CN110643727A - Dual fluorescence quantitative PCR mycoplasma detection kit - Google Patents
Dual fluorescence quantitative PCR mycoplasma detection kit Download PDFInfo
- Publication number
- CN110643727A CN110643727A CN201911018480.3A CN201911018480A CN110643727A CN 110643727 A CN110643727 A CN 110643727A CN 201911018480 A CN201911018480 A CN 201911018480A CN 110643727 A CN110643727 A CN 110643727A
- Authority
- CN
- China
- Prior art keywords
- mycoplasma
- pcr
- kit
- detection
- reference gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a double-fluorescence quantitative PCR mycoplasma detection kit. The kit comprises a PCR mixed system, mycoplasma standard plasmids and ultrapure water, wherein the PCR mixed system comprises a probe quantitative PCR mixed system, a reference gene standard escherichia coli genome, mycoplasma primers and probes, and reference gene primers and probes. The detection box can detect 20 mycoplasma, and has the advantages of rapid detection and high sensitivity.
Description
Technical Field
The invention belongs to the field of PCR (polymerase chain reaction) mycoplasma detection, and particularly relates to a double-fluorescence quantitative PCR mycoplasma detection kit.
Background
Mycoplasma (Mycoplasma) is a prokaryotic microorganism lacking cell walls, which is a kind of bacteria and viruses, can grow and reproduce in an inanimate medium, has a simple structure and small size, has branched or filamentous morphological components, and can pass through a common microfiltration membrane filter (0.20-0.45 mu m). Since researchers found mycoplasma contamination in cell culture for the first time in 1956, the problem of mycoplasma contamination was ubiquitous, and related studies reported that the incidence of mycoplasma infection reached 63% during cell culture. Mycoplasma contamination can cause cell deformation, and can have serious effects on teaching, scientific research and production. Therefore, the establishment of a rapid and efficient mycoplasma detection method is significant.
There are various methods for detecting mycoplasma contamination in cell culture, and various methods such as isolation culture, DNA fluorescence staining, PCR, probe, ELISA, etc. are commonly used. Among them, the PCR technique has been widely used in scientific research and diagnosis of diseases as a rapid, sensitive, specific and simple genetic diagnosis technique. In 1989, the application of PCR method to detection and diagnosis of mycoplasma infection was first reported, and then the detection of various mycoplasma by PCR method was continuously found. In many PCR methods for detecting mycoplasma, a conserved region of 16srRNA sequence is used for primer selection, but if one-step PCR is used, the designed primers are difficult to avoid cross reaction with ecologically related bacteria and have a false positive result, or a part of primers with good specificity cannot amplify DNA of most common mycoplasma and have a false negative result.
Disclosure of Invention
The invention aims to solve the technical problem of providing a double-fluorescence quantitative PCR mycoplasma detection kit so as to overcome the defects that a PCR method in the prior art is easy to generate false positive or false negative results when used for detecting mycoplasma.
The invention provides a primer and probe combination for dual fluorescent quantitative PCR mycoplasma detection, which comprises a mycoplasma primer and probe, a reference gene primer and probe;
the mycoplasma primer and the probe are as follows:
Mycoplasma-F：TTAAACCACATGCTCCA，
Mycoplasma-R：ATCCGCCTGAGTAGTAT，
Mycoplasma-TaqMan：FAM-CCCGTCAATTCCTTTAAGTTTCACTC-BHQ1；
the reference gene primers and the probes are as follows:
TOP3A-F：AGCGACTGTACGAGTTTATT，
TOP3A-R：GAGCGATGTCGATCTCC，
TOP3A-TaqMan：HEX-ATTTCCTGGCTTGCTGCT-BHQ1。
the invention also provides a dual fluorescent quantitative PCR mycoplasma detection kit, which comprises a PCR mixed system, mycoplasma standard plasmids and ultrapure water, wherein the PCR mixed system comprises the primer and probe combination.
The two pairs of primers and the two-color probe in the primer and probe combination respectively aim at the mycoplasma DNA and the internal reference template.
The PCR mixed system also comprises: a probe quantitative PCR mixed system and a reference gene standard Escherichia coli genome.
