CN112795621A

CN112795621A - Method for efficiently removing host nucleic acid in blood stream infection sample

Info

Publication number: CN112795621A
Application number: CN202110159256.7A
Authority: CN
Inventors: 刘鹏; 张磊; 黄文华; 孔德聪; 江华; 律清宇; 郑玉玲; 姜永强
Original assignee: Institute of Pharmacology and Toxicology of AMMS
Current assignee: Institute of Pharmacology and Toxicology of AMMS; Academy of Military Medical Sciences AMMS of PLA
Priority date: 2021-02-05
Filing date: 2021-02-05
Publication date: 2021-05-14

Abstract

The invention discloses a method for efficiently removing host nucleic acid in a blood stream infection sample, which can improve the pathogen detection rate. The invention provides a method for removing host nucleic acid from a blood stream infection sample, which is characterized by comprising the following steps: sequentially carrying out the following steps on a blood stream infection sample: (1) adding saponin for cracking, and collecting precipitate; (2) washing with NaCl solution with NaCl concentration over 0.5M; (3) adding azide propidium bromide, performing photolysis, and collecting precipitate; (4) washing with NaCl solution with NaCl concentration over 0.5M. The method can effectively remove host nucleic acid, thereby more effectively detecting pathogenic microorganisms in a sample. The invention has important application value for identifying bloodstream infection.

Description

Method for efficiently removing host nucleic acid in blood stream infection sample

Technical Field

The invention belongs to the technical field of biology, and relates to a method for efficiently removing host nucleic acid in a blood stream infection sample, which can improve the pathogen detection rate.

Background

Sepsis and bacteremia are collectively referred to as bloodstream infection. Sepsis (septicema) is a blood infection caused by invasion of blood stream by various pathogenic microorganisms (bacteria or fungi) and toxins, and is clinically manifested as: sudden chills, hyperpyrexia, tachycardia, shortness of breath, rash, hepatosplenomegaly and mental changes, which can cause shock, Disseminated Intravascular Coagulation (DIC) and multi-organ failure. If the bacteria only transiently invade the blood, and there are no clinically significant symptoms of toxemia (such as vascular-related infections), they are called bacteremia (bacteremia).

Bloodstream infections (BSIs) have high mortality and multidrug resistance worldwide, so rapid and accurate antibiotic therapy is important to inhibit disease progression and the development of resistant strains. The clinical detection gold standard for pathogenic bacteria is still a separation culture method, and the traditional diagnosis method is long in time consumption and poor in sensitivity and cannot be used for quick and effective application. With the development of molecular diagnostic techniques, sequencing techniques are increasingly applied to clinical diagnosis. Sequence alignment is a necessary process for transformation of sequencing results, and huge sequencing data is a hot spot troubling researchers for many years. Since the data generated by sequencing will contain a large number of host sequences and few microbial sequences, the microbial sequence number ratio is too small, which can seriously affect the sequencing sensitivity and subsequent alignment efficiency. This is especially true for whole blood samples with large cellular content.

The existing host nucleic acid removing methods have insignificant effects such as an enzymolysis method, an ultrasonic crushing method, a filtration method, a kit method and the like.

Propidium azide bromide (PMA) is a photosensitive DNA chimeric dye developed by biotium corporation with high affinity. The dye itself has weak fluorescence, but the fluorescence becomes strong after binding to nucleic acid. It has high affinity and preferentially binds to double-stranded DNA. Due to photolysis, the photosensitive azido group on the dye is converted to a highly reactive nitrene group, which readily reacts with any hydrocarbon (hydrocarbon) moieties at the binding site to form a stable covalent nitrogen-carbon bond, resulting in permanent DNA modification. The dye is almost completely cell membrane impermeable and can thus be used to selectively bind exposed DNA in dead cells. At present, PMA is mainly reported to be used for activity research of bacteria, and host nucleic acid removal by utilizing PMA is not reported.

Disclosure of Invention

The invention aims to provide a method for efficiently removing host nucleic acid in a blood stream infection sample, which can improve the pathogen detection rate.

The invention provides a method for pretreating a blood stream infection sample, which is characterized by comprising the following steps:

sequentially carrying out the following steps on a blood stream infection sample:

(1) adding saponin for cracking, and collecting precipitate;

(2) washing with NaCl solution with NaCl concentration over 0.5M;

(3) adding azide propidium bromide, performing photolysis, and collecting precipitate;

(4) washing with NaCl solution with NaCl concentration over 0.5M.

