CN111999497A - Enzyme linked immunosorbent assay kit for detecting rabies virus glycoprotein antigen and application thereof - Google Patents

Enzyme linked immunosorbent assay kit for detecting rabies virus glycoprotein antigen and application thereof Download PDF

Info

Publication number
CN111999497A
CN111999497A CN202010854943.6A CN202010854943A CN111999497A CN 111999497 A CN111999497 A CN 111999497A CN 202010854943 A CN202010854943 A CN 202010854943A CN 111999497 A CN111999497 A CN 111999497A
Authority
CN
China
Prior art keywords
solution
seq
enzyme
acid sequence
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202010854943.6A
Other languages
Chinese (zh)
Other versions
CN111999497B (en
Inventor
董春娜
张蕾
宋芳
肖进
齐鹏
李静
李鹏宇
刘新月
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Animal Husbandry Industry Co Ltd
Original Assignee
China Animal Husbandry Industry Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Animal Husbandry Industry Co Ltd filed Critical China Animal Husbandry Industry Co Ltd
Priority to CN202010854943.6A priority Critical patent/CN111999497B/en
Publication of CN111999497A publication Critical patent/CN111999497A/en
Application granted granted Critical
Publication of CN111999497B publication Critical patent/CN111999497B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G01N33/56994—Herpetoviridae, e.g. cytomegalovirus, Epstein-Barr virus
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals
    • G01N33/535—Production of labelled immunochemicals with enzyme label or co-enzymes, co-factors, enzyme inhibitors or enzyme substrates
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G01N2333/145—Rhabdoviridae, e.g. rabies virus, Duvenhage virus, Mokola virus or vesicular stomatitis virus
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses an enzyme linked immunosorbent assay kit for specifically and quantitatively detecting rabies virus glycoprotein antigen and application thereof. The kit comprises an enzyme-linked reaction plate coated by a capture antibody and a monoclonal antibody of an enzyme-labeled antibody. The heavy chain variable region of the monoclonal antibody is as follows: CDR1 is shown as 31 th to 36 th amino acids of the sequence 1; CDR2 is shown as amino acids 51-66 of the sequence 1; CDR3 is shown as 99 th to 105 th amino acids of a sequence 1; light chain variable region: CDR1 is shown as amino acids 24-40 of the sequence 2; CDR2 is shown as amino acids 56-62 of the sequence 2; the CDR3 is shown as amino acids 95-103 of the sequence 2. The enzyme-linked immunosorbent assay quantitative detection kit prepared by adopting the specific monoclonal antibody of the rabies virus has high sensitivity and strong specificity, and can effectively distinguish and detect the content of the rabies virus glycoprotein antigen in a sample.

