CN104164514B - Detect Edwardsiella tarda with the fluorescent probe PCR method of Channel-catfish tarda simultaneously - Google Patents
Detect Edwardsiella tarda with the fluorescent probe PCR method of Channel-catfish tarda simultaneously Download PDFInfo
- Publication number
- CN104164514B CN104164514B CN201410441438.3A CN201410441438A CN104164514B CN 104164514 B CN104164514 B CN 104164514B CN 201410441438 A CN201410441438 A CN 201410441438A CN 104164514 B CN104164514 B CN 104164514B
- Authority
- CN
- China
- Prior art keywords
- tarda
- seqidno
- seq
- channel
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to detection method and the detection kit of microorganism, be specifically related to a kind of Edwardsiella tarda that simultaneously detects with the fluorescent probe PCR detection method of Channel-catfish tarda, described method comprises: utilize specific probe and primer pair, be that template carries out real-time fluorescence PCR reaction with DNA of bacteria, it is characterized in that: described primer pair is respectively Seq ID No.1, Seq ID No.2, Seq ID No.3 and Seq ID No.4 shown sequence; Seq ID No.1: 5 '-CTGCCAAGCAGGGACGTAA-3 ' Seq ID No.2: 5 '-CGAGGAGAGCATCTTGTCGAA-3 ' Seq ID No.3: 5 '-TCCATTCGTCTGTGCGACAA-3 ' Seq ID No.4: the described probe of 5 '-AAAACACGTTCGGATGGATTG-3 ' is nucleotide sequence that can be identical or complementary with the sequence of genomic dna between described primer pair of Edwardsiella tarda or Channel-catfish tarda, and 5 ' of described probe end and 3 ' is held and is marked with fluorescent reporter group and fluorescent quenching group respectively; Does is described probe Seq ID No.5 and Seq ID sequence shown in No.6, Seq ID No.5:5 '-ATCCTCAACGTCGAGAAGGCGCG-3 ' Seq ID No.6:5 '-CACTATGAGGGTGGGATCAAGGCGTTT-3 '.
Description
Technical field
The present invention relates to detection method and the detection kit of microorganism, be specifically related to for detecting Edwardsiella tarda simultaneously with the primer of Channel-catfish tarda real-time PCR detection and probe sequence, and test kit.
Background technology
Edwardsiella tarda (
edwardsiellasp.) be distributed widely in seawater and fresh water, infect various cultivation hydrocoles, very harmful to aquaculture.To eel, catfish, yellow eel and other many animals cause a disease, can serious financial consequences be caused, the pathogenic bacteria causing fish to fall ill be mainly Edwardsiella tarda (
e.tarda) He Channel-catfish tarda (
e.ictaluri).Existing known Edwardsiella tarda is the important pathogen of multiple light, marine fish, and cause the disease of fish kidney, liver purulence ulcer focus, loss is serious, is endanger larger pathogenic bacteria in current aquaculture.
The tarda technique of gene detection set up both at home and abroad at present has the regular-PCR detection technique detecting Edwardsiella tarda, and the regular-PCR detection technique of Jian Ce Channel-catfish tarda, these methods need repeatedly these two kinds of bacterium to be detected, and need could observe detected result by gel electrophoresis, detection method is loaded down with trivial details and time-consuming compared with fluorescence PCR method.
Not yet exploitation foundation detects Edwardsiella tarda with the fluorescent probe PCR detection method of Channel-catfish tarda simultaneously both at home and abroad at present.
Summary of the invention
In view of this, the present invention is in order to the Edwardsiella tarda in rapid detection hydrocoles with Channel-catfish tarda, and exploitation establishes and detects Edwardsiella tarda with the real time fluorescent PCR method of Channel-catfish tarda.
One aspect of the present invention develops a kind of Edwardsiella tarda that simultaneously detects with the fluorescent probe PCR detection method of Channel-catfish tarda.
The present invention provide on the other hand a kind of for detecting Edwardsiella tarda simultaneously with the test kit of Channel-catfish tarda.