After the pretreatment, the absolute abundance of the host DNA in the blood stream infection sample is reduced, and the absolute abundance of the pathogenic microorganism DNA is unchanged (the relative abundance is increased), so that the pathogenic microorganism in the blood stream infection sample can be more effectively detected.

The invention also provides a method for extracting and enriching the DNA of pathogenic microorganisms in a blood stream infection sample, which is characterized by comprising the following steps:

(1) adding saponin for cracking, and collecting precipitate;

(2) washing with NaCl solution with NaCl concentration over 0.5M;

(4) washing with NaCl solution with NaCl concentration over 0.5M.

In the sample obtained by the method, the absolute abundance of the host DNA is reduced, and the absolute abundance of the pathogenic microorganism DNA is unchanged (the relative abundance is increased), so that the pathogenic microorganism in the sample can be detected more effectively.

The invention also provides a method for preparing a DNA sample for detecting pathogenic microorganisms in a blood stream infection sample, which is characterized by comprising the following steps:

(1) adding saponin for cracking, and collecting precipitate;

(2) washing with NaCl solution with NaCl concentration over 0.5M;

(4) washing with NaCl solution with NaCl concentration over 0.5M.

The invention also provides a method for removing host nucleic acid in a blood stream infection sample, which is characterized by comprising the following steps:

(1) adding saponin for cracking, and collecting precipitate;

(2) washing with NaCl solution with NaCl concentration over 0.5M;

(4) washing with NaCl solution with NaCl concentration over 0.5M.

The method can effectively remove host nucleic acid, thereby more effectively detecting pathogenic microorganisms in a sample.

Any of the above methods wherein: in the step (1), the working concentration of the saponin is 0.1-2g/100 ml.

Any of the above methods wherein: in the step (1), the working concentration of the saponin is 1g/100 ml.

Any of the above methods wherein: the step (1) may specifically be: collecting blood stream infection sample, adding saponin or saponin solution, shaking, mixing, incubating for 5-10min, centrifuging, removing supernatant, and collecting precipitate.

Any of the above methods wherein: the step (1) may specifically be: collecting blood stream infection sample, adding saponin or saponin solution, shaking, mixing, incubating at room temperature for 5-10min, centrifuging at 20000g for 5min, removing supernatant, and collecting precipitate.

The saponin solution can be specifically a saponin aqueous solution.

The Saponin aqueous solution may specifically be 5g/100ml Saponin aqueous solution.

Any of the above methods wherein: in the step (3), the working concentration of the azide propidium bromide is 10-200 mu M.

Any of the above methods wherein: in the step (3), the working concentration of the azide propidium bromide is 50-200 mu M.

Any of the above methods wherein: in the step (3), the working concentration of the azide propidium bromide is 100 mu M.

Any of the above methods wherein: in the step (3), the photolysis time is 5-30 min.

Any of the above methods wherein: in the step (3), the photolysis time is 5-25 min.

Any of the above methods wherein: in the step (3), the photolysis time is 5 min.

The photolysis can be specifically blue light irradiation by adopting a PMA-Lite LED photolysis instrument.

Any of the above methods wherein: the step (3) may specifically be: adding PMA or PMA solution into the residue of the step (2), resuspending and mixing uniformly, incubating in the dark for 2-5min, performing photolysis, centrifuging, discarding the supernatant, and collecting the precipitate.

Any of the above methods wherein: the step (3) may specifically be: adding PMA solution into the residue (mainly precipitate) in the step (2), resuspending and mixing uniformly, incubating in dark for 2-5min, performing photolysis, centrifuging at 20000g for 2min, discarding the supernatant, and collecting the precipitate.

The PMA solution may specifically be an aqueous PMA solution.

The PMA solution may specifically be a 200. mu.M aqueous PMA solution.

Any of the above methods wherein: in the step (2), the NaCl concentration in the NaCl solution is 0.5-5M.

Any of the above methods wherein: in the step (2), the NaCl concentration in the NaCl solution is 0.5-2.5M.

Any of the above methods wherein: in the step (2), the NaCl concentration in the NaCl solution is 2.5M.

Any of the above methods wherein: in the step (4), the NaCl concentration in the NaCl solution is 0.5-5M.

Any of the above methods wherein: in the step (4), the NaCl concentration in the NaCl solution is 0.5-2.5M.