Description

Enzyme linked immunosorbent assay kit for detecting rabies virus glycoprotein antigen and application thereof
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to an enzyme-linked immunoassay kit for specifically and quantitatively detecting a rabies virus glycoprotein antigen, which is suitable for specific, rapid and accurate detection of the rabies virus glycoprotein antigen.
Background
Rabies virus is a member of the Rhabdoviridae (Rhabdoviridae) Lyssavirus (lyssvirus) genus. According to the analysis and identification of the rabies virus N protein monoclonal antibody and G protein series, the rabies viruses in all parts of the world are mainly divided into 4 serotypes. The serotype 1 virus is the rabies virus which is widely known and has the widest geographical distribution and the greatest threat to the health of people in the world, and comprises the wild virus and a fixed virus laboratory strain (such as SAD). With the progress of modern molecular biology, the genus rabies virus is divided into 7 genotypes by referring to the similarity rate of 500 nucleotides at the N-terminal of the rabies virus nucleoprotein (N protein) gene, and the genotypes 2-6 are only found in Europe and Africa.
Rabies virus is an nonsegmented single-stranded negative-strand RNA virus with a total genome length of about 1,2000nt, mainly encoding five known structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). During rabies virus infection, human and animal bodies can generate both cellular and humoral immune responses. Mainly affects lymphocytes mainly including nerve cells and T lymphocytes, but has little influence on B lymphocytes. In this process, in addition to being associated with the G protein, viral immunity is now increasingly found to be associated with the N and P proteins. The N gene is 1350-inch 1353nt in length, encodes N protein (nucleotidin) and is mainly responsible for packaging virus genome RNA. Because the content of the N gene is rich and the coded N protein is easy to detect by a fluorescent antibody method, the N gene and the N protein are most widely applied to antigen diagnosis and evolution analysis.
The existing method for determining rabies virus glycoprotein antigen mainly comprises an immunofluorescence method, an RT-PCR nucleic acid detection method and a virus separation method, wherein the methods mainly comprise cell culture separation and suckling mouse inoculation separation, and the detection methods are required to be completed in a P2 or P3 laboratory, and the methods are required to be completed only by professional experimenters and equipment, are long in time consumption and cannot meet the requirement of large-scale rapid diagnosis at all, so that a rabies virus glycoprotein antigen detection method which is convenient to operate, specific, sensitive, accurate and reliable is required to be developed.
At present, Enzyme-Linked immunosorbent assays (ELISA) are the mainstream immunoassay technology in the market, and the ELISA is widely applied to clinical detection, is rapid and convenient, has high sensitivity and does not need special instruments and equipment. The monoclonal antibody is an antibody prepared by screening aiming at a single epitope on the antigen, so that the rabies virus glycoprotein antigen can be sensitively and specifically recognized, a foundation is laid for a rabies virus glycoprotein antigen detection method based on the monoclonal antibody technology, and a detection method of an enzyme-linked immunosorbent assay related to quantitative detection of the rabies antigen is not searched at present, so that the invention has originality and novelty.
Disclosure of Invention
The invention aims to provide an enzyme-linked immunoassay kit for specifically and quantitatively detecting rabies virus glycoprotein antigens, which utilizes a monoclonal antibody RV1 capable of being specifically combined with the rabies virus glycoprotein antigens as a capture antibody and a detection antibody to establish a rabies virus glycoprotein antigen detection method with good specificity, sensitivity and repeatability, and is used for detecting the content of the rabies virus glycoprotein antigens in culture solution, inactivated solution, purified solution, concentrated solution, demulsified finished vaccines and the like in the vaccine production process.
Based on the purpose, the enzyme-linked immunosorbent assay kit for specifically and quantitatively detecting the rabies virus glycoprotein antigen comprises an enzyme-linked immunosorbent assay plate coated by a capture antibody and an enzyme-labeled detection antibody. The enzyme-labeled detection antibody is preferably an antibody labeled by horseradish peroxidase, and the horseradish peroxidase can be crosslinked on the detection antibody by a glutaraldehyde method or a periodic acid method. The capture antibody and the detection antibody are both monoclonal antibodies RV1 specifically combined with rabies virus glycoprotein antigens.
The capture antibody and the detection antibody (the monoclonal antibody RV1 specifically combined with the rabies virus glycoprotein antigen) both contain a heavy chain variable region RV1-VHAnd light chain variable region RV1-VL(ii) a The RV1-VHAnd RV1-VLBoth consist of a determinant complementary region and a framework region; the RV1-VHAnd said RV1-VLEach of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the RV1-VHThe amino acid sequence of the CDR1 is shown as amino acids 31-36 of SEQ ID No. 1; the RV1-VHThe amino acid sequence of the CDR2 is shown as amino acids 51-66 of SEQ ID No. 1; the RV1-VHThe amino acid sequence of the CDR3 is shown as the 99 th to 105 th amino acids of SEQ ID No. 1; the RV1-VLThe amino acid sequence of the CDR1 is shown as amino acids 24-40 of SEQ ID No. 2; the RV1-VLThe amino acid sequence of the CDR2 is shown as amino acids 56 to 62 of SEQ ID No. 2; the RV1-VLThe amino acid sequence of the CDR3 is shown as amino acids 95-103 of SEQ ID No. 2;
preferably, the RV1-VHThe amino acid sequence of (A) is shown as 1 st to 116 th sites of SEQ ID No.1 in a sequence table; RV1-V thereofLThe amino acid sequence of (A) is shown as 1 st to 113 th sites of SEQ ID No.2 in a sequence table;
the optimal coating preparation method and conditions of the enzyme-linked reaction plate are that a specific monoclonal antibody RV1 of the rabies virus is diluted into a coating working solution with the pH value of 9.6 carbonate solution to be 0.5-10 mu g/ml (preferably 0.5-4ug/ml, more preferably 1-4ug/ml, and finally 1ug/ml), then the coating working solution is added into a 96-hole polystyrene enzyme-linked reaction plate, 100 mu l/hole is formed, the plate is placed at the temperature of 2-8 ℃ for 8-12 hours, so that the specific monoclonal antibody RV1 is fully combined with the enzyme-linked reaction plate, then PBS buffer solution containing 10mg/ml bovine serum albumin (pH7.4) is added into the plate according to 300 mu l/hole, the plate is sealed and treated at the temperature of 37 ℃ for 2-3 hours, and the plate is dried, and is sealed and stored at the temperature of 2-8 ℃.
Preferably, the kit also comprises an antigen standard substance, wherein the antigen standard substance is a rabies virus glycoprotein antigen, the purity is not lower than 80%, the antigen content is 4IU, the antigen standard substance is diluted to (6.2 mIU-200 mIU) by using a sample diluent in use, and the measured OD is measured450nmValues were used to plot a standard curve.
The kit is a double-antibody sandwich enzyme-linked immunosorbent quantitative detection kit prepared by adopting a rabies virus specific monoclonal antibody, and the antigen content of rabies viruses in a sample is quantitatively detected by detecting signal change generated by an enzyme catalysis substrate.
Furthermore, the kit also comprises a sample diluent, a 20-time concentrated washing solution, a substrate solution A, a substrate solution B and a stop solution. The enzyme-linked reaction plate is a detachable 96-hole enzyme label plate. The sample diluent was a phosphate buffer solution containing 5mg/ml casein and having a value of 0.01M, pH of 7.4. The 20-time concentrated washing solution is 0.01M phosphate buffer solution with the pH value of 7.4 and contains 0.8-1.2% (ml/ml) of Tween-20. The substrate solution A is a citrate phosphate buffer solution containing 0.6mg/ml of urea hydrogen peroxide, and the substrate solution B is a tetramethylbenzidine solution containing 0.2mg/ml, and the substrate solution A and the substrate solution B are mixed in a ratio of 1:1 when in use. The stop solution is a 2mol/L sulfuric acid solution.
The invention also claims a monoclonal antibody which can be specifically combined with the rabies virus glycoprotein antigen and is the following monoclonal antibody:
1) contains heavy chain variable region RV1-VHAnd light chain variable region RV1-VL(ii) a The RV1-VHAnd RV1-VLBoth consist of a determinant complementary region and a framework region; the RV1-VHAnd said RV1-VLEach of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the RV1-VHThe amino acid sequence of the CDR1 is shown as amino acids 31-36 of SEQ ID No. 1; the RV1-VHThe amino acid sequence of the CDR2 is shown as amino acids 51-66 of SEQ ID No. 1; the RV1-VHThe amino acid sequence of the CDR3 is shown as the 99 th to 105 th amino acids of SEQ ID No. 1; the RV1-VLThe amino acid sequence of the CDR1 is shown as amino acids 24-40 of SEQ ID No. 2; the RV1-VLThe amino acid sequence of the CDR2 is shown as amino acids 56 to 62 of SEQ ID No. 2; the RV1-VLThe amino acid sequence of the CDR3 is shown as amino acids 95-103 of SEQ ID No. 2;
2) contains heavy chain variable region RV1-VHAnd light chain variable region RV1-VL(ii) a The RV1-VHThe amino acid sequence of (A) is shown as 1 st to 116 th sites of SEQ ID No.1 in a sequence table; RV1-V thereofLThe amino acid sequence of (A) is shown as 1 st to 113 th sites of SEQ ID No.2 in a sequence table; the application of the enzyme-linked immunoassay kit in the specific quantitative detection of rabies virus glycoprotein antigen also belongs to the protection scope of the invention.