A kind of Edwardsiella tarda that simultaneously detects is with the fluorescent probe PCR detection method of Channel-catfish tarda, described method comprises: utilize specific probe and primer pair, be that template carries out real-time fluorescence PCR reaction with DNA of bacteria, it is characterized in that: described primer pair is respectively the sequence shown in SeqIDNo.1, SeqIDNo.2, SeqIDNo.3 and SeqIDNo.4;
SeqIDNo.1:5’-CTGCCAAGCAGGGACGTAA-3’
SeqIDNo.2:5’-CGAGGAGAGCATCTTGTCGAA-3’
SeqIDNo.3:5’-TCCATTCGTCTGTGCGACAA-3’
SeqIDNo.4:5’-AAAACACGTTCGGATGGATTG-3’
Wherein: SeqIDNo.1 is the upstream primer of Edwardsiella tarda, SeqIDNo.2 is the downstream primer of Edwardsiella tarda, and SeqIDNo.3 is the upstream primer of Channel-catfish tarda, and SeqIDNo.3 is the downstream primer of Channel-catfish tarda;
Described probe is oligonucleotide sequence that can be identical or complementary with the sequence of genomic dna between described primer pair of Edwardsiella tarda or Channel-catfish tarda, and 5 ' of described probe end and 3 ' is held and is marked with fluorescent reporter group and fluorescent quenching group respectively;
Preferably, described probe is the sequence shown in SeqIDNo.5 and SeqIDNo.6,
SeqIDNo.5：5’-ATCCTCAACGTCGAGAAGGCGCG-3’；
SeqIDNo.6：5’-CACTATGAGGGTGGGATCAAGGCGTTT-3’，
Wherein, SeqIDNo.5 is oligonucleotide sequence that can be identical or complementary with the sequence of genomic dna between described primer pair of Edwardsiella tarda; SeqIDNo.6 is oligonucleotide sequence that can be identical or complementary with the sequence of genomic dna between described primer pair of Channel-catfish tarda.
The fluorescent reporter group of described SeqIDNo.5 probe 5 ' end mark is the fluorescent reporter group that FAM, SeqIDNo.6 probe 5 ' end marks is VIC, and described probe 3 ' holds the fluorescent quenching group of mark to be TAMRA.
The primer final concentration of described real-time fluorescence PCR reaction is 0.25 μm of ol/dm
3, probe final concentration is 0.5 μm of ol/dm
3.
The reaction conditions of described real-time fluorescence PCR comprises: first 95 DEG C of sex change 1min, then 95 DEG C of 10s, 55 DEG C of 10s, 68 DEG C of 30s circulate 40 times, carry out FAM and VIC two channels fluorescent collecting at 68 DEG C.
The present invention provide on the other hand a kind of for detecting Edwardsiella tarda simultaneously with the test kit of Channel-catfish tarda, it is characterized in that: described test kit contains can amplify Edwardsiella tarda with the primer pair of the gene fragment of Channel-catfish tarda, and described primer pair is respectively the sequence shown in SeqIDNo.1, SeqIDNo.2, SeqIDNo.3 and SeqIDNo.4;
SeqIDNo.1:5’-CTGCCAAGCAGGGACGTAA-3’
SeqIDNo.2:5’-CGAGGAGAGCATCTTGTCGAA-3’
SeqIDNo.3:5’-TCCATTCGTCTGTGCGACAA-3’
SeqIDNo.4:5’-AAAACACGTTCGGATGGATTG-3’
Described probe is nucleotide sequence that can be identical or complementary with the sequence of genomic dna between described primer pair of Edwardsiella tarda or Channel-catfish tarda, and 5 ' of described probe end and 3 ' is held and is marked with fluorescent reporter group and fluorescent quenching group respectively;
Described probe is the sequence shown in SeqIDNo.5 and SeqIDNo.6,
5’-ATCCTCAACGTCGAGAAGGCGCG-3’
5’-CACTATGAGGGTGGGATCAAGGCGTTT-3’。
The fluorescent reporter group of described SeqIDNo.5 probe 5 ' end mark is the fluorescent reporter group that FAM, SeqIDNo.6 probe 5 ' end marks is VIC, and described probe 3 ' holds the fluorescent quenching group of mark to be TAMRA.