The reference gene standard Escherichia coli genome is constructed by transposing a reference gene onto an Escherichia coli genome through a PGRG36 transposable plasmid. And a reference gene standard escherichia coli genome is constructed, so that the pollution risk is greatly reduced, and the detection result is more efficient.
The mycoplasma standard plasmid is constructed by cloning a cell-positive mycoplasma contamination PCR product onto a Vector PMD18-T Vector.
The fluorescent quantitative PCR amplification program of the kit comprises the following steps: denaturation at 94 ℃ for 4min and circulation.
The reaction conditions of the cycle are as follows: fluorescence was collected at 94 ℃ for 15s, 55 ℃ for 30s, and 72 ℃ for 30s, and at 55 ℃ for 40 cycles.
The invention also provides a detection method of the double fluorescence quantitative PCR mycoplasma detection kit, which comprises the following steps:
(1) preparing a fluorescent quantitative PCR reaction system, and preparing a sample: 18 μ L PCR mix, 2 μ L test sample, positive control: 18 μ L PCR mix, 2 μ L mycoplasma standard plasmid, negative control: 18 μ L of PCR mixed system, 2 μ L of ultrapure water;
(2) and (2) slightly and uniformly mixing the fluorescent quantitative PCR reaction system in the step (1) by reversing the upper part and the lower part for about ten times to avoid foaming, and slightly centrifuging to perform fluorescent quantitative PCR amplification.
The sample to be detected is cell extraction DNA or cell culture supernatant, and the PCR amplification procedure is as follows: denaturation at 94 ℃ for 4min and circulation.
The parameters of the cycle are optimized reaction conditions: fluorescence was collected at 94 ℃ for 15s, 55 ℃ for 30s, and 72 ℃ for 30s, and at 55 ℃ for 40 cycles.
Setting a threshold value after the PCR amplification in the step (2) is finished:
setting target genes for positive control and reference gene setting for negative control, setting threshold value and then setting reference CtThe values are as follows:
reference gene: ctValue 27+1
The target gene is as follows: ctValue 20+2
The results show that:
1. if the positive control sample is target gene mycoplasma CtValue of>27, but positive and negative samples reference Gene CtThe value was normal, indicating degradation of the positive mycoplasma control template.
2. If the negative control sample refers to gene CtValue of>30, reference gene C of positive control sampletValue of>30 and the gene of interest mycoplasma CtValue of>30, indicating that the 2 × PCR mixed system has failed.
In order to realize double fluorescence quantitative PCR detection of mycoplasma DNA, the invention selects two different color-labeled reporter fluorophores by using a TaqMan probe method, wherein FAM (fluorescence amplified polymerase chain reaction) is selected for modifying the reporter fluorescence of the mycoplasma DNA; VIC marker is selected as a reporter fluorophore for modifying a reference gene, and BHQ1 is selected as a quenching group, so that the aim of double detection is fulfilled.
The invention designs the primer and the probe according to the mycoplasma 16S ribosomal RNA conserved region and the reference gene TOP3A conserved region, and the gene segment covers a plurality of mycoplasma species, so that the invention can be used for PCR amplification detection aiming at various mycoplasma species, and can realize the detection of 20 mycoplasma species.
The invention has high detection sensitivity and accuracy, can detect the content of nucleic acid as low as 10 copies/mul, and has stronger specificity and higher sensitivity than the reported SYBR Green dye method fluorescent quantitative PCR detection of mycoplasma. Labord.S. et al have established a fluorescent probe-based real-time quantitative PCR detection method for Mycoplasma, which is a real-time quantitative PCR detection of a single fluorescent probe, and may result in false positive results due to the presence of inhibitors in the sample. The dual-fluorescence quantitative PCR mycoplasma detection established by the invention can respectively carry out quantitative detection on mycoplasma DNA and a reference gene, inhibitors in a reaction system can be monitored through the reference gene amplification efficiency, and the detection result is very high in efficiency. The probe method has the difficulty in selecting amplified fragments, and the method for establishing the dual fluorescent quantitative PCR mycoplasma detection can be used for quickly and efficiently detecting 20 mycoplasma. The kit and the detection method are simple to use and operate, can save the sample pretreatment (boiling), save the operation time and the pollution risk, can realize the quantitative detection of the mycoplasma DNA without electrophoresis, and can be produced and popularized in large scale for the detection of mycoplasma, especially the mycoplasma in cell cultures.