The application of the monoclonal antibody capable of being specifically combined with the rabies virus glycoprotein antigen in the preparation of the kit for detecting the rabies virus is also within the protection scope of the invention. In particular to the application in the preparation of a kit for detecting rabies virus.
The monoclonal antibody capable of specifically binding to the rabies virus glycoprotein antigen can be obtained by the following method: the rabies virus-specific monoclonal cell strains of the present invention are screened according to conventional methods known in the art. Specifically, the specific monoclonal antibody of the rabies virus can comprise the following steps:
1) obtaining inactivated rabies virus glycoprotein antigen by a hollow fiber purification method, wherein the purity is not lower than 80 percent and the inactivated rabies virus glycoprotein antigen is used as immunogen;
2) using rabies virus inactivated antigen as immunogen to immunize animals for 4 times continuously, wherein each time is 14 days apart, the first 3 times adopt a multipoint subcutaneous immunization mode, the 4 th time adopts an intraperitoneal injection immunization mode, and each time is 1 mg/animal;
3) separating splenocytes from immune animals, fusing the splenocytes with myeloma cells, screening hybridoma cells by using HAT selective culture medium, and screening specific positive clones from the supernatant of the hybridoma cells by using an indirect ELISA method; when the serum antibody level of the immunized animal is detected by indirect ELISA with a titer exceeding 1:50000, spleen cells of the animal can be isolated and prepared into a single cell suspension, and fused with myeloma cells (preferably mouse myeloma cells SP2/0) under the induction of an appropriate fusing agent (such as polyethylene glycol) to form hybridomas, and then cultured in HAT medium to screen the fused hybridoma cells, and further a desired specific monoclonal antibody cell strain can be identified using indirect ELISA or the like, and a monoclonal cell strain secreting RV1 is preferably used as a monoclonal cell strain for detecting rabies virus glycoprotein antigen by a pairing test.
7) Expression and purification of specific monoclonal antibodies: rabies virus specific monoclonal antibody RV1 isolated and purified from the culture broth of hybridoma cell strain RV1 or ascites of inoculated animals.
8) The above-mentioned immunized animal for preparing monoclonal antibody can be mammal such as mouse, rat, rabbit, goat, sheep, pig, etc., preferably mouse.
The detection program of the kit of the invention is as follows:
1) balancing: taking out the kit from the refrigeration environment, and standing at room temperature for balancing for 30min for later use; the liquid reagents were mixed well before use.
2) Preparing liquid: diluting the concentrated washing solution by 20 times of distilled water or deionized water to obtain a washing buffer solution;
3) sample dilution: the antigen standard substance is serially diluted by 1: 20-1: 1280 times by using a sample diluent, the corresponding antigen concentrations are respectively 200mIU, 100mIU, 50mIU, 25mIU, 12.5mIU and 6.2mIU, and a sample to be detected is also subjected to 4-8 gradient dilution by using the sample diluent.
4) Sample adding: and taking out the required laths, filling the rest laths into an aluminum foil bag, sealing, and storing at 2-8 ℃ for later use. And adding the diluted sample to be detected and the serially diluted antigen standard into a coated plate, setting 1 hole as negative quality control at 100 mu l/hole, and only adding the sample diluent. The time span of the sample application process should be as short as possible. Loading as shown in figure 1: S1-S6: diluting an antigen standard substance at a 1: 20-1: 640-fold ratio, wherein N: indicating a negative quality control hole, and only adding a sample diluent; t1: indicating the addition of each sample to be tested.
5) And (3) incubation: shaking and mixing evenly, placing in an incubator at 37 ℃ and reacting for 30 min.
6) Washing the plate: discarding the reaction solution, adding 300 μ l of diluted washing buffer solution into each well, soaking for 15s, throwing away the washing solution, continuously washing the plate for 4 times, and then drying by beating.
7) Adding an enzyme: add 100. mu.l of enzyme-labeled antibody to each well.
8) And (3) incubation: the reaction mixture was placed in an incubator at 37 ℃ and reacted for 30 min.
9) Washing the plate: discarding the reaction solution, adding 300 mu l of diluted washing buffer solution into each hole, soaking for 15s, throwing away the washing solution, continuously washing the plate for 4 times, and then drying by beating.
10) Adding 100 μ l of substrate working solution (substrate working solution is obtained by mixing substrate solution A and substrate solution B in equal amount, and is prepared at present), shaking, mixing, placing in 37 deg.C incubator, and reacting for 15min in dark.
11) 50. mu.l of chromogenic stop solution was added to each well, and the reaction was stopped by shaking and mixing.
12) Determination of OD per well450nmValue (reaction plate with stop solution should read OD within 15min450nmValue).
13) And (4) analyzing results: antigen Standard (200mIU) well OD450nmThe value should be more than or equal to 1.5, otherwise, the value is invalid; negative quality control hole OD450nmThe value should be less than or equal to 0.15, otherwise invalid; and (3) calculating the concentration: OD of each well according to antigen standard450nmAnd drawing a standard curve according to the values, and calculating the content of the rabies viruses in each sample to be detected.
In the detection method, the sample to be detected can be selected variously, and can be culture solution, inactivation solution, purification solution, concentrated solution, finished vaccine after demulsification and the like in the vaccine production process.
The result analysis method in step 13) may be: detecting each dilution OD of the well by using antigen standard450nmValue and negative quality control well OD450nmValues as X-axis, protein concentration as Y-axis, using EXCEL program → "Inserting "→" scatter plot ", selecting" scatter plot with smooth line and data mark "→" trend line "→" selecting "polynomial" → "display formula" and "display R square value". In general R2A value of 0.98 or more indicates that the standard curve is authentic (where points with too high or too low an OD should be discarded). Each 96-well plate should be set with a set of standards and plotted with the corresponding standard curve. Sample well OD according to polynomial equation450nmAnd carrying out value substitution calculation to obtain the antigen concentration in the sample.
The invention has the positive effects that: the enzyme-linked immunoassay kit for quantitative detection of rabies viruses provided by the invention has the advantages of high sensitivity, good specificity and convenience in operation, and can be used for stably detecting the content of rabies virus glycoprotein antigens. The kit is a double-antibody sandwich enzyme-linked immunosorbent quantitative detection kit prepared from a specific monoclonal antibody RV1 of the rabies virus, and can quantitatively detect the content of rabies virus glycoprotein antigen in a sample by detecting signal change generated by an enzyme catalysis substrate.
In conclusion, the double-antibody sandwich enzyme-linked immunosorbent assay quantitative detection kit prepared by adopting the specific monoclonal antibody of the rabies virus has high sensitivity and strong specificity, and can effectively distinguish and detect the content of the rabies virus glycoprotein antigen in a sample. Meanwhile, the operation method can complete the detection of at most 88 samples except the antigen standard and the negative quality control hole within 1.5 hours, greatly shortens the detection period, does not need an expensive ultracentrifuge, provides a more convenient and effective method for the quality control in the vaccine production, and has wide market prospect and good economic and social benefits.
Drawings
FIG. 1 is a schematic view of the loading of an enzyme-linked immunosorbent assay plate of the kit of the invention.
Detailed Description
The methods in the following examples are conventional methods unless otherwise specified.
The various biological materials described in the examples are obtained by way of experimental acquisition for the purposes of this disclosure and should not be construed as limiting the source of the biological material of the invention. In fact, the sources of the biomaterials used are wide and any biomaterials available without violating laws and ethical ethics can be used instead as suggested in the examples.
The embodiments are provided in order to provide detailed embodiments and specific procedures, which will help understanding of the present invention, but the scope of the present invention is not limited to the following embodiments.
Example 1 screening of hybridoma cell lines specific for rabies virus monoclonal antibody
The method comprises the following steps:
1) obtaining rabies virus inactivated antigen (provided by Jiangxi biological pharmaceutical factory of China animal husbandry GmbH) by using a hollow fiber method, wherein the purity is more than or equal to 80 percent, and the rabies virus inactivated antigen is used as immunogen;