Beneficial effect of the present invention:
The present invention develops foundation and detects Edwardsiella tarda with the fluorescent probe PCR detection method of Channel-catfish tarda simultaneously, compensate at present nothing both at home and abroad and detects the blank of the real time fluorescent PCR method of above-mentioned two kinds of tardas simultaneously.Fluorescent probe and object fragment is utilized to hybridize, the fluorescent probe PCR detection technique of release detection signal has the detection sensitivity higher than regular-PCR and specificity, and operation steps is simple, reaction terminates rear direct reading detected result, carrying out electrophoresis detection without the need to opening reaction tubes, decreasing crossed contamination, can the accuracy of more effective guarantee result, also effectively improve detection efficiency, shorten detection time.
Accompanying drawing explanation
Fig. 1 shows real-time PCR detection Edwardsiella tarda described in the embodiment of the present invention with Channel-catfish tarda negative findings figure: wherein, curve 1 is Edwardsiella tarda positive control; Curve 2 likes to obtain Fahrenheit bacterium positive control Wei Channel-catfish; Curve 3 is negative control; Curve 4 is for being subject to sample product.
Fig. 2 shows real-time PCR detection Edwardsiella tarda positive findings figure described in the embodiment of the present invention: wherein 1. Edwardsiella tarda positive controls; 2. Channel-catfish likes to obtain Fahrenheit bacterium positive control; 3. by sample product; 4. negative control.
Fig. 3 shows real-time fluorescence PCR Jian Ce Channel-catfish tarda positive findings figure described in the embodiment of the present invention: wherein, curve 1 is Edwardsiella tarda positive control; Curve 2 likes to obtain Fahrenheit bacterium positive control Wei Channel-catfish; Curve 3 and 4 is for being subject to sample product; Curve 5 is negative control.
Embodiment
In order to make those skilled in the art understand technical scheme of the present invention better, below disclose further some non-limiting embodiments the present invention is described in further detail.
Material used in the present invention and reagent all can be buied from the market or can be obtained by method described in the invention preparation.
embodiment 1
1, key instrument and reagent
Quantitative real time PCR Instrument: American AB I company 7300 type.Nucleic acid purification system: U.S. Thermo company KingFisherml type.Nucleic acid paramagnetic particle method extracts test kit: Omega biotech company of U.S. Mag-SiTissueDNAkit.Real-time fluorescence PCR reaction solution: the RealMasterMix(Probe of Beijing Tian Gen biotechnology company limited) test kit.
2 primers and probe
Select the tarda gyrb gene order that GenBank includes, at this gene order conservative region Primerexpress3.0 software design primer, and in tarda kind specific regions design TaqMan probe, check its specificity through NCBIBlast.Design and filter out 2 cover Auele Specific Primers and TaqMan-MGB probe.Edwardsiella tarda detection probes 5 ' end flag F AM fluorescent reporter group ， Channel-catfish tarda detection probes 5 ' holds mark VIC fluorescent reporter group.Primer and probe are synthesized by Shanghai Jierui Biology Engineering Co., Ltd, and sequence is in table 1.
Table 1 Edwardsiella tarda is with Channel-catfish tarda detects primer and probe sequence
Wherein, E.t-F1 represents the upstream primer of Edwardsiella tarda, and E.t-R1 represents the downstream primer of Edwardsiella tarda, the upstream primer of E.i-F2 Biao Shi Channel-catfish tarda, and E.i-R2 represents the downstream primer of SeqIDNo.3 Wei Channel-catfish tarda.