Any of the above methods wherein: in the step (4), the NaCl concentration in the NaCl solution is 2.5M.

The NaCl solution may specifically be an aqueous NaCl solution.

Any of the above methods wherein: the step (2) may specifically be: adding 2.5M NaCl aqueous solution, shaking for resuspension, centrifuging, and discarding the supernatant.

Any of the above methods wherein: the step (2) may specifically be: adding 2.5M NaCl aqueous solution, shaking for resuspension, centrifuging at 20000g for 3min, and discarding the supernatant.

Any of the above methods wherein: the step (4) may specifically be: adding 2.5M NaCl aqueous solution, shaking for resuspension, centrifuging, and discarding the supernatant.

Any of the above methods wherein: the step (4) may specifically be: adding 2.5M NaCl aqueous solution, shaking for resuspension, centrifuging at 20000g for 3min, and discarding the supernatant.

Any of the above methods may further comprise the steps of: adding PBS buffer solution into the remainder (mainly precipitate) of the step (4), and mixing uniformly.

The invention also provides application of the saponin, the NaCl and the azide propidium bromide in preparation of the kit.

The saponin can be saponin or saponin water solution.

The NaCl may be NaCl or an aqueous NaCl solution.

The azide propidium bromide can be azide propidium bromide or an azide propidium bromide water solution.

The invention also provides a kit which comprises saponin, NaCl and azido propidium bromide.

The saponin can be saponin or saponin water solution.

The NaCl may be NaCl or an aqueous NaCl solution.

The Kit may further comprise The IndISpin Pathologen Kit.

The use of any one of the above kits is (a) or (b) or (c) or (d):

(a) pretreating a blood stream infection sample;

(b) extracting and enriching the DNA of pathogenic microorganisms in a blood stream infection sample;

(c) preparing a DNA sample for detecting pathogenic microorganisms in a blood stream infection sample;

(d) removing host nucleic acids from the blood stream infected sample.

Any of the above hosts may be human.

Any of the above blood stream infection samples may be a blood stream infection sample from a human.

The bloodstream infection may be a bloodstream infection caused by a pathogenic microorganism.

The pathogenic microorganism is bacteria or fungi.

Illustratively, the infection is an E.coli infection.

Illustratively, the infection is a staphylococcus aureus infection.

Illustratively, the pathogenic microorganism is Escherichia coli.

Illustratively, the pathogenic microorganism is staphylococcus aureus.

Illustratively, the bloodstream infection is a bloodstream infection caused by E.coli.

Illustratively, the bloodstream infection is a bloodstream infection caused by staphylococcus aureus.

The method provided by the invention has the core steps that: saponin lysis → washing with high concentration NaCl solution → photolysis of propidium azide bromide. Further, the inventors have optimized the processing conditions. The invention can realize the technical effect that the removal efficiency of the host nucleic acid of the whole blood sample reaches 99.9 percent. The invention has important application value for identifying bloodstream infection.

Drawings

FIG. 1 is a graph showing the results of example 1.

Fig. 2 is a graph showing the results of comparative example 1.

FIG. 3 is a graph showing the results of example 2.

FIG. 4 is a graph showing the results of example 3.

FIG. 5 is a graph showing the results of example 4.

FIG. 6 is a graph showing the results of example 5.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

An exemplary microorganism used in example 1, comparative example 1, example 2, example 3 and example 4 for bloodstream infection is Escherichia coli, described in the following documents: zhao Chenna, Zhang super, Zheng Yu Ling, Liupeng and Jiang Yong, and the establishment and evaluation of a PCR array method for detecting 6 common children pyogenic meningitis pathogenic bacteria, military medicine, 11 months 11 in 2017, volume 41, stage 11. An exemplary microorganism of bloodstream infection used in example 5 is staphylococcus aureus, described in the following references: the targeted sequence enrichment and sequencing combined technical method for detecting 4 blood stream infection pathogens is evaluated in military medicine, 42 th roll 1 in 2018, 1 month and 42 th period.

Saponin (Saponin): Sigma-Aldrich, cat # S7900-100G; CAS number 8047-15-2, EINECS number 232-; https:// www.sigmaaldrich.com/catalog/product/sigma/s7900lang ═ zh & region ═ CN.

