CN104894136A - Aptamer and kit capable of specifically detecting rotavirus - Google Patents
Aptamer and kit capable of specifically detecting rotavirus Download PDFInfo
- Publication number
- CN104894136A CN104894136A CN201510284321.3A CN201510284321A CN104894136A CN 104894136 A CN104894136 A CN 104894136A CN 201510284321 A CN201510284321 A CN 201510284321A CN 104894136 A CN104894136 A CN 104894136A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- rotavirus
- protein
- lzbd
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an aptamer and a kit capable of specifically detecting a rotavirus. The aptamer, provided by the invention and as shown in SEQ ID No. 1-2, has high affinity with VP4 protein of the rotavirus. The aptamer provided by the invention can be used for capturing the rotavirus in a solution and also can be used for detecting the VP4 protein of the rotavirus in the solution. The aptamer is prepared into the corresponding kit to promote rotavirus serological diagnosis and blood screening. The aptamer provided by the invention is used for detecting the rotavirus and has the advantages of high sensitivity, low cost, easiness in preparation and easiness in storage.
Description
Technical field
The invention belongs to medical science, be specifically related to a kind of aptamer and test kit of energy specific detection rotavirus.
Background technology
Rotavirus is one of sick modal pathogenic agent of global infant's severe diarrhea, its main infection intestinal epithelial cell, thus causes cell injury, causes diarrhoea.Rotavirus is popular in autumn and winter in summer every year, and route of infection is excrement a bite approach, and clinical manifestation is acute gastroenteritis, and sick in osmotic diarrhea, the course of disease is generally 7 days, and heating continues 3 days, vomits 2 ~ 3 days, suffers from diarrhoea 5 days, seriously occur dewatering symptom.
Rotavirus always has seven kinds, is numbered A, B, C, D, E, F and G etc. respectively with English alphabet.The mankind are mainly subject to the infection of rotavirus A kind, B kind and C kind, and wherein modal be the infection of rotavirus A kind.And these seven kinds of rotaviruss all can cause disease with it other animals.
Among rotavirus A kind, there is different virus strain, be referred to as serum variant (serovar).Similar with influenza virus, rotavirus employs dual categorizing system, does to classify according to two structural protein matter of virosomal surface.Glycoprotein VP7 defines G type.P type is then defined for protease-sensitive protein VP4.P type can indicate P serotype with a numeral, and indicates corresponding P genotype by a numeral of square bracket inside.The method for expressing of G serotype is also very similar, but the genotypic numeral of G can be identical with the numeral of G serotype.For one thing, " Rotavirus Wa strain virus strain " (rotavlrus straln Wa) will be labeled as " P1A [8] G1 ".Because these two determine that G types can be communicated separately with the gene of P type and produce offspring, so the different combination of two genes will produce various different virus strain.
Rotavirus all has distribution all over the world, and A, B, C group rotavirus can cause human and animal to suffer from diarrhoea, and D-G group only causes animal diarrhea.The serotype of A group Major Epidemic is G1P8, G2P4, G3P8 and G4P8, in all medical cases, account for more than 80%.Older children and adult, often in symptomless infection, claim virus carrier usually.No matter in flourishing or developing country, the diarrhoea that A group RV causes has higher sickness rate, is that infant falls ill and lethal Important cause of disease.In developing country, it is the second cause of disease being only second to respiratory tract infection that infant is lethal.Excrement-mouth is the main path that RV propagates, pollution of waterhead in addition, respiratory tract airborne transmission, and all can cause popular with the close contact in nursery schools and childcare centres in one's power kinsfolk in institute, somebody infers, animal may be the important contagium infecting RV as people.In the internal breeding of mucous membrane of small intestine villus cell after Virus entry human body, virus capsid protein VP4 is major virulent factor, and it causes cytolysis dead, microvillus atrophy, shortens, comes off; The hyperplasia of gland nest, secretion increasing, cause severe diarrhea, the forfeiture of water and eletrolytes.The latent period of virus only has one to two days, and then fever, watery diarrhea, vomiting dehydration suddenly, can recover completely with autoimmunization.But when the bad or existing dehydration of infant nutrition, if treat not in time, will infant death be caused.Because virus variation itself is comparatively large, specific aim vaccine is difficult to realize industrialization, and the World Health Organization (WHO) is recommended to put prevention first, and notices that infantile nutrition and sanitary condition reach the infection rate reducing virus.