3, DNA profiling preparation
Get the tissues such as the liver of hydrocoles, spleen and kidney, streak inoculation is in tryptose soya agar (TSA), SS agar or bismuth sulfite agar (BSA) substratum.Tarda forms circular, smooth, moistening, translucent canescence small colonies on TSA flat board; SS nutrient agar flat board forms comparatively small colonies, because it produces H
2s can make bacterium colony central authorities for black; BSA culture medium flat plate is formed grey, bacterium colony with brown halation and metalluster.After 30 DEG C of cultivation 24h, the suspicious single bacterium colony streak inoculation of picking carries out pure culture in above-mentioned corresponding substratum, and the inoculation of getting pure culture is for subsequent use after cultured solution of broth 30 DEG C cultivates 24h.
The DNA of bacteria of cultivating gained is extracted by OMEGA company Mag-SiTissueDNAkit method.
4, real-time fluorescence PCR reaction system
25mm after optimization
3reaction system moiety is 0.25mm
3primer (20 μm of ol/dm
3), 0.5mm
3probe (20 μm of ol/dm
3), 2 ~ 5mm
3(negative control is two steaming H to sample DNA templates
2o.), 10mm
32.5 × realMasterMix(Beijing Tian Gen biotechnology company limited), 1.25mm
320 × ProbeEnhancersolution(Beijing Tian Gen biotechnology company limited), supply two steaming H
2o to 25mm
3.
5, real-time fluorescence PCR reaction conditions
Reaction conditions after optimization is first 95 DEG C of sex change 1min, and then 95 DEG C of 10s, 55 DEG C of 10s, 68 DEG C of 30s circulate 40 times, carry out FAM and VIC two channels fluorescent collecting at 68 DEG C.
6, result judges
6.1 negative findingses judge
Negative control without typical S type amplification curve, without threshold value cycle number (C
t); Positive control tool typical S type amplification curve, C
tvalue is less than 28, and experimental result is set up.Sample detection is without typical S type amplification curve, or C
tduring value >40, feminine gender can be judged to be.
6.2 Edwardsiella tarda positive findingses judge
Negative control without typical S type amplification curve, without threshold value cycle number (C
t); Positive control tool typical S type amplification curve, C
tvalue is less than 28, and experimental result is set up.There is typical S type amplification curve, C in the FAM channel fluorescence detection signal of sample
tvalue is less than 36; And the VIC channel fluorescence detection signal of sample is not when occurring typical S type amplification curve, can be judged to be that Edwardsiella tarda detects positive.
6.3 Channel-catfish tarda positive findingses judge
Negative control without typical S type amplification curve, without threshold value cycle number (C
t); Positive control tool typical S type amplification curve, C
tvalue is less than 28, and experimental result is set up.There is typical S type amplification curve, C in the FAM channel fluorescence detection signal of sample
tvalue is less than 36; And when also there is typical S type amplification curve in the VIC channel fluorescence detection signal of sample, C
tvalue is less than 36, can Ding as the detection of Channel-catfish tarda positive by Pan.
6.4 suspect results
Negative control without typical S type amplification curve, without threshold value cycle number (C
t); Positive control tool typical S type amplification curve, C
tvalue is less than 28, and experimental result is set up.As the C described in 6.2 and 6.3
tvalue is 36≤C
twhen≤40, detected result is suspicious, need re-start experiment.
embodiment 2
A kind of detection kit, for detecting Edwardsiella tarda simultaneously with the real-time PCR detection of Channel-catfish tarda, described test kit contains following primer and probe:
Table 1 Edwardsiella tarda is with Channel-catfish tarda detects primer and probe sequence
Wherein, E.t-F1 represents the upstream primer of Edwardsiella tarda, and E.t-R1 represents the downstream primer of Edwardsiella tarda, the upstream primer of E.i-F2 Biao Shi Channel-catfish tarda, and E.i-R2 represents the downstream primer of SeqIDNo.3 Wei Channel-catfish tarda.
Wherein, the FAM of E.t probe 5 ' end mark is fluorescent reporter group, and the VIC of E.i probe 5 ' end mark is fluorescent reporter group, and the TAMRA of E.t probe and E.i probe 3 ' end mark is fluorescent quenching group.
Described test kit also comprises working instructions.
The above, be only preferred embodiment of the present invention, is not used for limiting scope of the invention process.Therefore the change in every case done according to claim of the present invention and specification sheets or modification, all should belong within scope that patent of the present invention contains.