Azidation propidium bromide (PMA): biotium, cat # 40069, PMAxx^TMDye,20mM in dH₂O；https://biotium.com/product/pmaxx-20-mm-in-h2o/。

SYBR Green dye (2X), all known as PowerUp^TMSYBR^TMGreen Master Mix: thermo Fisher Scientific, cat # 00948467; https:// www.thermofisher.com/order/catalog/product/A25742SID src-srp-A25742 #/A25742SID src-srp-A25742.

The IndISpin Pathologen Kit (50): germany QIAGEN, cat # SP 54104; website linking: https:// www.indical.com/products/sample-preparation/. The IndISpin Pathologen Kit is a Kit for extracting viral RNA/DNA and bacterial DNA from animal samples (including undiluted whole blood, serum, swabs and tissues) according to The instructions.

All PBS buffers used in the examples were PBS buffer pH7.4, unless otherwise specified, and had been autoclaved. The aqueous Saponin solution was sterilized by filtration through a filter having a pore size of 0.2 μm before use. Aqueous NaCl solution, which was sterilized by filtration through a filter having a pore size of 0.2 μm before use.

Examples 1,

Firstly, preparing a simulation sample

The Escherichia coli was resuspended in PBS buffer to give a bacterial concentration of 10⁸-10⁹CFU/ml of Escherichia coli solution.

Each simulated sample was 200. mu.l. The preparation method of each simulated sample comprises the following steps: and (3) uniformly mixing 180 mu l of healthy human whole blood and 20 mu l of escherichia coli liquid to obtain a simulated sample. Multiple mock samples were prepared.

Second, pretreatment

1. A200. mu.l of the mock sample was added to 50. mu.l of 5g/100ml of Saponin aqueous solution, mixed well with shaking, incubated at room temperature for 5-10min, centrifuged at 20000g for 5min, and the supernatant was discarded. That is, the working concentration of Saponin is 1g/100 ml.

2. The precipitate remaining from step 1 was washed with 2.5M aqueous NaCl.

The specific washing method comprises the following steps: adding 2.5M NaCl aqueous solution, shaking for resuspension, centrifuging at 20000g for 3min, and discarding the supernatant.

3. Adding 100 μ l of 200 μ M PMA solution into the residue (volume of residue is 100 μ l, mainly precipitate) of step 2, resuspending, mixing, dark incubating for 2-5min, irradiating with blue light of PMA-Lite LED photolyzer for 5min, centrifuging for 2min at 20000g, and discarding the supernatant. That is, the working concentration of PMA was 100. mu.M.

Preparation method of 200 μ M PMA solution: PMA was taken, dissolved in sterile water and diluted to 200. mu.M.

4. The remaining precipitate from step 3 was washed with 2.5M aqueous NaCl.

5. And (3) adding PBS (phosphate buffer solution) into the residues (mainly precipitates) in the step (4) until the total volume is 200 mu l, and uniformly mixing to obtain a pretreated sample.

Thirdly, extracting DNA

And (3) taking The pretreated sample obtained in The second step, and extracting DNA by using The IndIspin Pathologen Kit to obtain a DNA sample.

And (2) taking 200 mu l of The simulation sample (also called as a sample without pretreatment) obtained in The step one, and extracting DNA by using The IndISpin Pathologen Kit to obtain a DNA sample.

Fourth, nucleic acid quantification

And (3) taking the DNA sample obtained in the step three (serving as a template), and performing nucleic acid quantification on the human GAPDH gene and the Escherichia coli16S gene by using real-time fluorescent quantitative PCR.

The primer pairs for detecting the human GAPDH gene were as follows:

GAPDH-F (SEQ ID NO: 1): TGGCAACAATATCCACTTTAACAGA;

GAPDH-R (SEQ ID NO: 2): TCAACGGATTTGGTCGTATTAGG.

The primer pairs for detecting the 16S gene of Escherichia coli are as follows:

coli16S-F (SEQ ID NO: 3): CCAGGGCTACACACGTGCTA;

coli16S-R (SEQ ID NO: 4): TCTCGCGAGGTCGCTTCT.

The reaction system of the fluorescent quantitative PCR is shown in Table 1. In the reaction system, the amount of the primer added is adjusted according to the concentration of the primer mother liquor, and then water is used for supplementing to 25 μ l. The working concentration of each primer in the reaction system was 0.2. mu.M.