The method that traditional detection RV infects depends on Electronic Speculum (EM) or immunologic assay, as Enzyme-linked Immunosorbent Assay (EL1SA) etc.In recent years along with the development of molecular genetics etc., establish more special and responsive detection method, as RNA nucleic acid hybridization, RT-PCR etc. are for detecting the method for nucleic acid.
Aptamer (Aptamer, also known as aptamers, aptamer) be can high-affinity, high specific the few nucleic acid molecule (ssDNA or ssRNA) of the strand in conjunction with certain biological target.Aptamer be by index concentration Fas lignand system evolution technology (Systematlc Evolutlon of Llgands by Exponentlal enrlchment, SELEX) screen from the DNA/RNA library of synthetic obtain can high degree of specificity in conjunction with the single stranded DNA/RNA of target molecules.Report that the target of aptamer comprises metal ion, organic molecule, polypeptide, protein, cell are even organized.The molecular recognition function of aptamer and antibody class are seemingly, there is the target recognition capability quite even stronger with antibody molecule, but there is much excellent characteristic compared with antibody, as molecular weight is little, can manufacture, not easy in inactivation, non-immunogenicity, easily synthesis and mark, between penetrate tissue, good dynamic metabolism, different batches, product can not there are differences and have fine chemical stability fast, has important application prospect in fields such as biological detection, medical diagnosis on disease treatments.
Summary of the invention
The object of this invention is to provide a kind of aptamer and test kit of energy specific detection rotavirus.
Aptamer provided by the invention is following (a) or (b):
The single stranded DNA shown in sequence 1 of (a) sequence table;
The single stranded DNA shown in sequence 2 of (b) sequence table.
Described aptamer and rotavirus vp 4 albumen have good affinity.
Also described aptamer can be carried out modifying or transforming, obtain the derivative of described aptamer.
The derivative of described aptamer can be following any one:
A) by described aptamer deletion or the Nucleotide increasing partial complementarity, the derivative with described aptamer with the aptamer of identical function obtained;
B) described aptamer is carried out Nucleotide replacement or part modification, the derivative with described aptamer with the aptamer of identical function obtained;
C) skeleton of described aptamer is transform as phosphorothioate backbone, the derivative with described aptamer with the aptamer of identical function obtained;
D) aptamer is transform as peptide nucleic acid(PNA), the derivative with described aptamer with the aptamer of identical function obtained;
E) after described aptamer being connected upper fluorescence, radioactivity and therapeutic substance, the derivative with described aptamer with the aptamer of identical function obtained.
The enzyme plate (as 96 orifice plates) being fixed with described aptamer also belongs to protection scope of the present invention.Rotavirus vp 4 albumen in enzyme connection amplifying method detection sample to be tested can be adopted, thus realize the detection of clinical middle rotavirus.
Described aptamer can be used for preparing the test kit detecting rotavirus.
The present invention also protects the test kit of a kind of auxiliary detection rotavirus patient, comprises described aptamer.Described test kit also can comprise the enzyme plate (as 96 orifice plates) being coated with rotavirus vp 4 protein monoclonal antibody.The described enzyme plate being coated with rotavirus vp 4 protein monoclonal antibody specifically can be 96 orifice plates with hepatitis virus VP4 protein monoclonal antibody.Utilize aptamer of the present invention, at the rotavirus infection initial stage, the detection to rotavirus can be realized by detection Rotavirus VP4 antigen instead of antibody.The novel method that Advantageous developments rotavirus detects by aptamer of the present invention.
The present invention also protects the enzyme plate being fixed with described aptamer preparing the application in test kit; Described test kit can auxiliary detection rotavirus vp 4 albumen and/or auxiliary detection rotavirus patient.
Utilize aptamer of the present invention, rotavirus vp 4 albumen in solution can be caught, also can detect the rotavirus in solution, rotavirus serodiagnosis and blood screening will be conducive to.Utilize aptamer of the present invention, part replaces monoclonal antibody to catch VP4 albumen and carry out rotavirus detection, have highly sensitive, cost is low, easy preparation, the advantage of easily preserving.The present invention has very high using value.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.