Advantageous effects
The invention can detect 20 mycoplasma, while the mycoplasma detection in the prior invention patent can not be realized. The invention selects two TaqMan probes marked with different colors to respectively detect the reference gene and the mycoplasma DNA, the detection sensitivity of the mycoplasma can reach 10 copies/mu L, and the sensitivity is far higher than that of the mycoplasma detection in the prior art. The quantitative PCR method is operated in a closed environment in the whole process, has no cross contamination of products and is simple to operate. Because different treatments may exist in the cell culture process and have large interference on PCR, and the common PCR method is easy to cause false negative results, the method can effectively monitor the inhibitor in the reaction system by referring to the amplification efficiency of the gene, and can still detect the cell culture supernatant sample by diluting the cell culture supernatant sample by 10 times with water (as in example 1), so that false negative is avoided and the detection result is reliable. The TaqMan probe has strong specificity, avoids acquiring non-specific amplification signals and greatly improves the detection sensitivity. In addition, the invention can realize quantitative detection of mycoplasma through the DNA CT value of mycoplasma, can carry out quantitative detection, and can divide the result into: negative, weak positive, positive and strong positive, and provides more guidance information for scientific research personnel. Because the copy number of the plasmid standard substance is different from that of the detection sample greatly, in addition, aerosol is easy to form to cause pollution, and positive addition is easy to cause, the reference gene standard escherichia coli genome constructed by the invention greatly reduces the pollution risk, and the detection result is more efficient. In conclusion, the dual fluorescence quantitative PCR mycoplasma detection kit established by the invention can be applied to mycoplasma detection of cell extracted DNA and cell culture supernatant, and accurate and rapid detection of mycoplasma pollution is realized.
Drawings
FIG. 1 is a schematic diagram of the detection of Mycoplasma by double fluorescent quantitative PCR and a graph showing the amplification of Mycoplasma by double fluorescent quantitative PCR in example 1.
FIG. 2 is a graph showing the results of identification of a mycoplasma positive standard plasmid (labeled as 1) in example 1.
FIG. 3 is a diagram showing the results of PCR identification of transposable colonies of the reference gene in example 1, wherein 1 is a reference gene standard E.coli genome.
FIG. 4 is a standard curve of a mycoplasma positive standard plasmid in example 1.
FIG. 5 is a graph showing the results of the sensitivity test of the mycoplasma positive standard plasmid in example 1, wherein 10,100,1000,10000,100000 indicates the copy number of the mycoplasma positive standard plasmid, and the copy number of the mycoplasma positive standard plasmid selected as 10000 in example 1 is used as a positive control.
FIG. 6 is a graph showing the results of detection of DNA extracted from cells and cell culture supernatant samples in example 1, in which 1 and 2 are positive cell extracted DNA samples, 3 and 4 are positive cell culture supernatant samples, 5 is a negative cell culture supernatant sample, and 6 is a negative sample with H added2Negative control of O.
FIG. 7 is a diagram showing the comparison result of the Mycoplasma amplification product NCBI BLAST according to the present invention.
Detailed Description
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined in the appended claims.
pMD TM18-T Vector Cloning Kit was purchased from Bao bioengineering; pGRG36 vector was purchased from central plains of Beijing; the primers were synthesized by Suzhou Hongxn Biotechnology Co., Ltd, and the TaqMan probes were synthesized by general biosystems (Anhui) Co., Ltd. The probe quantitative PCR mixing system was purchased from near shore protein science and technology, Inc.
Example 1
The embodiment provides a dual fluorescent quantitative PCR mycoplasma detection kit, which comprises a PCR mixed system, mycoplasma standard plasmids and ultrapure water, wherein the PCR mixed system comprises a probe quantitative PCR mixed system, mycoplasma primers and probes, reference gene primers and probes, and a reference gene standard Escherichia coli genome. The recommended reaction system is 20 muL, wherein 0.2 muL of each of the Mycoplasma, TOP3A upstream primer and downstream primer (50 muL/L), 0.1 muL of each of the Mycoplasma and TOP3A TaqMan probe (50 muL/L), and 10.4 muL of the probe quantitative PCR mixed system; reference gene standard E.coli genome 2. mu.L.