TABLE 1

The reaction procedure for fluorescent quantitative PCR was as follows: 10min at 95 ℃; at 95 ℃ for 15s and 60 ℃ for 1min, and performing 40 cycles; post-addition of the lysis curve procedure, procedure default to instrument (Stepone Plus).

At least three iterations of processing are set and the results averaged.

The results are shown in FIG. 1. As can be seen, after the pretreatment, the Ct value of the human GAPDH gene as a detection object is significantly increased, indicating that the abundance of human DNA in the DNA sample is significantly reduced. As can be seen, the Ct value of the detection object of the E.coli16S gene was not increased after the pretreatment, indicating that the abundance of E.coli DNA in the DNA sample was not decreased.

Comparative examples 1,

Firstly, preparing a simulation sample

Second, pretreatment

1. Same as in step two of example 1, step 1.

2. The remaining precipitate from step 1 was washed with sterile water.

The specific washing method comprises the following steps: sterile water was added, shaking for resuspension, followed by centrifugation at 20000g for 3min and discarding the supernatant.

3. Adding 100 μ l of 20 μ M PMA solution into the residue (volume of residue is 100 μ l, mainly precipitate) of step 2, resuspending, mixing, dark incubating for 2-5min, blue-light irradiating with PMA-Lite LED photolyzer for 25min, centrifuging at 20000g for 2min, and discarding the supernatant. That is, the working concentration of PMA was 10. mu.M.

Preparation method of 20 μ M PMA solution: PMA was taken, dissolved in sterile water and diluted to 20. mu.M.

4. The remaining precipitate from step 3 was washed with sterile water.

5. Same as in step two of example 1, step 5.

Step three, the same as step three of example 1.

Step four, the same as example 1.

At least three iterations of processing are set and the results averaged.

The results are shown in FIG. 2.

Example 2 optimization of PMA concentration

Firstly, preparing a simulation sample

Second, pretreatment

Substantially the same as the second step of example 1.

The only difference is that: adding 100 mul of PMA solution with different concentrations in the step 3; the PMA solution was replaced with an equal volume of sterile water as a 0-strength PMA solution.

Thirdly, extracting DNA

Step four, the same as example 1.

At least three iterations of processing are set and the results averaged.

The results are shown in FIG. 3 (the abscissa of FIG. 3 is the working concentration of PMA in. mu.M). As can be seen, the working concentration of 50-200 μ M is adopted for PMA in the pretreatment, and the Ct values of the human GAPDH gene as a detection object are all remarkably increased, which indicates that the abundance of human DNA in a DNA sample is remarkably reduced.

Example 3 photolysis time optimization

Firstly, preparing a simulation sample

Second, pretreatment

Substantially the same as the second step of example 1.

The only difference is that: in the step 3, different irradiation times are adopted for the blue light irradiation of the LED photolysis instrument; 0 represents no irradiation.

Thirdly, extracting DNA

Step four, the same as example 1.

At least three iterations of processing are set and the results averaged.

The results are shown in FIG. 4 (the abscissa of FIG. 4 is the irradiation time in min). As can be seen, during the pre-treatment, hydrolysis is carried out for 5-25min, and the Ct values of the human GAPDH gene as a detection object are all remarkably increased, which indicates that the abundance of the human DNA in the DNA sample is remarkably reduced.

Example 4 optimization of NaCl concentration

Firstly, preparing a simulation sample

The Escherichia coli was resuspended in PBS buffer to give a bacterial concentration of 10⁸-10⁹CFU/ml of E.coliAnd (5) bacterial liquid.

Each Control sample was 200. mu.l. The preparation method of each Control sample comprises the following steps: and (3) uniformly mixing 180 mu l of PBS buffer solution and 20 mu l of escherichia coli liquid to obtain a Control sample. Multiple Control samples were prepared.

Second, pretreatment

Substantially the same as the second step of example 1.

The only difference is that: NaCl aqueous solutions with different concentrations are adopted for washing in the step 2 and the step 4; the aqueous NaCl solution was replaced with sterile water as an aqueous NaCl solution of 0 concentration.

Thirdly, extracting DNA

Taking a Control sample, and extracting DNA by using The IndISpin Pathologen Kit to obtain a DNA sample.

Step four, the same as example 1.

At least three iterations of processing are set and the results averaged.