<110> Inspection and Quarantine Center of Xiamen Entry-Exit Inspection and Quarantine Bureau
<120> detects Edwardsiella tarda simultaneously with the PCR method of Channel-catfish tarda
<130>2014
<160>6
<170>PatentInversion3.3
<210>1
<211>19
<212>DNA
<213> synthetic
<400>1
ctgccaagcagggacgtaa19
<210>2
<211>21
<212>DNA
<213> synthetic
<400>2
cgaggagagcatcttgtcgaa21
<210>3
<211>20
<212>DNA
<213> synthetic
<400>3
tccattcgtctgtgcgacaa20
<210>4
<211>21
<212>DNA
<213> synthetic
<400>4
aaaacacgttcggatggattg21
<210>5
<211>23
<212>DNA
<213> synthetic
<400>5
atcctcaacgtcgagaaggcgcg23
<210>6
<211>27
<212>DNA
<213> synthetic
<400>6
cactatgagggtgggatcaaggcgttt27
Claims (2)
1. one kind for detecting the test kit of Edwardsiella tarda and Channel-catfish tarda simultaneously, it is characterized in that: described test kit contains can amplify Edwardsiella tarda with the primer pair of the gene fragment of Channel-catfish tarda, and described primer pair is respectively the sequence shown in SeqIDNo.1, SeqIDNo.2, SeqIDNo.3 and SeqIDNo.4:
SeqIDNo.1:5’-CTGCCAAGCAGGGACGTAA-3’
SeqIDNo.2:5’-CGAGGAGAGCATCTTGTCGAA-3’
SeqIDNo.3:5’-TCCATTCGTCTGTGCGACAA-3’
SeqIDNo.4:5’-AAAACACGTTCGGATGGATTG-3’
Described probe is nucleotide sequence that can be identical or complementary with the sequence of genomic dna between described primer pair of Edwardsiella tarda or Channel-catfish tarda, and 5 ' of described probe end and 3 ' is held and is marked with fluorescent reporter group and fluorescent quenching group respectively;
Described probe is the sequence shown in SeqIDNo.5 and SeqIDNo.6,
5’-ATCCTCAACGTCGAGAAGGCGCG-3’
5’-CACTATGAGGGTGGGATCAAGGCGTTT-3’。
2. detection kit according to claim 1, it is characterized in that: the fluorescent reporter group of described SeqIDNo.5 probe 5 ' end mark is FAM, the fluorescent reporter group of SeqIDNo.6 probe 5 ' end mark is VIC, and described probe 3 ' holds the fluorescent quenching group of mark to be TAMRA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410441438.3A CN104164514B (en) | 2014-09-01 | 2014-09-01 | Detect Edwardsiella tarda with the fluorescent probe PCR method of Channel-catfish tarda simultaneously |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410441438.3A CN104164514B (en) | 2014-09-01 | 2014-09-01 | Detect Edwardsiella tarda with the fluorescent probe PCR method of Channel-catfish tarda simultaneously |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104164514A CN104164514A (en) | 2014-11-26 |
| CN104164514B true CN104164514B (en) | 2016-03-16 |
Family
ID=51908495
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410441438.3A Expired - Fee Related CN104164514B (en) | 2014-09-01 | 2014-09-01 | Detect Edwardsiella tarda with the fluorescent probe PCR method of Channel-catfish tarda simultaneously |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104164514B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105925683B (en) * | 2016-05-13 | 2019-08-06 | 中国科学院水生生物研究所 | The detection kit and its application of Edwardsiella tarda |
| CN114854886A (en) * | 2022-06-30 | 2022-08-05 | 南开大学 | Real-time fluorescence PCR detection method for Edwardsiella tarda and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6951726B2 (en) * | 2002-09-24 | 2005-10-04 | Mississippi State University | Real-time PCR assay of the bacterium Edwardsiella ictaluri in channel catfish |
| CN102140513A (en) * | 2010-12-24 | 2011-08-03 | 中国科学院海洋研究所 | Primer sequences for detecting Edwardsiella tarda, Edwardsiella ictarda or pathogenic Edwardsiella tarda, and detection method and application thereof |
| CN102154473A (en) * | 2011-01-24 | 2011-08-17 | 杭州市农业科学研究院 | Gene chip and applications thereof in detection of aquatic pathogenic microorganism |
-
2014