N1-NTA Agarose microbead is purchased from Qlagen company.96 orifice plates (being purchased from plerce company) that Streptavidin is modified.The Streptavidin that horseradish peroxidase (HRP) marks is purchased from plerce company.Intestinal bacteria (E.coll) DH5a bacterial strain is purchased from Beijing Ding Guo company.Intestinal bacteria (E.coll) BL21 (DE3) bacterial strain is purchased from lnvltrogen company.Prokaryotic expression carrier pLMl; The public can obtain from Institute of Chemistry, Academia Sinica; Overproductlon of the p50subunlt of NF-k B.B loorg Med ChemLett.1993,3:1089_1094.
The preparation of embodiment 1, associated protein and related solution
One, the preparation with histidine-tagged rotavirus vp 4 albumen (target proteins)
1, the amplification of the encoding gene of VP4 albumen
The sequence of VP4 albumen is that this area is known.As: Genbank:SEG_DQ005115S.
With rotavirus, particularly A virus is template, as the template of pcr amplification, carries out pcr amplification, obtain pcr amplification product with the primer pair of primer 1 and primer 2 composition.
Primer 1 (upstream primer): 5 '-atggc ttcgctcatt tataga-3 ';
Primer 2 (downstream primer): 5 ,-tcacagtttacactgcagtat-3 ';
5 ' end of upstream and downstream primer introduces EcoRl restriction enzyme site and BamHl restriction enzyme site respectively.
Pcr amplification condition: 95 DEG C of 2m1n; 95 DEG C of 30s, 66 DEG C of 30s, 72 DEG C of 1m1n, 35 circulations; 72 DEG C of 7m1n.
2, the structure of prokaryotic expression carrier
1. use the pcr amplification product of Restriction Enzyme EcoRl and BamHl double digestion step 1, obtain digestion products.
2. use Restriction Enzyme EcoRl and BamHl double digestion prokaryotic expression carrier pLMl, reclaim carrier framework.
3. step digestion products is 1. connected with step carrier framework 2., obtains connecting product.
4. will connect product conversion bacillus coli DH 5 alpha competent cell, with the LB plate screening positive colony containing penbritin (Amp), extraction plasmid carries out enzyme successively and cuts qualification and order-checking qualification.
Sequencing result shows, (skeleton plasmid is prokaryotic expression carrier pLMl to obtain recombinant plasmid pLMl-VP4, at EcoRl and BamHl enzyme, the histidine-tagged encoding gene cut on the encoding gene and carrier inserting rotavirus vp 4 albumen between recognition site merges, and expresses rotavirus vp 4 albumen that band is histidine-tagged).
3, the prokaryotic expression qualification with histidine-tagged rotavirus vp 4 albumen
1. by recombinant plasmid pLMl-VP4 transformation of E. coli BL21 (DE3) competent cell, with the LB plate screening positive colony containing penbritin.
2. picking positive colony is in LB liquid nutrient medium, and 37 DEG C of joltings are spent the night, and adds 1PTG (final concentration 1mmol/L) and continues to cultivate induction 10h.
3. the centrifugal 1m1n of 13000rpm, collects thalline and carries out SDS-PAGE electrophoresis and Western blot.The primary antibodie of Westernblot is antl-hls (purchased from Slgma company).The result of Western blot shows, containing rotavirus vp 4 albumen that band is histidine-tagged in thalline.
4, the great expression with histidine-tagged rotavirus vp 4 albumen, purifying and detection
1. by recombinant plasmid pLMl-VP4 transformation of E. coli BL21 (DE3) competent cell, recombinant bacterium is obtained.
2. the recombinant bacterium inoculation LB substratum 1. step obtained, 37 DEG C of shaking culture are spent the night, volume ratio by 1: 50 is transferred in the LB substratum containing 50ug/ml penbritin, about 2h (making OD600 be 0.6-0.8) is cultivated in 37 DEG C of joltings, adds 1PTG (final concentration 1mmol/L) and continues to cultivate induction 12h.
3. 3500rpm collected by centrifugation thalline, at start buffer (the 0.02M sodium phosphate containing 100ug/ml N,O-Diacetylmuramidase, 0.5M NaCl, pH7.4) ultrasonication (frequency 120w in, in each circulation, ultrasonic 3s stops 3s, and 400 circulations, ice bath carries out), 4 DEG C, the centrifugal 10m1n of 10000rpm, collect cracking supernatant.
