family members can all contribute to epidemics, and it has been speculated that animals may be a significant source of human RV infection. After the virus invades the human body, the virus proliferates in small intestinal mucosa villus capillaries, and virus coat protein VP4 is a main pathogenic factor, which causes cell lysis and death, and microvilli atrophy, shorten and fall off; crypt cells proliferate, secrete and cause severe diarrhea and loss of water and electrolytes. The incubation period of the virus is only one to two days, then the fever, watery diarrhea, vomiting and dehydration are suddenly caused, and the virus can be completely recovered by autoimmunity. However, when the infant is malnourished or dehydrated, if not treated in time, the infant will die. Because the virus has large variation and the targeted vaccine is difficult to realize industrialization, the World Health Organization (WHO) recommends taking prevention as the main and paying attention to the nutrition and health conditions of infants to reduce the infection rate of the virus.

The traditional method for detecting RV infection mainly depends on Electron Microscopy (EM) or immunological determination, such as enzyme-linked immunosorbent assay (E L1 SA) and the like, recently, with the development of molecular genetics and the like, more specific and sensitive detection methods, such as RNA nucleic acid hybridization, RT-PCR and the like, for detecting nucleic acid are established.

Aptamer (Aptamer) is a single-stranded oligonucleotide molecule (ssDNA or ssRNA) capable of binding a certain biological target with high affinity and high specificity, the Aptamer is a single-stranded DNA/RNA capable of binding a target molecule with high specificity, which is obtained by screening a synthetic DNA/RNA library by using an exponential enrichment ligand phylogenetic technique (Systemlc evoluted of L lgands by Exponentilal enrichment, SE L EX).

Disclosure of Invention

The invention aims to provide a nucleic acid aptamer and a kit capable of specifically detecting rotavirus.

The aptamer provided by the invention is (a) or (b) as follows:

(a) single-stranded DNA shown in sequence 1 of the sequence table;

(b) single-stranded DNA shown in sequence 2 of the sequence table.

The aptamer has better affinity with rotavirus VP4 protein.

The aptamer can also be modified or modified to obtain derivatives of the aptamer.

The derivative of the aptamer can be any one of the following:

a) deleting part of or adding part of complementary nucleotides into the aptamer to obtain a derivative of the aptamer with the same function as the aptamer;

b) carrying out nucleotide substitution or partial modification on the aptamer to obtain a derivative of the aptamer with the same function as the aptamer;

c) transforming the skeleton of the aptamer into a phosphorothioate skeleton to obtain a derivative of the aptamer with the same function as the aptamer;

d) modifying the aptamer into peptide nucleic acid to obtain a derivative of the aptamer with the same function as the aptamer;

e) and (3) connecting the aptamer with fluorescent, radioactive and therapeutic substances to obtain the derivative of the aptamer with the same function as the aptamer.

An ELISA plate (such as a 96-well plate) on which the aptamer is immobilized also belongs to the protection scope of the invention. The rotavirus VP4 protein in a sample to be detected can be detected by adopting an enzyme-linked amplification method, so that the detection of the rotavirus in clinic is realized.

The aptamer can be used for preparing a kit for detecting rotavirus.

The invention also provides a kit for auxiliary detection of rotavirus patients, which comprises the aptamer. The kit can also comprise an enzyme label plate (such as a 96-well plate) coated with the rotavirus VP4 protein monoclonal antibody. The ELISA plate coated with the rotavirus VP4 protein monoclonal antibody can be a 96-well plate with a hepatitis virus VP4 protein monoclonal antibody. The aptamer of the invention can detect rotavirus by detecting rotavirus VP4 antigen rather than antibody in the early stage of rotavirus infection. The aptamer of the invention is beneficial to developing a new method for detecting rotavirus.

The invention also protects the application of the ELISA plate fixed with the aptamer in the preparation of a kit; the kit can assist in detecting rotavirus VP4 protein and/or assist in detecting rotavirus patients.