2) the immune animal is BALB/c mouse (purchased from Beijing Wittingle laboratory animal technology Co., Ltd.), the continuous immunization is carried out for 4 times, each time is 14 days, the multipoint subcutaneous immunization mode is adopted for the first 3 times, the intraperitoneal injection immunization mode is adopted for the 4 th time, and each mouse is injected with 1mg antigen;
3) 7 days after the last immunization, separating serum from tail blood of the mouse, detecting by indirect ELISA (enzyme-linked immunosorbent assay), when the titer is more than 1:50000, separating splenocytes of the immunized animal, fusing the splenocytes with myeloma cells SP2/0 with good growth state, and screening by using HAT selective culture medium to obtain hybridoma cells;
4) screening specific positive clones from the hybridoma cell supernatant by an indirect ELISA method to finally obtain 3 specific positive clones; the method comprises the following specific operation steps: dissolving rabies virus inactivated antigen in a carbonate solution with the pH value of 9.6 to dilute the solution to the concentration of 2 mug/ml, adding the diluted solution into a 96-hole polystyrene enzyme-linked reaction plate, placing the plate at the temperature of 2-8 ℃ for 8-12 hours with 100 mug/l of each hole to enable the specific monoclonal antibody to be fully combined with the enzyme-linked reaction plate, then adding PBS buffer solution containing 10mg/ml bovine serum albumin (pH7.4) into the plate according to 300 mug/l of each hole, sealing the plate at the temperature of 37 ℃ for 2-3 hours, drying the plate, sealing the plate with aluminum foil paper after the plate is dried, and storing the plate at the temperature of 2-8 ℃ for later use.
Taking cell culture supernatantAdding the mixture into an enzyme label plate coated with virus antigen, reacting for 30 minutes at 37 ℃, washing the plate for 4 times by using a washing solution (0.01M phosphate buffer solution containing Tween-20 with the concentration of 0.8-1.2% (ml/ml) and the pH value of 7.4, diluting 20 times by using double distilled water when in use), beating to dry, adding a rabbit anti-mouse IgG-HRP marker (purchased from Sigma company in America) diluted by 1:5000 into each hole, reacting for 30 minutes at 37 ℃, using the washing solution for 4 times, beating to dry, adding 50 mu l of each substrate working solution of a substrate solution A (citrate phosphate buffer solution containing 0.6mg/ml of urea hydrogen peroxide) and a substrate solution B (tetramethylbenzidine solution containing 0.2 mg/ml) into each hole, and reacting for 15 minutes at 37 ℃ in a dark place. Mu.l of stop solution (2mol/L sulfuric acid solution) was added to each well, and the reaction was terminated by shaking and mixing. OD per well was measured within 15 minutes450nmThe value is obtained. And (3) determining the titer of the specific monoclonal antibody in the cell culture supernatant by taking the absorbance value of more than negative control (namely plate washing culture solution) multiplied by 2.1 times as a positive determination standard, simultaneously determining whether the monoclonal antibody plate washing strain has cross reaction with other viruses, finally obtaining 2 specific cell clones which only have strong signal reaction with rabies viruses but do not react with the negative control, and respectively numbering the 2 strains as RV1 and RV 2.
Example 2 pairing test of rabies virus monoclonal purified antibody
1) Preparation of coated plate by using specific monoclonal antibody of rabies virus
Diluting the purified specific monoclonal antibody into coating working solution of 0.5 mu g/ml, 1 mu g/ml, 2 mu g/ml and 4 mu g/ml by using carbonate solution with pH 9.6, then adding the coating working solution into a 96-hole polystyrene enzyme-linked reaction plate, placing the plate at 100 mu l/hole for 8-12 hours at 2-8 ℃ to ensure that the specific monoclonal antibody is fully combined with the enzyme-linked reaction plate, then adding PBS buffer solution containing 10mg/ml bovine serum albumin with pH7.4 into the plate according to 300 mu l/hole, sealing the plate at 37 ℃ for 2-3 hours, drying the plate, and sealing and storing the plate at 2-8 ℃ after the plate is dried.
2) Preparation of rabies virus specific monoclonal antibody marked by horseradish peroxidase
Coupling rabies virus specific monoclonal antibody with Horse Radish Peroxidase (HRP) by glutaraldehyde oxidation, dialyzing with PBS buffer solution of pH7.4, adding equal amount of high quality glycerol, and storing at-20 deg.C or below. The method comprises the following specific steps:
dissolving 5mg of HRP in 0.2ml of PBS (phosphate buffer solution) containing 1.25% of glutaraldehyde and having the pH value of 6.8 of 0.1mol/L, placing the solution at room temperature for coupling for 18 hours, and fully dialyzing to remove redundant glutaraldehyde;
adding physiological saline to 1ml, then adding 2.5mg of the specific monoclonal antibody of the purified rabies virus and 0.1ml of 1mol/L carbonate buffer solution with the pH value of 9.6, and placing for 24 hours at the temperature of 2-8 ℃;
③ adding 0.1ml of 0.3mol/L lysine solution, and standing for 2 hours at room temperature;
and fourthly, fully dialyzing by using PBS buffer solution with the pH value of 7.4, and removing the precipitate through centrifugation to obtain the supernatant which is the enzyme conjugate. Diluting with enzyme marker diluent according to a certain proportion (1:1000, 1:2000 and 1:4000 times dilution) to obtain the working solution of the enzyme marker.
3) The pairing test between 2 specific antibodies was determined using a checkerboard titration method.
Adding an antigen: diluting the antigen with sample diluent, wherein one part has a concentration of 100mIU, the other part has a concentration of 10mIU, and the reaction is carried out at the temperature of 37 ℃ for 30 minutes;
adding enzyme labeled single antibody: after washing the plate for 4 times continuously, adding enzyme-labeled monoclonal antibodies (RV1, RV2) and reacting for 30 minutes at 37 ℃;
③ developing color: continuously washing the plate for 4 times, adding 100 μ l of substrate working solution (substrate working solution is obtained by mixing substrate solution A and substrate solution B in equal amount, and is prepared in situ), shaking, mixing, placing in 37 deg.C incubator, and reacting in dark place for 15 min;
reading: 50. mu.l of chromogenic stop solution was added to each well, and the reaction was stopped by shaking and mixing. Determination of OD per well450nmThe value is obtained. OD with 100mIU sample450nmValue (A) divided by OD of 10mIU sample450nmThe larger the value (B), the larger the A/B value, the higher the detection sensitivity of the paired monoclonal antibody, and the results are shown in Table 1-Table 3, therefore, preferably RV1 is used as the capture antibody and the detection antibody for detection at the same time, RV1 can be selected as the capture antibody at 1. mu.g/ml, and RV1 can be selected as the detection antibody at 1:2000 dilution.
TABLE 1 results of the pairing test with RV1 as capture antibody (A/B values)
Figure BDA0002646099300000091
TABLE 2 results of the pairing test with RV2 as capture antibody (A/B values)
Figure BDA0002646099300000092
Example 3 subculture and preservation of rabies virus monoclonal antibody
The subculturing of the hybridoma cells comprises the following steps:
1) culturing and passaging the hybridoma RV1 in DMEM medium (containing 100U/ml penicillin and 100. mu.g/ml streptomycin) containing 10% fetal bovine serum;
2) after the 10 th generation of culture, the hybridoma cell strain can still grow well and stably passage, and the titer in the supernatant can still reach more than 1:50, and the result shows that the hybridoma cell strain which can stably passage and can sustainably and stably secrete the anti-rabies virus monoclonal antibody is obtained.
Preservation of hybridoma cells comprises the steps of: in the subculture of hybridoma cells, since mutation may occur during serial passage and the ability to secrete monoclonal antibodies may be lost, and in addition, in order to prevent contamination that may occur during culture, a part of hybridoma cells must be preserved;
1) removing the culture solution in the cell culture dish, and adding DMEM culture medium containing 10% fetal calf serum to suspend cells;
2) centrifugation is carried out at 1000r/min for 10 minutes, the supernatant is discarded, and the cell pellet is frozen in a cell freezing medium (dimethyl sulfoxide: fetal bovine serum: DMEM 1:3:6) suspension cells at 5 × 10 concentration5Cells/ml;
3) the cell counting is carried out by trypan blue, and the survival rate is more than 95%;
4) aseptically packaging the cells into cryopreservation tubes, standing at 1 ml/tube at 4 deg.C for 2 hr, standing at-20 deg.C for 2 hr, standing overnight at-80 deg.C, and transferring into liquid nitrogen for long-term storage.
The hybridoma cell strain prepared by the method can continuously and stably secrete the rabies virus specific monoclonal antibody is named as RV 1.
Example 4 preparation of rabies virus-specific monoclonal antibody
1) The mass preparation of monoclonal antibodies using animals: selecting adult BALB/c mouse, inoculating abdominal cavity with immunosuppressor to cause reduction of value alkane in inflammatory reaction, 0.5 ml/mouse;
2) inoculating hybridoma RV1, 2 multiplied by 10 days later into abdominal cavity6～3×106One mouse/mouse. After 5 days, ascites can be collected by using a No. 9 needle when the abdomen is obviously enlarged and the skin is tense;
3) the ascites fluid was centrifuged (10,000r/min, 30 minutes) to remove cell components and other precipitates, and the supernatant was collected;
4) diluting the supernatant with 15-30 times volume of PBS buffer solution (pH7.4), purifying with Protein A affinity chromatography column, and purifying with Na3PO4And (3) balancing the ProteinA prepacked column by using a solution with the pH value of 7.0, balancing the volume of 3-5 columns, then combining the supernatant with the ProteinA prepacked column, and eluting with an eluent with the pH value of 3.0 of Glycine-HCL after the sample is combined to obtain the purified RV 1.