4. agarose cracking supernatant being splined on N1-NTA coupling sticks post (purchased from GE company), with washlngbuffer (0.02M sodium phosphate, 0.5M NaCl, 0.05M imidazoles, ρ H74) washing removal foreign protein, with elutlonbuffer (0.02M sodium phosphate, 0.5M NaCl, 0.5M imidazoles, pH7.4) wash-out target protein, obtains being with histidine-tagged rotavirus vp 4 albumen (by Rotavirus VP4 antigen detection kit test positive).
The screening of embodiment 2, aptamer and preparation
One, albumen is fixing
1, get N1-NTA Agarose microbead and be placed in 5ml centrifuge tube, remove supernatant, PBS buffer solution three times;
2, be scattered in by the microballon of step 1 in target proteins (or reference protein is intestinal bacteria empty carrier albumen), incubated at room 1h, PBS buffer by centrifugation washs three times;
3, the microballon of step 2 is scattered in 1ml PBS damping fluid again, be placed in 4 DEG C for subsequent use.
Two, the design of random nucleic acid library
Design the random nucleic acid library that two ends comprise about 20 Nucleotide, centre comprises 40 Nucleotide as follows:
5 '-ATGCTCGGATCGCACTAAAGG (N40) ATGCTGGACGTTTTCATGCG-3 '; N40 represents 40 random nucleotides.
Three, the screening of aptamer
1, DNA library pre-treatment
Random nucleic acid library is dissolved in binding buffer liquid.
2, instead to sieve
Random nucleic acid library is mixed with the microballon being fixed with reference protein, hatches 1-2 hour for 37 DEG C; After the washing of binding buffer liquid, microballon is centrifugal by ultrafiltration.
3, just sieve
Being added by solution centrifugal for ultrafiltration in anti-sieved journey is fixed with in the microballon of target proteins, hatches 1-2 hour for 37 DEG C.By microballon by after ultrafiltration centrifuge washing, with aqua sterilisa, microballon is transferred in centrifuge tube.By microballon after 95 DEG C of heating 10m1n, cooled on ice 10m1n, high speed centrifugation, collect supernatant liquor and with DNA wherein for template, utilize primer (F1TC-5 ,-ATGCTCGGATCGCACTAAAGG-3, and Blotln-5 ,-CGCATGAAAACGTCCAGCAT-3 ') carry out pcr amplification; By the PCR primer of the dextran bead separating bio element mark of avidin bag quilt after amplification, then utilize the sodium hydroxide of 0.2M that double-stranded DNA sex change is unwind, collect the DNA single chain of F1TC mark, screen for next round after these DNA single chain desalinations.
In order to obtain the aptamer of high-affinity and specific binding target proteins, in the process of screening, progressively changing anti-sieve and the protein content, screening time, the content that are just sieving and just sieving washing times, to increase screening pressure.
10 take turns screening after, carry out pcr amplification for template by primer (5 '-ATGCTCGGATCGCACTAAAGG-3 ' and 5 '-CGCATGAAAACGTCCAGCAT-3) to screen product, PCR primer checked order.
The aptamer sequence following (sequence 1 and 2 see sequence table) of final selection:
Sequence 1 (LZBD-1): ATGCTCGGATCGCACTAAAGGATACGCTCCAATTACCAGCTTACCACCTACGACAG ATCTC ATGCTGGACGTTTTCATGCG-3 ';
Sequence 2 (LZBD-2): ATGCTCGGATCGCACTAAAGGAGATCTTACATTCAATCGCCTATACATACTATCCG CTATG ATGCTGGACGTTTTCATGCG-3 ';
The specificity (being detected by fluorescein) of embodiment 3, aptamer
One, the F1TC mark of aptamer
Aptamer LZBD-1 and LZBD-2 of embodiment 2 preparation is marked with fluorescein isothiocyanate (F1TC).
Two, the specificity of aptamer
1, albumen is fixing
(1) target proteins is fixing
1. get 200ul N1-NTA Agarose microbead and be placed in 5ml centrifuge tube, remove supernatant, PBS buffer solution three times;
2. be scattered in 1mL target proteins by step microballon 1., incubated at room 1h, PBS buffer by centrifugation washs three times;
3. step microballon is 1. scattered in 1ml PBS damping fluid again, be placed in 4 DEG C for subsequent use.
(2) reference protein is fixing
Target proteins is replaced, other same step (1) with reference protein.Wherein said reference protein is respectively rotavirus vp 6 albumen, VP2 albumen, BSA, human hemoglobin, influenza HA protein, gp120 albumen.