The aptamer of the invention can be used for capturing rotavirus VP4 protein in a solution, can also be used for detecting rotavirus in the solution, and is beneficial to rotavirus serodiagnosis and blood screening. The aptamer provided by the invention is used for partially replacing a monoclonal antibody to capture VP4 protein for rotavirus detection, and has the advantages of high sensitivity, low cost, easiness in preparation and easiness in storage. The invention has high application value.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified.

N1-NTA agarose beads are available from Qlagen, streptavidin-modified 96-well plates (available from plerce), horseradish peroxidase (HRP) -labeled streptavidin from plerce, Escherichia coli (E. coll) DH5a from Beijing ancient countries, Escherichia coli (E. coll) B L (DE3) from lnvltrogen, prokaryotic expression vector p L Ml, publicly available from the institute of chemical sciences of Chinese academy of sciences, references SodeokaM, &ltttttranslation = L "&gTtT L &lTt/Tmgtt gTtTtTarson C, Chen L, et al. A. multinuclear platform for prokaryotic expression by PCR! Chenovular PCR, and ECbutyl 3. Bg.3.109593.

Example 1 preparation of related proteins and related solutions

Preparation of histidine-tagged rotavirus VP4 protein (target protein)

1. Amplification of the Gene encoding the VP4 protein

The sequence of the VP4 protein is well known in the art. Such as: genbank: SEG _ DQ 005115S.

Rotavirus, especially A virus, is used as template for PCR amplification, and the primer pair comprising primer 1 and primer 2 is used for PCR amplification to obtain PCR amplification product.

Primer 1 (forward primer): 5'-atggc ttcgctcatt tataga-3', respectively;

primer 2 (downstream primer): 5, -tcacagtttacactgcagtat-3';

the 5' ends of the upstream primer and the downstream primer are respectively introduced with an EcoRl enzyme cutting site and a BamH enzyme cutting site.

PCR amplification conditions: 2m1n at 95 ℃; 30s at 95 ℃, 30s at 66 ℃, 1m1n at 72 ℃ for 35 cycles; 7m1n at 72 ℃.

2. Construction of prokaryotic expression vector

① the PCR amplified product of step 1 was double digested with restriction enzymes EcoRl and BamHl to give a digested product.

② the prokaryotic expression vector p L Ml was digested with restriction enzymes EcoRl and BamHl, and the vector backbone was recovered.

③ linking the enzyme digestion product of step ① with the vector backbone of step ② to obtain a linked product.

④ the ligation product is transformed into Escherichia coli DH5 α competent cells, positive clones are screened by L B plate containing ampicillin (Amp), and plasmids are extracted for enzyme digestion identification and sequencing identification in sequence.

Sequencing results show that a recombinant plasmid p L Ml-VP4 is obtained (the framework plasmid is a prokaryotic expression vector p L Ml, and the coding gene of rotavirus VP4 protein is inserted between the EcoRl and BamHl enzyme digestion recognition sites and fused with the coding gene of histidine tag on the vector to express the rotavirus VP4 protein with histidine tag).

3. Prokaryotic expression identification of rotavirus VP4 protein with histidine tag

① recombinant plasmid p L Ml-VP4 was transformed into competent cells of E.coli B L21 (DE3) and positive clones were screened on ampicillin-containing L B plates.

② Positive clones were picked up in L B liquid medium, shaken overnight at 37 ℃ and cultured for 10h with 1PTG (final concentration 1 mmol/L).

③ 13000 centrifugal 1m1n at 13000rpm, collected thallus and SDS-PAGE electrophoresis and Western blot.Westernblot primary antibody is antl-hls (from Slgma corporation). Western blot shows that the thallus contains rotavirus VP4 protein with histidine tag.

4. Large-scale expression, purification and detection of rotavirus VP4 protein with histidine tag

① the recombinant plasmid p L Ml-VP4 is transformed into competent cells of Escherichia coli B L21 (DE3) to obtain recombinant bacteria.

② the recombinant strain obtained in step ① was inoculated into L B medium, cultured overnight with shaking at 37 ℃, transferred to L B medium containing 50ug/ml ampicillin at a volume ratio of 1: 50, cultured with shaking at 37 ℃ for about 2 hours (OD 600 was adjusted to 0.6-0.8), and further cultured with 1PTG (final concentration 1 mmol/L) for 12 hours.