Example 5 Gene sequencing of rabies Virus-specific hybridoma cell lines, establishment of monoclonal antibody recombinant expression System, and purification of monoclonal antibody
The method comprises the following steps:
1) extracting total RNA of a specific positive clone hybridoma cell strain, performing reverse transcription, performing PCR (polymerase chain reaction) and performing sequence determination:
extracting total RNA: taking 250 ul of hybridoma cell suspension, adding 750 ul of Trizol, turning upside down and mixing, adding 200 ul of chloroform, mixing, and centrifuging at 12000rpm at 4 ℃ for 15 min. The supernatant was pipetted into a new 1.5ml EP tube, 600. mu.l of isopropanol was added, mixed well and centrifuged for 10 min. The isopropanol was discarded, washed with 75% DEPC ethanol and centrifuged. The ethanol was discarded, oven dried and the RNA was dissolved in 20. mu.l of RNase-free water.
Reverse transcription: reverse transcription was performed using the Invitrogen reverse transcription kit as per the instructions to obtain cDNA for hybridoma cells.
PCR reaction and cloning and sequencing of products thereof: universal primers were designed for the heavy and light chain variable regions with the following sequence information:
TABLE 3 Universal primers for heavy and light chain variable regions
Name (R) Sequence (5 '-3')
VH-1 (Forward) GTGAATTCATGCAGGTGCAGCTGTTGGAGTCTGG
VH-2 (reverse) ATGTCGACTGAGGAGACGGTGACCAGGGTGCC
VL-1 (Forward) GTGAATTCATGGACATTGTGATGACCCAGTCTCC
VL-2 (reverse) CAGTCGACTTACGTTTGATCTCCAGCTTGGTCCC
And amplifying the target fragment by using an amplification primer, recovering the fragment after amplification, and then connecting a vector for sequence determination to obtain sequence information of heavy chain and light chain variable regions of the monoclonal antibody.
2) Synthesis of gene sequence of specific monoclonal antibody and establishment of recombinant expression system
Synthesis of gene sequence: according to the determined sequences of the heavy chain and light chain variable regions of the monoclonal antibody RV1, the sequences of the heavy chain and light chain constant regions of the murine antibody are supplemented in the variable region part, then the murine antibody is sent to Shanghai Czeri bioengineering company Limited to synthesize the gene sequence, and insect cell codon optimization is carried out, wherein the nucleotide sequence of the RV1 heavy chain is shown as SEQ ID No.3 (the full-length sequence is the coding sequence) in the sequence table, and the nucleotide sequence of the light chain is shown as SEQ ID No.4 (the full-length sequence is the coding sequence) in the sequence table.
Constructing a shuttle vector: based on the sequence information of the heavy chain and the light chain and the sequence information of a pFastBacDual (purchased from Thermo Fisher company, Cat. 10712024) vector, corresponding primers (the sequence is shown in the following table 2) are designed, fragments of the full length of the heavy chain and the light chain are amplified, and the fragments are connected into the pFastBacDual vector through a homologous recombination method after the recovery of glue, wherein the pFastBacDual vector contains two promoters, namely a PH promoter and a P10 promoter, and contains GP67 signal peptide sequence information behind the PH promoter sequence, and HDM signal peptide sequence information behind the P10 promoter sequence, and the sequence accuracy is ensured through sequencing after the sequence information is connected into the vector.
TABLE 4 expression vector construction primer sequence information
Name (R) Sequence (5 '-3')
RV1-HF TCATACATCTACGCGGCCGCTAGCGACGTGCAGTTGCAG
RV1-HR TCCCCCATCTCCCGGTACCCTTTCCGGGGGA
RV1-LF CTGCCTTTGCGGCGGATGAATTCGACATCGTGATGACCCAGA
RV1-LR CTAGTACTTCTCGACAAGCTTGGAGCACTCGGTTGGA
Screening and extracting recombined Bacmid: transforming DH10Bac competence by the constructed shuttle vector, coating a three-resistance plate (kanamycin, gentamicin and tetracycline), culturing for 48h at 37 ℃ in an incubator, picking out white spots, identifying by using an M13 primer, selecting clone shake bacteria completely without 300bp bands, extracting Bacmid by using an isopropanol precipitation method after 12h, and then determining the concentration by using Nanodrop.
Rescue of recombinant baculovirus: density was 2X 10 before transfection6And (2) spreading SF9 cells on a six-hole plate, transfecting recombinant Bacmid according to the amount of 5 mu g and 2.5 mu g, wherein the using amount of a transfection reagent is 8 mu l, changing the liquid after 4-6 h of transfection, culturing at 28 ℃, harvesting and amplifying P2 generation virus after 72h, and amplifying the P3 generation virus by adopting the same method. The amplification of the P4 generation virus adopts shake flask amplification, and the inoculation ratio of the virus is 1: 100.
3) expression and purification of specific monoclonal antibodies: inoculating the P4 generation virus at a ratio of 1:5 with a density of 2 × 106Hi5 cells, cultured at 28 ℃, harvested after 48h, centrifuged at 8000r/min for 1h to obtain the supernatant, and then filtered through a 0.22 μm filter for later use. With Na3PO4And (3) balancing the ProteinA prepacked column by using a solution with the pH value of 7.0, balancing the volume of 3-5 columns, then combining the cell supernatant with the ProteinA prepacked column, and eluting with an eluent with the pH value of 3.0 of Glycine-HCL after the sample is combined, thus obtaining the purified rabies virus G protein specific monoclonal antibody RV 1. OD measurement with UV spectrophotometer280nmValue using the OD280nmThe value divided by an empirical factor of 1.48 is the concentration of the monoclonal antibody in mg/ml. The results showed that RV1 secreted a monoclonal antibody concentration of 1.26 mg/ml.
Example 6 preparation of rabies Virus glycoprotein antigen quantitative determination ELISA kit
1) Preparation of antigen coated plate by using rabies virus specific monoclonal antibody
Diluting the purified specific monoclonal antibody obtained in the example 5 by using a carbonate solution with pH 9.6 to obtain 1 mu g/ml coating working solution, adding the diluted coating working solution to a 96-hole polystyrene enzyme-linked reaction plate, placing the solution at 100 mu l/hole for 8 to 12 hours at the temperature of 2 to 8 ℃ to ensure that the specific monoclonal antibody is fully combined with the enzyme-linked reaction plate, adding a PBS (phosphate buffer solution) containing 10mg/ml bovine serum albumin (pH7.4) into the solution at 300 mu l/hole, sealing the solution at 37 ℃ for 2 to 3 hours, drying the solution, and sealing and storing the dried enzyme-linked reaction plate at the temperature of 2 to 8 ℃.
2) Preparation of rabies virus specific monoclonal antibody marked by horseradish peroxidase
The rabies virus-specific monoclonal antibody prepared in example 5 was coupled with horseradish peroxidase (HRP) by glutaraldehyde oxidation, dialyzed thoroughly against PBS buffer solution of pH7.4, added with an equal amount of high-quality glycerol, and stored at-20 ℃ or below. The method comprises the following specific steps:
dissolving 5mg of HRP in 0.2ml of PBS (phosphate buffer solution) containing 1.25% of glutaraldehyde and having the pH value of 6.8 of 0.1mol/L, placing the solution at room temperature for coupling for 18 hours, and fully dialyzing to remove redundant glutaraldehyde;
adding physiological saline to 1ml, then adding 2.5mg of the specific monoclonal antibody of the purified rabies virus and 0.1ml of 1mol/L carbonate buffer solution with the pH value of 9.6, and placing for 24 hours at the temperature of 2-8 ℃;
③ adding 0.1ml of 0.3mol/L lysine solution, and standing for 2 hours at room temperature;
and fourthly, fully dialyzing by using PBS buffer solution with the pH value of 7.4, and removing the precipitate through centrifugation to obtain the supernatant which is the enzyme conjugate. Diluting the solution with an enzyme marker diluent according to a certain proportion to obtain the working solution of the enzyme marker.
3) Preparation of rabies virus glycoprotein antigen standard
In order to facilitate result analysis, the kit further comprises a rabies virus glycoprotein antigen standard, specifically can be rabies virus glycoprotein antigen purified liquid produced by a rabies virus vaccine factory, the purity is not lower than 80%, the antigen content is 4IU, the rabies virus glycoprotein antigen purified liquid is packaged into 1.0 ml/tube, when the kit is used, the rabies virus glycoprotein antigen purified liquid is diluted by a sample diluent (1: 20-1: 640), a label is pasted, and the rabies virus glycoprotein antigen purified liquid is stored at the temperature of below 20 ℃ below zero for later use.
4) The sample dilutions were prepared as 1 vial (24 ml/vial) of 0.01M, pH value 7.4 phosphate buffer containing 5mg/ml casein.
5) Substrate solution A was prepared as citrate phosphate buffer containing 0.6mg/ml urea hydrogen peroxide (1 vial, 12 ml/vial)
6) Substrate solution B was prepared as a 0.2mg/ml solution of Tetramethylbenzidine (TMB) (1 vial, 12 ml/vial).
7) The 20-fold concentrated washing solution was prepared as 0.01M phosphate buffer (50 ml/vial, 2 vials) containing Tween-20 at a concentration of 0.8% to 1.2% (ml/ml) and a pH of 7.4.
8) Preparation of stop solution A2 mol/L sulfuric acid solution (1 vial, 12 ml/vial) was prepared.
9) If necessary, the kit may also contain a sample dilution plate (2, 96 wells/block) for sample dilution.
Example 7 application method of rabies virus glycoprotein antigen quantitative detection ELISA kit