2, the specificity that is combined with target proteins of aptamer
Following 3 groups of process are set:
1st group: the aptamer LZBD-1 binding buffer liquid marked by 1ul 10uM FITC dissolves, and is fixed with the microbeads for periods 1h of target proteins with 50ul;
2nd group: the aptamer LZBD-2 binding buffer liquid marked by 1ul 10uM FITC dissolves, and is fixed with the microbeads for periods 1h of target proteins with 50ul;
3rd group: the random library binding buffer liquid marked by 1ul 10uM FITC dissolves, and is fixed with the microbeads for periods 1h of target proteins with 50ul;
4-9 group: the aptamer LZBD-1 binding buffer liquid marked by 1ul 10uM FITC dissolves, and is fixed with the microbeads for periods 1h of 6 kinds of reference proteins respectively with 50ul;
10-15 group: the aptamer LZBD-2 binding buffer liquid marked by 1ul 10uM FITC dissolves, and is fixed with the microbeads for periods 1h of 6 kinds of reference proteins respectively with 50ul;
All get supernatant liquor in the moment (before combination) just adding microballon and moment (after combining) of hatching 1 hour, measure fluorescence intensity for each group.
Combination rate=(before combining the rear clear liquid fluorescence intensity of fluorescence intensity-combination)/combine front fluorescence intensity X 100%.
| Fit title | Target proteins combination rate |
| LZBD-1 | 97.2％ |
| LZBD-2 | 98.3％ |
| Random library | 2.1％ |
Result shows: aptamer LZBD-1 and LZBD-2 has good specificity to target proteins.Aptamer LZBD-1 and LZBD-2 and reference protein all can not be in conjunction with, show good specificity.The fit of random library can not be combined with target proteins.
Associativity additionally by routine is tested, and draws its dissociation constant Kd to be respectively LZBD-1 be 15nM, LZBD-2 to be 12nM.
Embodiment 4, the rotavirus adopted in aptamer plate detection serum
Get the serum that 80ul contains rotavirus; Mix with binding buffer liquid equal-volume, join aptamer plate, the every hole of 200ul, hatch 1 hour (1-2 hour) for 37 DEG C; After washings washing, add rotavirus vp 4 protein monoclonal antibody that HRP modifies, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; Contrast is set.
The absorbance value under 450nm is detected after colour developing.Calculate the relative photon absorbing intensity of aptamer plate.Result shows, aptamer LZBD-1 and aptamer LZBD-1 can detect the target viral in serum.Check virus titer by PCR, find to adopt the effect of fit detection to be better than the method for PCR detection on the contrary.
Embodiment 5 stability test
Aptamer LZBD-1 and aptamer LZBD-2 is placed in respectively the serum of normal temperature, after 3 weeks, detects its residual quantity by PCR, find still there is 90% maintenance active.Activity determination finds, its activity does not change substantially.Illustrate, this is fit has good stability.
Claims (5)
1. aptamer, is characterized in that: can be combined with virus-specific.
2. aptamer as claimed in claim 1, is characterized in that: can with rotavirus specific binding.
3. aptamer as claimed in claim 2, is characterized in that: the single stranded DNA shown in sequence 1 that its sequence is sequence table; Or the single stranded DNA shown in sequence 2 of sequence table.
4. a rotavirus specific detection agents box, it contains the aptamer described in claim 1-3.