Wherein, the mycoplasma primer and the probe are as follows:
Mycoplasma-F：TTAAACCACATGCTCCA，
Mycoplasma-R：ATCCGCCTGAGTAGTAT，
Mycoplasma-TaqMan：FAM-CCCGTCAATTCCTTTAAGTTTCACTC-BHQ1；
the reference gene primers and probes are:
TOP3A-F：AGCGACTGTACGAGTTTATT，
TOP3A-R：GAGCGATGTCGATCTCC，
TOP3A-TaqMan：HEX-ATTTCCTGGCTTGCTGCT-BHQ1。
reference gene the standard E.coli genome was constructed by transposing a reference gene to the E.coli genome via a PGRG36 transposable plasmid.
The mycoplasma standard plasmid is constructed by cloning the PCR product polluted by the cell positive mycoplasma onto the Vector PMD18-T Vector.
The above-mentioned kit was used for the detection of 1 cell-extracted DNA and 3 cell culture supernatant samples.
Sample treatment:
the sample is cell extracted cell DNA, and the culture conditions are as follows: 30 ten thousand 293T cells and 2ml fresh medium were added to each well of a 6-well plate and 200. mu.l of cell suspension was transferred to a T25 flask containing 4ml of medium at 37 ℃ with 5% CO2The incubator of (2) for cultivation. Cell DNA was extracted using an animal genome extraction kit purchased from Biotechnology Ltd according to the protocol. The DNA of the cell extracted has no concentration requirement, and 2ul can be directly taken as a sample loading template for qPCR reaction.
If the sample is cell culture supernatant, the culture conditions are as follows: 30 ten thousand 293T cells and 2ml fresh medium were added to each well of a 6-well plate and 200. mu.l of cell suspension was transferred to a T25 flask containing 4ml of medium at 37 ℃ with 5% CO2The incubator of (2) for cultivation. The following operations are required:
1. 1ml of cell culture supernatant was taken and placed in a centrifuge tube.
2. 13000rpm/min, and 5 minutes.
3. After the supernatant was diluted 10 times, 2ul was used as a template for the qPCR reaction.
qPCR reaction (exemplified by ABI 7500)
In this embodiment, the pre-added primers provided by the kit are centrifuged before use and then carefully opened to avoid flying and losing. When in use, the mixture is gently and evenly mixed by turning upside down for about ten times, so as to avoid foaming, and after slight centrifugation, the use is recommended as follows:
(20μL)
| components | Sample (I) | Positive control | Negative control |
| PCR mixing system | 18μL | 18μL | 18μL |
| Sample(s) | 2μL | 0 | 0 |
| Mycoplasma standard plasmid | 0 | 2μL | 0 |
| Ultrapure water | 0 | 0 | 2μL |
And mixing the liquid in the PCR tube, centrifuging, and placing in a fluorescent quantitative PCR instrument. When detecting (including the construction of the positive plasmid), the PCR amplification procedure is as follows: after denaturation at 94 ℃ for 4min, circulation is carried out, and the circulation reaction conditions are as follows: fluorescence was collected at 94 ℃ for 15s, 55 ℃ for 30s, and 72 ℃ for 30s, and at 55 ℃ for 40 cycles. The size of the PCR amplification product of the mycoplasma is 83bp, and the size of the PCR amplification product of the reference gene is 93bp (the sample is cell DNA extracted from cells or cell culture supernatant, and the sizes of the amplification products are the same).
After the reaction was completed, the threshold was set as follows:
setting target genes for positive control and reference gene setting for negative control, setting threshold value and then setting reference CtThe values are as follows:
reference gene: ctValue 27+1
The target gene is as follows: ctValue 20+2
The results show that:
1. if the positive control sample is target gene mycoplasma CtValue of>27, but positive and negative samples reference Gene CtThe value was normal, indicating degradation of the positive mycoplasma control template.
2. If the negative control sample refers to gene CtValue of>30, reference gene C of positive control sampletValue of>30 and the gene of interest mycoplasma CtValue of>30, indicating that the 2 × PCR mixed system has failed.