1) Balancing: taking out the kit from the refrigeration environment, and standing at room temperature for balancing for 30min for later use; the liquid reagents were mixed well before use.
2) Preparing liquid: diluting the concentrated washing solution by 20 times of distilled water or deionized water to obtain a washing buffer solution;
3) sample dilution: the antigen standard substance is serially diluted by 1: 20-1: 640 times by using a sample diluent, the corresponding antigen concentrations are respectively 200mIU, 100mIU, 50mIU, 25mIU, 12.5mIU and 6.2mIU, and a sample to be detected is also subjected to 4-8 gradient dilution by using the sample diluent.
4) Sample adding: and taking out the required laths, filling the rest laths into an aluminum foil bag, sealing, and storing at 2-8 ℃ for later use. And adding the diluted sample to be detected and the serially diluted antigen standard into a coated plate, setting 1 hole as negative quality control at 100 mu l/hole, and only adding the sample diluent. The time span of the sample application process should be as short as possible. As shown in fig. 1, the sample application: S1-S6: diluting an antigen standard substance at a 1: 20-1: 640-fold ratio, wherein N: indicating a negative quality control hole, and only adding a sample diluent; t1: indicating the addition of each sample to be tested.
5) And (3) incubation: shaking and mixing evenly, placing in an incubator at 37 ℃ and reacting for 30 min.
6) Washing the plate: discarding the reaction solution, adding 300 μ l of diluted washing buffer solution into each well, soaking for 15s, throwing away the washing solution, continuously washing the plate for 4 times, and then drying by beating.
7) Adding an enzyme: add 100. mu.l of enzyme-labeled antibody to each well.
8) And (3) incubation: the reaction mixture was placed in an incubator at 37 ℃ and reacted for 30 min.
9) Washing the plate: discarding the reaction solution, adding 300 mu l of diluted washing buffer solution into each hole, soaking for 15s, throwing away the washing solution, continuously washing the plate for 4 times, and then drying by beating.
10) Adding 100 μ l of substrate working solution (substrate working solution is obtained by mixing substrate solution A and substrate solution B in equal amount, and is prepared at present), shaking, mixing, placing in 37 deg.C incubator, and reacting for 15min in dark.
11) 50. mu.l of chromogenic stop solution was added to each well, and the reaction was stopped by shaking and mixing.
12) Determination of OD per well450nmValue (reaction plate with stop solution should read OD within 15min450nmValue).
13) And (4) analyzing results: antigen Standard (200mIU) well OD450nmThe value should be more than or equal to 1.5, otherwise, the value is invalid; negative quality control hole OD450nmThe value should be less than or equal to 0.15, otherwise invalid; and (3) calculating the concentration: OD of each well according to antigen standard450nmAnd drawing a standard curve according to the values, and calculating the content of the rabies viruses in each sample to be detected.
In the detection method, the sample to be detected can be selected variously, and can be culture solution, inactivation solution, purification solution, concentrated solution, finished vaccine after demulsification and the like in the vaccine production process.
The result analysis method in step 13) may be: detecting each dilution OD of the well by using antigen standard450nmValue and negative quality control well OD450nmThe values were taken as the X-axis, the protein concentration was taken as the Y-axis, and an EXCEL program was used, → "insert" → "scatter plot", and "scatter plot with smooth line and data mark" → "trend line" → selection of "polynomial" → "display formula" and "display R square value". In general R2The value of more than or equal to 0.98 shows that the standard curve is credible(where points with too high or too low an OD should be discarded). Each 96-well plate should be set with a set of standards and plotted with the corresponding standard curve. Sample well OD according to polynomial equation450nmAnd carrying out value substitution calculation to obtain the antigen concentration in the sample.
The detection process takes about 1.5 hours, and up to 88 samples can be detected in one experiment.
Example 8 sensitivity test
3 batches of the kit are selected, 100 mu l/hole of the sample diluent is used, 8 holes are repeated, the kit of the embodiment 6 and the detection method of the embodiment 7 are used for detection, the average value (X) +3 multiplied by the Standard Deviation (SD) is calculated to be the detection sensitivity of the kit, and the maximum value is taken as the sensitivity of the kit.
TABLE 5 sensitivity test
Kit lot Mean value (X) Standard Deviation (SD) X+3SD
1 0.75 0.38 1.89
2 1.59 0.46 2.97
3 1.61 0.49 3.08
The results of 3 replicates (Table 4) showed that the sensitivity of the kit was 3.08mIU, but less than this sensitivity could be detected with the kit.
Example 9 specificity test
BHK21 cell host protein, canine parvovirus antigen, canine distemper antigen, canine adenovirus antigen and canine parainfluenza antigen are selected, diluted by sample diluent in the kit, and detected according to the kit of embodiment 6 and the detection method of embodiment 7, and negative quality control holes are arranged (only the sample diluent is added), and the detection result shows that the kit has no non-specific reaction to the pathogens, and the specificity is 100%.
Example 10 comparison of the kit of the invention and the detection method thereof with the NIH method of mice
In order to verify the accuracy and convenience of the detection result of the invention, a comparative test is carried out with a mouse NIH method. The patent kit and the mouse NIH method are used for simultaneously detecting 3 rabies PV strain samples. The detection results are shown in table 6, and the coincidence rate of the two detection methods is high.
TABLE 6 comparative test results of the present kit and the NIH method for mice
Figure BDA0002646099300000151
Figure BDA0002646099300000161
Meanwhile, in the aspect of operation convenience, the whole operation of the kit only needs 1.5 hours, 88 samples can be detected at most, and the detection time of the rabies vaccine can be shortened from 28 days to 1.5 hours, so that the detection time of the vaccine is shortened, the production and sale efficiency of the vaccine is improved, and the NIH animal method is finally replaced.
<110> Zhongmu industries GmbH
<120> enzyme linked immunosorbent assay kit for detecting rabies virus glycoprotein antigen and application thereof
<130> WHOI201056
<170> Patent-In 3.5
<160> 4
<210> 1
<211> 116
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Asp Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Ser Leu Ser Leu Thr Cys Ser Val Thr Gly Tyr Ser Ile Thr Ser Lys
20 25 30
Tyr Asn Trp Trp Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp
35 40 45
Met Gly Tyr Ile Tyr Tyr Asp Gly Ser Tyr Asn Tyr Pro Pro Ser Leu
50 55 60
Lys Asn Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe
65 70 75 80
Leu Asn Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys
85 90 95
Ala Arg Gly Gly Ser Ser Arg Thr Asn Trp Gly Gln Gly Thr Thr Leu
100 105 110
Thr Val Ser Ser
115
<210> 2
<211> 113
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ala Met Ser Val Gly
1 5 10 15
Gln Lys Val Thr Met Ser Cys Asn Tyr Ser Gln Ser Leu Leu Tyr Ser
20 25 30
Ser Asn Gln Lys Tyr Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Ser Pro Lys Leu Leu Val Tyr Phe Ala Ser Gly Gly Glu Ser Gly Val
50 55 60
Pro Asp Arg Phe Ile Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
65 70 75 80
Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Asp Tyr Phe Cys Asn Thr
85 90 95
His Tyr Ser Thr Gly Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu
100 105 110
Lys
<210> 3
<211> 1023
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gacgtgcagt tgcaggagtc cggtcccgga ttggtgaagc catcccagtc cttgtccttg 60
acctgctccg tgactggcta ctccatcacc tccaagtaca actggtggtg gatcaggcag 120
ttccccggaa acaagttgga gtggatggga tacatctact acgacggtag ctacaactac 180
cctcctagct tgaagaaccg tatctccatc acccgcgaca ccagcaagaa ccagttcttc 240
ctcaacttga acagcgtgac caccgaggac accgctacct actactgcgc tcgcggcggt 300
agcagccgta ccaactgggg acagggaacc accttgaccg tcagctccac ccacacctgc 360
cctccatgcc ccgccccaga gttgctcggc ggcccatccg tcttcctgtt ccctccaaag 420
cctaaggaca ccctcatgat cagccgtacc ccagaggtca cctgcgtcgt cgtcgatgtg 480
tcccacgagg accctgaggt caagttcaac tggtacgtgg acggtgtgga ggtgcacaac 540
gctaagacca agcctagaga ggagcagtac aacagcacct acagagtcgt gagcgtgctg 600
accgtgttgc accaggactg gctgaacgga aaggagtaca agtgcaaggt gagcaacaag 660
gctttgcccg ccccaatcga gaaaaccatc agcaaggcta agggtcagcc acgcgagcca 720
caggtgtaca ccttgcctcc tagccgcgac gagttgacca agaaccaggt ttccctcacc 780
tgcctcgtga agggtttcta ccctagcgac atcgctgtcg agtgggagag caacggccag 840
cctgagaaca actacaagac cacccctcct gtgctcgact ccgacgggtc gttcttcttg 900
tactccaagc tgaccgtaga taagtccaga tggcagcagg gtaacgtctt ctcttgtagc 960
gtcatgcacg aggctttgca caaccactac acccagaaga gcttgagctt gtcccccgga 1020
aag 1023
<210> 4
<211> 642
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gacatcgtga tgacccagag cccatccagc ttggctatgt ccgtcggaca gaaggtcacc 60
atgtcctgca actactccca gtccctgttg tacagctcca accagaagta ctacctcgcc 120
tggtatcagc agaagccagg tcagtcccca aagttgctcg tgtacttcgc ctcgggtgga 180
gagagcggtg tgcccgacag attcatcggt tccggcagcg gaaccgactt caccttgacc 240
atcagcagcg tgcaggctga ggacctcgcc gactacttct gcaacaccca ctacagcacc 300
ggattgacct tcggcgctgg aaccaagctg gagttgaagg cccctagcgt caccttgttc 360
cctcctagct ccgaggagtt gcaggctaac aaggctacct tggtctgcct gatcagcgac 420
ttctaccccg gcgctgtgac cgtggcttgg aaggccgact ccagccctgt caaggccggc 480
gtcgagacca ccacccctag caagcagtcc aacaacaagt acgccgcttc ctcctacttg 540
agcctcaccc ctgagcagtg gaagagccac agatcctaca gctgccaggt gacccacgag 600
ggtagcaccg tcgaaaaaac cgtcgctcca accgagtgct cc 642