③ 3500rpm, the cells were collected by centrifugation, sonicated (frequency 120w, sonication 3s for 3s per cycle, 400 cycles in an ice bath) in a start buffer (0.02M sodium phosphate, 0.5M NaCl, pH7.4) containing 100ug/ml lysozyme, and the lysate was collected by centrifugation at 10000rpm for 10M1n at 4 ℃.

④ the lysed supernatant was applied to an N1-NTA-coupled agarose gel column (available from GE Co.) and washed with washbingbuffer (0.02M sodium phosphate, 0.5M NaCl, 0.05M imidazole, rho H7.4) to remove impure protein and elutlonbuffer (0.02M sodium phosphate, 0.5M NaCl, 0.5M imidazole, pH7.4) to elute the target protein to obtain rotavirus VP4 protein (positive in the rotavirus VP4 antigen detection kit).

Example 2 screening and preparation of aptamers

First, protein fixation

1. Placing N1-NTA agarose beads in a 5ml centrifuge tube, removing supernatant, and washing with PBS buffer solution for three times;

2. dispersing the microbeads obtained in the step 1 into a target protein (or a control protein is an escherichia coli empty carrier protein), incubating for 1h at room temperature, and centrifugally washing for three times by using a PBS (phosphate buffer solution);

3. the microbeads of step 2 were redispersed in 1ml of PBS buffer and placed at 4 ℃ until use.

Design of random nucleic acid library

A random nucleic acid library containing approximately 20 nucleotides at both ends and 40 nucleotides in the middle was designed as follows:

5 '-ATGCTCGGATCGCACTAAAGG (N40) ATGCTGGACGTTTTCATGCG-3'; n40 represents 40 random nucleotides.

Screening of aptamer

1. DNA library pretreatment

The random nucleic acid library was dissolved in binding buffer.

2. Reverse sieve

Mixing the random nucleic acid library with microbeads immobilized with control proteins, and incubating for 1-2 hours at 37 ℃; after washing with binding buffer, the microbeads were centrifuged by ultrafiltration.

3. Positive sieve

Adding the solution subjected to ultrafiltration and centrifugation in the reverse screening process into the microbeads immobilized with the target protein, and incubating for 1-2 hours at 37 ℃. After the microbeads were washed by ultrafiltration and centrifugation, the microbeads were transferred to a centrifuge tube with sterilized water. Heating the microbeads at 95 ℃ for 10m1n, cooling on ice for 10m1n, centrifuging at high speed, collecting supernatant, taking DNA in the supernatant as a template, and performing PCR amplification by using primers (F1TC-5, -ATGCTCGGATCGCACTAAAGG-3 and Bloltln-5, -CGCATGAAAACGTCCAGCAT-3'); after amplification, the biotin-labeled PCR product was isolated by avidin-coated dextran beads, followed by denaturing and melting of double-stranded DNA using 0.2M sodium hydroxide, and F1 TC-labeled DNA single strands were collected and desalted for the next round of screening.

In order to obtain aptamers that bind target proteins with high affinity and specificity, the amounts of proteins, screening times, contents, and the number of washes for the positive screen were gradually changed during the screening process to increase the screening pressure.

After 10 rounds of selection, PCR amplification was performed using the selection products as templates with primers (5'-ATGCTCGGATCGCACTAAAGG-3' and 5 ' -CGCATGAAAACGTCCAGCAT-3,) and the PCR products were sequenced.

The sequence of the finally selected aptamer is as follows (see sequences 1 and 2 of the sequence table):

sequence 1 (L ZBD-1) ATGCTCGGATCGCACTAAAGGATACGCTCCAATTACCAGCTTACCACCTACGACAGATCTC ATGCTGGACGTTTTCATGCG-3';

sequence 2 (L ZBD-2) ATGCTCGGATCGCACTAAAGGAGATCTTACATTCAATCGCCTATACATACTATCCGCTATG ATGCTGGACGTTTTCATGCG-3';

example 3 specificity of aptamer (detection by fluorescein)

First, F1TC labeling of aptamers

The aptamers L ZBD-1 and L ZBD-2 prepared in example 2 were labeled with fluorescein isothiocyanate (F1 TC).