And (4) judging a result:
in the embodiment, the sample is cell extracted cell DNA and cell culture supernatant, and the detection result of the cell extracted cell DNA is positive for mycoplasma; results of cell culture supernatant detection: 2 cases were positive for mycoplasma and 1 case was negative for mycoplasma.
Plasmid extraction, colony PCR primer amplification using PMD18-T Vector, agarose gel electrophoresis results are shown in FIG. 2, which indicates that the mycoplasma positive standard plasmid is successfully constructed.
Use of the upstream primer 5'-GATGCTGGTGGCGAAGCTGT-3'; the downstream primer 5'-GATGACGGTTTGTCACATGGA-3' (E.coli genome) was PCR amplified and agarose gel electrophoresis was performed to identify positive primers, as shown in FIG. 3.
And automatically generating a standard curve by using an ABI 7500 software standard curve establishing function. A standard curve constructed from Ct values of 5 copy number gradient Mycoplasma standard plasmids and the logarithm of their copy numbers is shown in FIG. 4.
The sensitivity of the TaqMan probe dual fluorescent quantitative PCR reaction was examined using 10-fold serial dilutions of Mycoplasma positive standard plasmid (105 copies/. mu.L-10 copies/. mu.L) and 800-fold dilutions of the reference gene standard E.coli genomic DNA as templates, as shown in FIG. 5.
FIG. 1 shows that: the dual fluorescence quantitative PCR mycoplasma detection method established by the invention is stable, and the reference gene can play a good role in monitoring a system.
FIG. 6 shows that: the dual fluorescence quantitative PCR mycoplasma detection method established by the invention can be applied to mycoplasma detection of cell extracted DNA and cell culture supernatant, and accurate and rapid detection of mycoplasma pollution is realized.
FIG. 7 shows that: the dual fluorescence quantitative PCR mycoplasma detection method established by the invention can detect 20 mycoplasma, and the name of the amplifiable mycoplasma is shown in Table 1.
The invention creatively selects the common conserved sequences in different mycoplasma species by comparison to design the PCR primers, designs the specific PCR primers to amplify one end gene segment of the mycoplasma 16sRNA, and the gene segment covers most mycoplasma species, so that the specific PCR primers can be used for PCR amplification detection aiming at various mycoplasma species.
TABLE 1
| Numbering | |
| 1 | |
| 2 | |
| 3 | Mycoplasma hyopneumoniae |
| 4 | |
| 5 | Mycoplasma sp. |
| 6 | Mycoplasma dispar |
| 7 | uncultured Mycoplasma sp. |
| 8 | Mycoplasma flocculare ATCC 27399 |
| 9 | |
| 10 | Mycoplasma bovoculi M165/69 |
| 11 | Mycoplasma hyorhinis DBS 1050 |
| 12 | Mycoplasma hyopneumoniae 7422 |
| 13 | Mycoplasma hyopneumoniae 168- |
| 14 | Mycoplasma hyorhinis GDL-1 |
| 15 | |
| 16 | Mycoplasma hyopneumoniae 168 |
| 17 | Mycoplasma hyorhinis HUB-1 |
| 18 | Mycoplasma flocculare |
| 19 | Mycoplasma flocculare ATCC 27716 |
| 20 | Mycoplasma hyorhinis ATCC 17981 |
The sensitivity of the quantitative PCR detection method for mycoplasma capricolum established by gazania splendens et al reaches 5.96 copies/mu L, the detection sensitivity of the established method is 10 copies/mu L, the sensitivity is similar and is far higher than that of the common PCR; various species of mycoplasma can be detected. Compared with China patent CN106939353A (named as PCR primer and positive plasmid for detecting mycoplasma, construction method thereof, kit and detection method thereof) of Gaough chess, varnished solenoid and Liuhuamin 2017, the invention has the advantages that the double quantitative PCR is operated in a whole closed house, so that cross contamination is prevented; subsequent electrophoresis operation is not needed, so that the operation is simpler; and can realize the quantitative detection of mycoplasma; the inhibitor in the reaction system can be effectively monitored by the amplification efficiency of the reference gene, and the detection result is more efficient.