5. the application of aptamer described in claim 1-3 in the test kit for the preparation of detection rotavirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510284321.3A CN104894136B (en) | 2015-05-23 | 2015-05-23 | Aptamer capable of specifically detecting rotavirus and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510284321.3A CN104894136B (en) | 2015-05-23 | 2015-05-23 | Aptamer capable of specifically detecting rotavirus and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104894136A true CN104894136A (en) | 2015-09-09 |
| CN104894136B CN104894136B (en) | 2020-07-24 |
Family
ID=54027095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510284321.3A Expired - Fee Related CN104894136B (en) | 2015-05-23 | 2015-05-23 | Aptamer capable of specifically detecting rotavirus and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104894136B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108707607A (en) * | 2018-06-08 | 2018-10-26 | 邵玉芹 | A kind of aptamers and kit of energy specific detection EV71 viruses |
| CN112526130A (en) * | 2020-12-15 | 2021-03-19 | 武汉大学 | Reagent kit for detecting rotavirus/norovirus and application thereof |
-
2015
- 2015-05-23 CN CN201510284321.3A patent/CN104894136B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| BLANCA ET AL: ""Selection, Characterization and Application of Nucleic Acid Aptamers for the Capture and Detection of Human Norovirus Strains", 《PLOS ONE》 * |
| HU ET AL: "Cell attachment protein VP8* of a human rotavirus specifically interacts with A-type histo-blood group antigen", 《NATURE》 * |
| 王敏等: "婴幼儿腹泻轮状病毒感染调查分析", 《青岛大学医学院学报》 * |
| 胡丽芝 等: "《山东化工》", 8 March 2015 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108707607A (en) * | 2018-06-08 | 2018-10-26 | 邵玉芹 | A kind of aptamers and kit of energy specific detection EV71 viruses |
| CN112526130A (en) * | 2020-12-15 | 2021-03-19 | 武汉大学 | Reagent kit for detecting rotavirus/norovirus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104894136B (en) | 2020-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lima et al. | The intestinal virome of malabsorption syndrome-affected and unaffected broilers through shotgun metagenomics | |
| Boley et al. | Porcine deltacoronavirus infection and transmission in poultry, United States | |
| Nurmoja et al. | Biological characterization of African swine fever virus genotype II strains from north‐eastern Estonia in European wild boar | |
| de Deus et al. | Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in Spain | |
| Harrington et al. | Norovirus capture with histo-blood group antigens reveals novel virus-ligand interactions | |
| Bank-Wolf et al. | Zoonotic aspects of infections with noroviruses and sapoviruses | |
| Matthijnssens et al. | Simian rotaviruses possess divergent gene constellations that originated from interspecies transmission and reassortment | |
| Peralta et al. | Evidence of widespread infection of avian hepatitis E virus (avian HEV) in chickens from Spain | |
| Oue et al. | Isolation of an equine coronavirus from adult horses with pyrogenic and enteric disease and its antigenic and genomic characterization in comparison with the NC99 strain | |
| An et al. | Novel goose-origin astrovirus infection in geese: the effect of age at infection | |
| Kim et al. | Intestinal and extra-intestinal pathogenicity of a bovine reassortant rotavirus in calves and piglets | |
| Qin et al. | Antigenic characterization of a marine fish iridovirus from grouper, Epinephelus spp | |
| Di Felice et al. | Bovine noroviruses: a missing component of calf diarrhoea diagnosis | |
| CN106591242B (en) | One plant of canine parvovirus poison strain CPV-YH and its application | |
| Swiatek et al. | Detection and analysis of bovine rotavirus strains circulating in Australian calves during 2004 and 2005 | |
| CN104312985B (en) | The people source rotavirus attenuated strain with broad-spectrum immunogenicity and the vaccine prepared by this attenuated strain | |
| Grellet et al. | Prevalence and risk factors of astrovirus infection in puppies from French breeding kennels | |
| Bishop et al. | Enteric viruses | |
| Jeong et al. | Detection and molecular characterization of porcine group C rotaviruses in South Korea | |
| Takano et al. | Molecular characterization and pathogenicity of a genogroup GVI feline norovirus | |
| CN106867974A (en) | Type infected animal model of CA 6 and preparation method and application | |
| CN102212623B (en) | Two-color fluorescence quantitative polymerase chain reaction (PCR) combined detection method of swine fever virus and blue ear disease virus and kit thereof | |
| Kuwabara et al. | First isolation of cytopathogenic bovine torovirus in cell culture from a calf with diarrhea | |
| CN101660001B (en) | Reagent kit for detecting rotavirus nucleic acid | |
| Li et al. | Isolation and identification of two new strains of mammalian orthoreovirus from Chinese tree shrews |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Liu Hui Inventor after: Zhang Lu Inventor after: Jiang Yuhong Inventor before: Liu Hui Inventor before: Jiang Yuhong Inventor before: Zhang Lu |
|
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200622 Address after: 266000 No. 217 West Liaoyang Road, Shandong, Qingdao Applicant after: QINGDAO WOMEN AND CHILDREN'S Hospital Address before: 266034 Shandong province Qingdao City, Tong Fu Road No. 6 Applicant before: Liu Hui |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200724 Termination date: 20210523 |