The results are shown in FIG. 5 (the abscissa of FIG. 5 is NaCl concentration in M). The Control sample contained no human blood and was used as a reference. It can be found that the high-concentration sodium chloride does not have a killing effect on escherichia coli, does not reduce the abundance of escherichia coli DNA, and also increases the detection sensitivity of escherichia coli DNA in the QPCR reaction (which is reflected in that the Ct value of the escherichia coli16S gene as a detection object is reduced relative to a Control sample).

Examples 5,

Firstly, preparing a simulation sample

The staphylococcus aureus is resuspended by PBS buffer solution to obtain the bacterial concentration of 10⁸-10⁹CFU/ml Staphylococcus aureus liquid.

Each simulated sample was 200. mu.l. The preparation method of each simulated sample comprises the following steps: and uniformly mixing 180 mu l of healthy human whole blood and 20 mu l of staphylococcus aureus liquid to obtain a simulated sample. Multiple mock samples were prepared.

Second, pretreatment

The same procedure as in step two of example 1.

Thirdly, extracting DNA

The same procedure as in step three of example 1.

Fourth, nucleic acid quantification

And (3) taking the DNA sample obtained in the third step (as a template), and performing nucleic acid quantification on the human GAPDH gene and the staphylococcus aureus Glutamate synthase gene by using real-time fluorescent quantitative PCR.

The primer pairs for detecting staphylococcus aureus Glutamate synthase gene were as follows:

Sta-F (SEQ ID NO: 5): GGTTAGGTGAATTGATTGTTTTATAAGGT, respectively;

Sta-R (SEQ ID NO: 6): TGGAAGCTGAAAAGGTAAACGAA are provided.

Essentially the same as step four of example 1. The only difference is that Sta-F replaces e.coli1tis-F and Sta-R replaces e.coli1tis-R.

At least three iterations of processing are set and the results averaged.

The results are shown in FIG. 6. As can be seen, after the pretreatment, the Ct value of the human GAPDH gene as a detection object is significantly increased, indicating that the abundance of human DNA in the DNA sample is significantly reduced. As can be seen, after the pretreatment, the Ct value of the staphylococcus aureus Glutamate synthase gene as a detection object is not increased, which indicates that the abundance of the staphylococcus aureus DNA in the DNA sample is not reduced.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> military medical research institute of military science institute of people's liberation force of China

<120> a method for efficiently removing host nucleic acid from blood stream infection sample

<130> GNCYX210452

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggcaacaat atccacttta acaga 25

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcaacggatt tggtcgtatt agg 23

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccagggctac acacgtgcta 20

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tctcgcgagg tcgcttct 18

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggttaggtga attgattgtt ttataaggt 29

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tggaagctga aaaggtaaac gaa 23

Claims

1. A method of pre-treating a blood stream infected sample, comprising:

(1) adding saponin for cracking, and collecting precipitate;

(2) washing with NaCl solution with NaCl concentration over 0.5M;

(4) washing with NaCl solution with NaCl concentration over 0.5M.

2. A method for extracting and enriching DNA of pathogenic microorganisms in blood stream infection samples is characterized in that:

(1) adding saponin for cracking, and collecting precipitate;

(2) washing with NaCl solution with NaCl concentration over 0.5M;

(4) washing with NaCl solution with NaCl concentration over 0.5M.

3. A method of preparing a DNA sample for detecting a pathogenic microorganism in a blood stream infected sample, characterized by:

(1) adding saponin for cracking, and collecting precipitate;

(2) washing with NaCl solution with NaCl concentration over 0.5M;

(4) washing with NaCl solution with NaCl concentration over 0.5M.

4. A method for removing host nucleic acids from a blood stream infected sample, comprising:

(1) adding saponin for cracking, and collecting precipitate;

(2) washing with NaCl solution with NaCl concentration over 0.5M;

(4) washing with NaCl solution with NaCl concentration over 0.5M.

5. The method of any of claims 1 to 4, wherein:

in the step (1), the working concentration of the saponin is 0.1-2g/100 ml.

6. The method of any of claims 1 to 4, wherein:

in the step (2) and the step (4), the NaCl concentration in the NaCl solution is 0.5M-5M.

7. The method of any of claims 1 to 4, wherein:

in the step (3), the working concentration of the azide propidium bromide is 10-200 mu M.

8. The method of any of claims 1 to 4, wherein:

in the step (3), the photolysis time is 5min-30 min.

9. The application of saponin, NaCl and azido propidium bromide in the preparation of the kit.

10. A kit comprises saponin, NaCl and azido propidium bromide.