SEQUENCE LISTING
<110> university of east China
<120> double-fluorescence quantitative PCR mycoplasma detection kit
<130> 1
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 17
<212> DNA
<213> Artificial sequence
<400> 1
ttaaaccaca tgctcca 17
<210> 2
<211> 17
<212> DNA
<213> Artificial sequence
<400> 2
atccgcctga gtagtat 17
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence
<400> 3
cccgtcaatt cctttaagtt tcactc 26
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
<210> 5
<211> 17
<212> DNA
<213> Artificial sequence
<400> 5
gagcgatgtc gatctcc 17
<210> 6
<211> 18
<212> DNA
<213> Artificial sequence
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence
<400> 8
gatgacggtt tgtcacatgg a 21
Claims (7)
1. A primer and probe combination for dual fluorescent quantitative PCR mycoplasma detection is characterized by comprising a mycoplasma primer and probe and a reference gene primer and probe;
the mycoplasma primer and the probe are as follows:
Mycoplasma-F：TTAAACCACATGCTCCA，
Mycoplasma-R：ATCCGCCTGAGTAGTAT，
Mycoplasma-TaqMan：FAM-CCCGTCAATTCCTTTAAGTTTCACTC-BHQ1；
the reference gene primers and the probes are as follows:
TOP3A-F：AGCGACTGTACGAGTTTATT，
TOP3A-R：GAGCGATGTCGATCTCC，
TOP3A-TaqMan：HEX-ATTTCCTGGCTTGCTGCT-BHQ1。
2. a dual fluorescence quantitative PCR mycoplasma detection kit, characterized in that, the kit comprises a PCR mixed system, mycoplasma standard plasmid and ultrapure water, and the PCR mixed system comprises the primer and probe combination of claim 1.
3. The kit of claim 2, wherein the PCR mix system further comprises: a probe quantitative PCR mixed system and a reference gene standard Escherichia coli genome.
4. The kit of claim 3, wherein the reference gene standard E.coli genome is constructed by transposing a reference gene into the E.coli genome using a PGRG36 transposable plasmid.
5. The kit of claim 2, wherein the mycoplasma standard plasmid is constructed by cloning a cell-positive mycoplasma contamination PCR product into the Vector PMD18-T Vector.
6. The kit of claim 2, wherein the fluorescent quantitative PCR amplification procedure of the kit is as follows: denaturation at 94 ℃ for 4min and circulation.
7. The kit of claim 7, wherein the cycling reaction conditions are: fluorescence was collected at 94 ℃ for 15s, 55 ℃ for 30s, and 72 ℃ for 30s, and at 55 ℃ for 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911018480.3A CN110643727A (en) | 2019-10-24 | 2019-10-24 | Dual fluorescence quantitative PCR mycoplasma detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911018480.3A CN110643727A (en) | 2019-10-24 | 2019-10-24 | Dual fluorescence quantitative PCR mycoplasma detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110643727A true CN110643727A (en) | 2020-01-03 |
Family
ID=68994775
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911018480.3A Pending CN110643727A (en) | 2019-10-24 | 2019-10-24 | Dual fluorescence quantitative PCR mycoplasma detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110643727A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112899351A (en) * | 2021-02-03 | 2021-06-04 | 东华大学 | Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824471A (en) * | 2009-12-14 | 2010-09-08 | 北京鑫诺美迪基因检测技术有限公司 | Composition and kit for simultaneously detecting mycoplasma urealytium, mycoplasma hominis and mycoplasma genitalium |
| CN103409509A (en) * | 2013-07-02 | 2013-11-27 | 江苏硕世生物科技有限公司 | Group B streptococcus fluorescence PCR detection kit |
| CN104531738A (en) * | 2014-12-08 | 2015-04-22 | 四川省华派生物制药有限公司 | Preparation method of positive contrast plasmids for mycoplasma PCR detection and transformed strain of positive contrast plasmids |
| CN104988242A (en) * | 2015-08-11 | 2015-10-21 | 上海睿玻生物科技有限公司 | Kit for detecting mycoplasma hominis nucleic acid through PCR-fluorescence probe method and detecting method of kit |
| CN106939353A (en) * | 2017-05-09 | 2017-07-11 | 广东顺德工业设计研究院(广东顺德创新设计研究院) | PCR primer, positive plasmid and its construction method, kit and detection method for detecting mycoplasma |
| AR110951A1 (en) * | 2017-01-24 | 2019-05-22 | Flagship Pioneering Inc | COMPOSITIONS AND RELATED METHODS TO CONTROL DISEASES TRANSMITTED BY VECTORS |