- 2014-09-01 CN CN201410441438.3A patent/CN104164514B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6951726B2 (en) * | 2002-09-24 | 2005-10-04 | Mississippi State University | Real-time PCR assay of the bacterium Edwardsiella ictaluri in channel catfish |
| CN102140513A (en) * | 2010-12-24 | 2011-08-03 | 中国科学院海洋研究所 | Primer sequences for detecting Edwardsiella tarda, Edwardsiella ictarda or pathogenic Edwardsiella tarda, and detection method and application thereof |
| CN102154473A (en) * | 2011-01-24 | 2011-08-17 | 杭州市农业科学研究院 | Gene chip and applications thereof in detection of aquatic pathogenic microorganism |
Non-Patent Citations (1)
| Title |
|---|
| 迟缓爱德华氏菌SYBR Green I实时荧光定量PCR检测方法的建立及其应用;荣小军 等;《水产学报》;20131231;第37卷(第12期);1829-1838 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104164514A (en) | 2014-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102605055B (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
| CN102146466B (en) | Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method | |
| CN102443629B (en) | Fluorescence quantitative PCR (polymerase chain reaction) detection kit for salmonella and detection method thereof | |
| CN102965438B (en) | Duplex polymerase chain reaction (PCR) detection primer group, kit and method for pathogenic channa source aeromonas schubertii | |
| CN105734164B (en) | A kind of multiple PCR reagent kit of detection bacterium meningitis pathogen | |
| CN105063036B (en) | The molecular labeling of Xanthomonas oryzae pv oryzae and its application | |
| CN105420373A (en) | Multiple PCR primer set and probes and detecting method for simultaneously detecting three kinds of aeromonas | |
| CN107955839A (en) | For detecting double PCR primer, detection method and the kit of 3 type of porcine circovirus 2 type and circovirus | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN102676664B (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN1955310A (en) | Nucleotide sequential, testing kit and method for detecting swine streptococcus II | |
| CN104164514B (en) | Detect Edwardsiella tarda with the fluorescent probe PCR method of Channel-catfish tarda simultaneously | |
| CN106434935A (en) | Composition and method for identifying pasteurella multocida and/or haemophilus parasuis | |
| CN103397108A (en) | HCLV (hog cholera lapinized virus) fluorescent quantitation RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| CN106868198B (en) | Multiplex PCR primer group for simultaneously detecting four pathogenic bacteria of catfishes and monitoring method | |
| CN115125313A (en) | Primer pair for detecting pathogenic enterocolitis yersinia and CRISPR/Cas12a detection kit | |
| CN107604098A (en) | For detecting dove TTV EvaGreen real-time fluorescence quantitative PCRs primer and kit | |
| CN108588183A (en) | A kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes | |
| CN109136394A (en) | One kind proposing Dick's Salmonella TaqMan fluorescent quantitative PCR detection method and application until dawn | |
| CN107586889A (en) | Dove New-type adenovirus EvaGreen real-time fluorescence quantitative PCR detection primers | |
| CN108103152A (en) | A kind of Listonella anguillarum rapid detection method | |
| CN108359746B (en) | Method and primer for detecting cell cross contamination caused by Hela cells | |
| CN105112570A (en) | Real-time RT-PCR (reverse transcription-polymerase chain reaction) specific primers, probe and method for detecting PSTVd (potato spindle tuber viroid) | |
| CN104878072A (en) | Didymella bryoniae fluorescent PCR detection method as well as primer and probe for didymella bryoniae fluorescent PCR detection method | |
| CN104313154A (en) | Double PCR (Polymerase Chain Reaction) method for simultaneously detecting mycoplasma hyopneumoniae and porcine pasteurella multocida |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160316 Termination date: 20160901 |