Claims (10)

1. An enzyme linked immunosorbent assay kit for specifically and quantitatively detecting rabies virus glycoprotein antigen comprises an enzyme linked immunosorbent assay plate coated by a capture antibody and an enzyme labeled detection antibody; the monoclonal antibody specifically combined with the rabies virus glycoprotein antigen contains a heavy chain variable region RV1-VHAnd light chain variable region RV1-VL(ii) a The RV1-VHAnd RV1-VLBoth consist of a determinant complementary region and a framework region; the RV1-VHAnd said RV1-VLEach of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the RV1-VHThe amino acid sequence of the CDR1 is shown as amino acids 31-36 of SEQ ID No. 1; the RV1-VHThe amino acid sequence of the CDR2 is shown as amino acids 51-66 of SEQ ID No. 1; the RV1-VHThe amino acid sequence of the CDR3 is shown as the 99 th to 105 th amino acids of SEQ ID No. 1; the RV1-VLThe amino acid sequence of CDR1 is as shown in SEQ ID No.2Amino acids at positions 24-40; the RV1-VLThe amino acid sequence of the CDR2 is shown as amino acids 56 to 62 of SEQ ID No. 2; the RV1-VLThe amino acid sequence of CDR3 is shown as amino acids 95-103 of SEQ ID No. 2.
2. The ELISA kit of claim 1, wherein: the RV1-VHThe amino acid sequence of (A) is shown as 1 st to 116 th sites of SEQ ID No.1 in a sequence table; RV1-V thereofLThe amino acid sequence of (A) is shown as 1 st to 113 th sites of SEQ ID No.2 in the sequence table.
3. The ELISA kit of claim 1, wherein: the kit also comprises an antigen standard substance, wherein the antigen standard substance is a rabies virus glycoprotein antigen.
4. The ELISA kit of claim 1, wherein: the acquisition method of the enzyme-linked reaction plate comprises the steps of dissolving the capture antibody in a carbonate solution with the pH value of 9.6, adding the solution into a 96-hole polystyrene enzyme-linked reaction plate, placing the solution at the temperature of 2-8 ℃ for 8-12 hours with 50 ng-1000 ng of the capture antibody per hole to enable the capture antibody to be fully combined with the enzyme-linked reaction plate, adding PBS buffer solution containing 10mg/ml bovine serum albumin (pH7.4) into the solution according to 300 mu l/hole, sealing the solution at the temperature of 37 ℃ for 2-3 hours, drying the solution, and sealing and storing the enzyme-linked reaction plate at the temperature of 4 ℃ after the enzyme-linked reaction plate is dried.
5. The enzyme-linked immunoassay kit of claim 1, characterized in that: the kit also comprises a substrate solution A, a substrate solution B and a stop solution; the substrate solution A is a citrate phosphate buffer solution containing 0.6mg/ml of urea hydrogen peroxide, the substrate solution B is a tetramethylbenzidine solution containing 0.2mg/ml, and the substrate solution A and the substrate solution B are mixed in a ratio of 1:1 when in use; the stop solution is a 2mol/L sulfuric acid solution.
6. The kit of claim 1, wherein: the kit also comprises a sample diluent and a 20-time concentrated washing solution; the sample diluent was phosphate buffer containing 5mg/ml casein with a value of 0.01M, pH of 7.4; the 20-fold concentrated washing solution is 0.01M phosphate buffer solution with pH value of 7.4 and contains 0.8-1.2% Tween-20.
7. Use of the enzyme linked immunosorbent kit of any one of claims 1-6 for specific quantitative detection of rabies virus glycoprotein antigen.
8. The use of claim 7, wherein the sample to be tested is a culture solution, an inactivated solution, a purified solution, a concentrated solution or a finished vaccine after emulsion breaking in the vaccine production process.
9. Monoclonal antibody specifically binding to rabies virus glycoprotein antigen and containing heavy chain variable region RV1-VHAnd light chain variable region RV1-VL(ii) a The RV1-VHAnd RV1-VLBoth consist of a determinant complementary region and a framework region; the RV1-VHAnd said RV1-VLEach of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the RV1-VHThe amino acid sequence of the CDR1 is shown as amino acids 31-36 of SEQ ID No. 1; the RV1-VHThe amino acid sequence of the CDR2 is shown as amino acids 51-66 of SEQ ID No. 1; the RV1-VHThe amino acid sequence of the CDR3 is shown as the 99 th to 105 th amino acids of SEQ ID No. 1; the RV1-VLThe amino acid sequence of the CDR1 is shown as amino acids 24-40 of SEQ ID No. 2; the RV1-VLThe amino acid sequence of the CDR2 is shown as amino acids 56 to 62 of SEQ ID No. 2; the RV1-VLThe amino acid sequence of the CDR3 is shown as amino acids 95-103 of SEQ ID No. 2;
preferably, the RV1-VHThe amino acid sequence of (A) is shown as 1 st to 116 th sites of SEQ ID No.1 in a sequence table; RV1-V thereofLThe amino acid sequence of (A) is shown as 1 st to 113 th sites of SEQ ID No.2 in the sequence table.
10. Use of the monoclonal antibody of claim 9 in the preparation of a kit for the detection of rabies virus glycoprotein antigen.
CN202010854943.6A 2020-08-24 2020-08-24 ELISA kit for detecting rabies virus glycoprotein antigen and application thereof Active CN111999497B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010854943.6A CN111999497B (en) 2020-08-24 2020-08-24 ELISA kit for detecting rabies virus glycoprotein antigen and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010854943.6A CN111999497B (en) 2020-08-24 2020-08-24 ELISA kit for detecting rabies virus glycoprotein antigen and application thereof