-
2019
- 2019-10-24 CN CN201911018480.3A patent/CN110643727A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824471A (en) * | 2009-12-14 | 2010-09-08 | 北京鑫诺美迪基因检测技术有限公司 | Composition and kit for simultaneously detecting mycoplasma urealytium, mycoplasma hominis and mycoplasma genitalium |
| CN103409509A (en) * | 2013-07-02 | 2013-11-27 | 江苏硕世生物科技有限公司 | Group B streptococcus fluorescence PCR detection kit |
| CN104531738A (en) * | 2014-12-08 | 2015-04-22 | 四川省华派生物制药有限公司 | Preparation method of positive contrast plasmids for mycoplasma PCR detection and transformed strain of positive contrast plasmids |
| CN104988242A (en) * | 2015-08-11 | 2015-10-21 | 上海睿玻生物科技有限公司 | Kit for detecting mycoplasma hominis nucleic acid through PCR-fluorescence probe method and detecting method of kit |
| AR110951A1 (en) * | 2017-01-24 | 2019-05-22 | Flagship Pioneering Inc | COMPOSITIONS AND RELATED METHODS TO CONTROL DISEASES TRANSMITTED BY VECTORS |
| CN106939353A (en) * | 2017-05-09 | 2017-07-11 | 广东顺德工业设计研究院(广东顺德创新设计研究院) | PCR primer, positive plasmid and its construction method, kit and detection method for detecting mycoplasma |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112899351A (en) * | 2021-02-03 | 2021-06-04 | 东华大学 | Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse |
| CN112899351B (en) * | 2021-02-03 | 2022-08-26 | 东华大学 | Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pisal et al. | Detection of mycoplasma contamination directly from culture supernatant using polymerase chain reaction | |
| Zhao et al. | Enumeration of viable non-culturable Vibrio cholerae using droplet digital PCR combined with propidium monoazide treatment | |
| CN111187756A (en) | Areca-nut yellows-related virus and detection method thereof | |
| CN114350828A (en) | Specific primer for amplifying Pantoea ananatis and application thereof | |
| CN112041441A (en) | Primer group for detecting candida auricula, candida auricula detection kit and candida auricula detection method | |
| CN110643727A (en) | Dual fluorescence quantitative PCR mycoplasma detection kit | |
| CN110735003A (en) | Universal primer, kit and detection method for detecting fungal contamination in cell product | |
| CN110699471B (en) | Primer pair and kit for rapidly detecting mycoplasma and application of primer pair and kit | |
| CN112029881A (en) | Primer pair for detecting lactobacillus paracasei N1115 and application thereof | |
| CN114990244A (en) | Detection method for rapidly detecting staphylococcus aureus based on MIRA fluorescence method | |
| CN115125313A (en) | Primer pair for detecting pathogenic enterocolitis yersinia and CRISPR/Cas12a detection kit | |
| CN102936621A (en) | Bacillus cereus detection method and kit | |
| CN110592248B (en) | Method for efficiently identifying/screening clostridium butyricum and application thereof | |
| CN104032000B (en) | The detection method of a kind of bacillus cereus and test kit | |
| CN114540519A (en) | Primer, kit and identification method for identifying bacillus amyloliquefaciens in yeast for making hard liquor | |
| CN104164514B (en) | Detect Edwardsiella tarda with the fluorescent probe PCR method of Channel-catfish tarda simultaneously | |
| CN113388689A (en) | Primer combination, probe, kit and use method thereof | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| CN112430675A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN110964849B (en) | Method for eliminating African swine fever virus detection false positive and kit for detecting African swine fever virus | |
| CN114574611B (en) | Cattle green alga-free PCR primer and application thereof | |
| CN107604102A (en) | Dove TTV and the dual Real time PCR detection kits of dove New-type adenovirus | |
| CN114107325B (en) | Metagenome internal reference, preparation method and application thereof, and metagenome blood flow pathogen detection method | |
| CN107604085B (en) | LAMP (loop-mediated isothermal amplification) detection primer group, kit and method for ureaplasma parvum | |
| CN116377093A (en) | Method for detecting plasmid copy number in escherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200103 |