II, specificity of aptamer

1. Immobilization of proteins

(1) Immobilization of target proteins

① placing 200ul N1-NTA agarose beads in 5ml centrifuge tube, removing supernatant, washing with PBS buffer solution three times;

② dispersing the ① microbeads in 1m L target protein, incubating for 1h at room temperature, and washing three times by centrifugation with PBS buffer;

③ the microbeads from step ① were redispersed in 1ml PBS buffer and placed at 4 ℃ until use.

(2) Immobilization of control proteins

The target protein was replaced with the control protein, and the procedure was otherwise the same as in step (1). Wherein the control proteins are rotavirus VP6 protein, VP2 protein, BSA, human hemoglobin, influenza HA protein and gp120 protein respectively.

2. Specificity of binding of aptamer to target protein

The following 3 sets of treatments were set:

group 1, dissolving 1ul of 10uM FITC labeled aptamer L ZBD-1 with a binding buffer solution, and incubating with 50ul of microbeads immobilized with target proteins for 1 h;

group 2, dissolving 1ul of 10uM FITC labeled aptamer L ZBD-2 with a binding buffer solution, and incubating with 50ul of microbeads immobilized with target proteins for 1 h;

group 3: dissolving 1ul of 10uM FITC labeled random library by using a binding buffer solution, and incubating for 1h with 50ul of microbeads immobilized with target proteins;

groups 4-9, 1ul of 10uM FITC labeled aptamer L ZBD-1 was dissolved in binding buffer and incubated with 50ul of microbeads immobilized with 6 control proteins, respectively, for 1 h;

group 10-15, 1ul of 10uM FITC labeled aptamer L ZBD-2 was dissolved in binding buffer and incubated with 50ul of beads immobilized with 6 control proteins for 1 h;

the supernatant was taken from each group at the time of just adding the beads (before binding) and at the time of 1 hour of incubation (after binding), and the fluorescence intensity was measured.

Binding rate (fluorescence intensity before binding-fluorescence intensity of serum after binding)/fluorescence intensity before binding X100%.

Aptamer name	Target protein binding rate
		LZBD-1	97.2％
LZBD-2	98.3％
		Random libraries	2.1％

The results showed that the aptamers L ZBD-1 and L ZBD-2 had good specificity for the target protein neither the aptamers L ZBD-1 nor L ZBD-2 bound to the control protein, nor showed good specificity.

In addition, the dissociation constants Kd were determined to be L ZBD-1 and L ZBD-2 at 15nM and 12nM, respectively, by routine binding assays.

Example 4 detection of rotavirus in serum Using aptamer plates

Taking 80ul of serum containing rotavirus; mixing with binding buffer solution in equal volume, adding into aptamer plate, incubating at 200ul per well for 1 hr (1-2 hr); washing with washing solution, adding HRP-modified rotavirus VP4 protein monoclonal antibody, and incubating at 37 deg.C for 0.5 hr (0.5-1 hr); after being washed by the washing liquid, the developing liquid A + B is added for developing for 10 minutes; and setting comparison.

The results show that the aptamer L ZBD-1 and the aptamer L ZBD-1 can detect target viruses in serum, and the detection effect of the aptamer is stronger than that of the PCR detection method by detecting the virus titer through PCR.

Example 5 stability test

The aptamer L ZBD-1 and the aptamer L ZBD-2 were placed in serum at room temperature, respectively, and after 3 weeks, the residual amount was checked by PCR, and it was found that 90% of the activity remained.

Claims (1)

1. The application of the aptamer in preparing a kit for detecting diarrhea caused by rotavirus is characterized in that the aptamer can be specifically combined with the rotavirus, and the sequence of the aptamer is single-stranded DNA (deoxyribonucleic acid) shown as a sequence 1 in a sequence table; or single-stranded DNA shown in sequence 2 of the sequence table, and the kit for detecting rotavirus diarrhea comprises a 96-hole enzyme label plate with a rotavirus VP4 protein monoclonal antibody.