Publications (2)

Publication Number Publication Date
CN111999497A true CN111999497A (en) 2020-11-27
CN111999497B CN111999497B (en) 2023-08-08

Family

ID=73474007

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010854943.6A Active CN111999497B (en) 2020-08-24 2020-08-24 ELISA kit for detecting rabies virus glycoprotein antigen and application thereof

Country Status (1)

Country Link
CN (1) CN111999497B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112684185A (en) * 2020-12-25 2021-04-20 苏州旭光科星抗体生物科技有限公司 Soluble B7-H4 quantitative detection kit and application thereof
CN113009139A (en) * 2021-02-26 2021-06-22 中牧实业股份有限公司 Enzyme linked immunosorbent assay kit for detecting porcine pseudorabies virus antigen and application thereof
CN114958774A (en) * 2022-05-08 2022-08-30 中国医学科学院医学生物学研究所 Anti-rabies virus monoclonal antibody, hybridoma cell strain secreting antibody and application
CN116023481A (en) * 2022-11-25 2023-04-28 杭州博日科技股份有限公司 Canine coronavirus monoclonal antibody and its application and products

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080765A2 (en) * 2010-01-04 2011-07-07 Indian Immunologicals Limited Recombinant human bivalent diabody against rabies virus and uses thereof
CN103848915A (en) * 2012-12-03 2014-06-11 长春百克生物科技股份公司 Preparation and application of novel anti-rabies virus glycoprotein human-derived genetically-engineered antibody
CN105481979A (en) * 2016-01-07 2016-04-13 中国疾病预防控制中心病毒病预防控制所 Humanized anti-rabies-virus glycoprotein neutralizing antibody RV3A5 and application thereof
CN109580945A (en) * 2018-12-11 2019-04-05 中牧实业股份有限公司 Enzyme linked immunosorbent assay kit for detecting O-type Guangxi strain antigen of foot-and-mouth disease and application thereof
CN109900902A (en) * 2019-03-29 2019-06-18 中牧实业股份有限公司 A kind of porcine pseudorabies virus gB blocks ELISA antibody assay kit and its application

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080765A2 (en) * 2010-01-04 2011-07-07 Indian Immunologicals Limited Recombinant human bivalent diabody against rabies virus and uses thereof
CN103848915A (en) * 2012-12-03 2014-06-11 长春百克生物科技股份公司 Preparation and application of novel anti-rabies virus glycoprotein human-derived genetically-engineered antibody
CN105481979A (en) * 2016-01-07 2016-04-13 中国疾病预防控制中心病毒病预防控制所 Humanized anti-rabies-virus glycoprotein neutralizing antibody RV3A5 and application thereof
CN109580945A (en) * 2018-12-11 2019-04-05 中牧实业股份有限公司 Enzyme linked immunosorbent assay kit for detecting O-type Guangxi strain antigen of foot-and-mouth disease and application thereof
CN109900902A (en) * 2019-03-29 2019-06-18 中牧实业股份有限公司 A kind of porcine pseudorabies virus gB blocks ELISA antibody assay kit and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
郑佳琳等: "狂犬病病毒糖蛋白抗原表位富集区单克隆抗体的制备", 《中国畜牧兽医学会畜牧兽医生物技术学分会暨中国免疫学会兽医免疫分会第八次学术研讨会论文集》, pages 332 - 335 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112684185A (en) * 2020-12-25 2021-04-20 苏州旭光科星抗体生物科技有限公司 Soluble B7-H4 quantitative detection kit and application thereof
CN112684185B (en) * 2020-12-25 2024-01-12 苏州旭光科星抗体生物科技有限公司 Soluble B7-H4 quantitative detection kit and application thereof
CN113009139A (en) * 2021-02-26 2021-06-22 中牧实业股份有限公司 Enzyme linked immunosorbent assay kit for detecting porcine pseudorabies virus antigen and application thereof
CN113009139B (en) * 2021-02-26 2022-07-29 中牧实业股份有限公司 Enzyme linked immunosorbent assay kit for detecting porcine pseudorabies virus antigen and application thereof
CN114958774A (en) * 2022-05-08 2022-08-30 中国医学科学院医学生物学研究所 Anti-rabies virus monoclonal antibody, hybridoma cell strain secreting antibody and application
CN114958774B (en) * 2022-05-08 2023-10-27 中国医学科学院医学生物学研究所 Anti-rabies virus monoclonal antibody, hybridoma cell strain secreting antibody and application
CN116023481A (en) * 2022-11-25 2023-04-28 杭州博日科技股份有限公司 Canine coronavirus monoclonal antibody and its application and products

Also Published As

Publication number Publication date
CN111999497B (en) 2023-08-08

Similar Documents

Publication Publication Date Title
CN109900902B (en) Porcine pseudorabies virus gB blocking ELISA antibody detection kit and application thereof
CN113740536B (en) African swine fever virus p30 blocking ELISA antibody detection kit and application thereof
US10766949B2 (en) Method for preparing whole bovine-derived broadly neutralizing antibody against serotype O foot-and-mouth disease virus
CN111999497B (en) ELISA kit for detecting rabies virus glycoprotein antigen and application thereof
CN111153991A (en) Human SARS-CoV-2 monoclonal antibody and its preparation method and use
CN111848786B (en) Monoclonal antibody, preparation method and application thereof
CN107973850A (en) Recombinate CSFV E 2 protein pig source monoclonal antibody and its preparation method and application
CN109900903B (en) Porcine pseudorabies virus gE blocking ELISA antibody detection kit and application thereof
CN113009139B (en) Enzyme linked immunosorbent assay kit for detecting porcine pseudorabies virus antigen and application thereof
WO2012163263A1 (en) Reagents and methods for prrsv detection
CN109851671B (en) Monoclonal antibody for detecting O-type Guangxi strain antigen of foot-and-mouth disease and application thereof
CN113687073B (en) African swine fever virus p54 blocking ELISA antibody detection kit and application thereof
KR101080071B1 (en) Rift valley fever competition ELISA using monoclonal antibodies against recombinant N protein
CN109824775B (en) Foot-and-mouth disease A type Wuhan strain monoclonal antibody, composition and application thereof
CN116589565A (en) An African swine fever p72 monoclonal antibody and its application
CN118440186A (en) A broad-spectrum antibody against SARS-like coronavirus and/or novel coronavirus mutant strains and its application
CN114966013B (en) ELISA kit for detecting African swine fever virus antigen and application thereof
CN118440187A (en) Broad-spectrum antibody for resisting SARS-like coronavirus and/or new coronamutant strain and its application
CN109613238B (en) Enzyme linked immunosorbent assay kit for detecting foot-and-mouth disease A type Wuhan strain antigen and application thereof
CN116718765B (en) Bovine sarcoidosis blocking ELISA antibody detection kit and application thereof
CN107098980A (en) A kind of fusion protein for detecting Detecting Rubella Virus Antibodies In Human Sera and preparation method thereof
CN118684769B (en) Anti-pig IgG antibody, antibody composition and application thereof
CN119285760B (en) African swine fever virus p30 protein monoclonal antibody and preparation method and application thereof
CN114230661B (en) Antibody for detecting tomato yellow mottle related virus as well as preparation method and application thereof
CN120064640A (en) Porcine parvovirus VP2 double-antibody sandwich quantitative detection kit and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant