CN108588183A - A kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes - Google Patents
A kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes Download PDFInfo
- Publication number
- CN108588183A CN108588183A CN201810416127.XA CN201810416127A CN108588183A CN 108588183 A CN108588183 A CN 108588183A CN 201810416127 A CN201810416127 A CN 201810416127A CN 108588183 A CN108588183 A CN 108588183A
- Authority
- CN
- China
- Prior art keywords
- detection
- calcein
- reaction
- lamp
- reaction system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the detection reaction systems that a kind of calcein visualization LAMP detects Klebsiella Pneumoniae, include reagent in the reaction volume of 25 μ L：10 × thermosol Buffer, dNTPs, glycine betaine, MgSO4, inner primer pair, ring primer pair, outer primer pair, calcein, MnCl2, Bst polymerases, DNA profiling, RNase free water.The detection reaction system has good specificity, and consistent with the sensibility of LAMP agarose gel electrophoresis detection methods, but 100 times more sensitive than PCR method；Calcein and manganese ion are added before the reaction, the direct visual color variation of reaction product can determine whether reaction result, need not move through agarose gel electrophoresis detection.As can be seen that calcein visualization LAMP method has many advantages, such as that high specificity, sensitive high, easy to operate, product easily detect, reaction only needs a thermostat water bath that detection can be completed, and is suitable for quick detection of the farm of base to pathogen.
Description
Technical field
The present invention relates to biotechnologies.
Background technology
Klebsiella Pneumoniae (Klebsiella Pneumoniae) is Gram-negative, and one kind of enterobacteriaceae is pathogenic
Stronger conditioned pathogen, in rod-shaped, atrichia, it is unpowered, have thicker pod membrane, by Friediander in 1893 from trouble
It is isolated for the first time in the lung tissue of lobar pneumonia patient.Currently, the bacterium is in worldwide distribution, it is primarily present in people and animal
Enteron aisle, respiratory tract and urogenital tract and water, soil and cereal in, can cause when immunity of organisms declines pneumonia, enteritis,
A variety of diseases such as meningitis, peritonitis, disease in the urological system, wound infection septicemia.In recent years, have more by the bacterium to be caused
Human poultry infection morbidity report, be separated to the bacterium out of many animals body such as birds, amphibian animal and fish, and increasing is presented
More trend cause huge loss to aquaculture, and make treatment difficulty because it clinically typically exhibits multi-drug resistant
Greatly, the death rate is high and paid attention to extensively.Therefore, a kind of prevention of the method quickly detected to the infection of Klebsiella Pneumoniae is established
It is had a very important significance with control.
At present be usually used in Klebsiella Pneumoniae detection method be mainly Bacteria Culture identification, regular-PCR technology and in real time
Fluorescence PCR assay.Bacteria Culture identification is cumbersome, and time-consuming, and Detection of pathogenic bacteria positive rate is low.And with nucleic acid detection technique
Raising, the detection of Klebsiella Pneumoniae also begins to use regular-PCR technology and real-time fluorescent PCR technology.Regular-PCR detection is accurate
Inadequate, poor specificity is spent, and technology requires high, testing cost height；And real-time fluorescent PCR technology is dependent on expensive thermal cycle
Instrument and probe synthesis, also skilled operator.Therefore, the technology based on PCR can not be carried out in farm of base,
Limit the extensive utilization of these technologies.
Loop-mediated isothermal amplification technique (LAMP) is to be examined by a kind of new etiology nucleic acid that Notomi et al. is invented for 2000
Survey technology.The technology designs 4 different primers (FIP, BIP, F3, B3) for 6 sections on target dna chain, is set in chain
It changes under the action of BstDNA polymerases in 60 DEG C of -65 DEG C of amplification 60min of constant temperature or so, you can carry out cyclic amplification, and efficiency can
Up to 109-1010A order of magnitude.And calcein visualization LAMP method is that manganese ion is added in buffer solution before the reaction, is used in combination
Calcein makees fluorescence indicator.Before LAMP reactions, calcein and manganese ion combine, and reaction buffer is crocus；
In the presence of having target gene, LAMP reactions occur, the pyrophosphate ion of generation deprives the manganese ion combined with calcein simultaneously
In combination, calcein is combined with remaining pyrophosphate ion generates green fluorescence, to put the signal of LAMP amplifications
Greatly, it visually observes clearly.This method has many advantages, such as that high specificity, sensitive high, easy to operate, product easily detect, reaction
It only needs a thermostat water bath that detection can be completed, is suitable for quick detection of the farm of base to pathogen.
Invention content
The present invention provides a kind of simple and efficient, the calcein visualization LAMP of the field quick detection of suitable cultivation base
Detect the detection reaction system of Klebsiella Pneumoniae comprising：
Wherein, the DNA profiling is obtained by building Klebsiella Pneumoniae positive plasmid.Select Klebsiella Pneumoniae
The conservative region of FimK genes designs specific primer, and 266bp FimK gene orders are cloned into pMD19-T carriers, are built into
Klebsiella Pneumoniae positive plasmid.Sequencing result：
GGGAGCGTTATCTTTCCGGCGCGTCGACTGCACTTCAATGCGTATAAACTGGATATGAGCATCGTCAACGACGCCCA
GCACGATCCAAAGGCGCTTGCGCTAATAAAAAGCCTGGCCTACTACTGCCAGTTAAGCGACAGTCGCTGTGTGGCGG
AAGGGGTGGATTCACTGGCGAAATTTACGCAGTTAAAATCGCTGGGGATTGATCGCTTCCAGGGCTATCTGTTTTCA
CCACCGATGCGGCGTGAACATCTCCCGGATCTGAT(SEQ ID №1)
Further, the optimal reaction temperature of the reaction system is 64 DEG C, optimum reacting time 50min.
Beneficial effects of the present invention include：The calcein visualizes the detection reactant of LAMP detection Klebsiella Pneumoniaes
System has good specificity, and consistent with the sensibility of LAMP agarose gel electrophoresis detection methods, but than PCR method sensitivity
100 times；Calcein and manganese ion are added before the reaction, the direct visual color variation of reaction product can determine whether reaction knot
Fruit needs not move through agarose gel electrophoresis detection.As can be seen that calcein visualization LAMP method has high specificity, spirit
The advantages that quick high, easy to operate, product easily detects, reaction only need a thermostat water bath that detection can be completed, and are suitable for base
Quick detection of the layer farm to pathogen.
Description of the drawings
Fig. 1 is the reaction temperature Optimum Experiment result figure of reaction system of the present invention, and a figures are the lamp of calcein
Figure, b figures be that electrophoresis lamp schemes, and M is marked to represent 2000bp DNA Marker in figure, label 1~7 respectively represent 59 DEG C, 60 DEG C,
61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C, 65 DEG C, label 8 is negative control；
Fig. 2 is the reaction time Optimum Experiment result figure of reaction system of the present invention, and a figures are the lamp of calcein
Figure, b figures be that electrophoresis lamp schemes, and M is marked to represent 2000bp DNA Marker in figure, label 1~7 respectively represent 10min,
20min, 30min, 40min, 45min, 50min, 55min, label 8 are negative control；
Fig. 3 is the calcein and manganese ion ratio optimization test result figure of reaction system of the present invention, is marked in figure
(1：8) corresponding concentration ratio is (25 μM：0.2mM), (1 is marked:12) corresponding concentration ratio is (25 μM：0.3mM), (1 is marked:
16) corresponding concentration ratio is (25 μM：0.4mM), (1 is marked：32) corresponding concentration ratio is (25 μM：0.8mM), (1 is marked:64)
Corresponding concentration ratio is (25 μM：1.2mM), (1 is marked:128) corresponding concentration ratio is (25 μM：2.4mM), (1 is marked:10) right
The concentration ratio answered is (50 μM：0.5mM), (1 is marked：12) corresponding concentration ratio is (50 μM：0.6mM), (1 is marked:24) corresponding
Concentration ratio be (50 μM：1.2mM)；
Fig. 4 is the magnesium ion concentration Optimum Experiment result figure of reaction system of the present invention, and a figures are the lamp of calcein
Figure, b figures be that electrophoresis lamp schemes, and M is marked to represent 2000bp DNA Marker in figure, label 1~6 respectively represent 2.0mM,
3.0mM, 4.0mM, 5.0mM, 6.0mM, 7.0mM, label 7 are negative control；
Fig. 5 is the glycine betaine concentration optimization test result figure of reaction system of the present invention, and a figures are the lamp of calcein
Figure, b figures be that electrophoresis lamp schemes, and M is marked to represent 2000bp DNA Marker in figure, label 1~5 respectively represent 0mM, 0.25mM,
0.5mM, 0.75mM, 1mM, label 6 are negative control；
Fig. 6 is the dNTPs concentration optimization test result figures of reaction system of the present invention, and a figures are the lamp of calcein
Figure, b figures be that electrophoresis lamp schemes, and M is marked to represent 2000bp DNA Marker in figure, label 1~6 respectively represent 0.6mM,
0.8mM, 1.0mM, 1.2mM, 1.4mM, 1.6mM, label 7 are negative control；
Fig. 7 is the Bst polymerase concentration Optimum Experiment result figures of reaction system of the present invention, and a figures are calcein
Lamp schemes, and b figures are electrophoresis lamp figures, mark M to represent 2000bp DNA Marker in figure, label 1~5 respectively represents 0.08U/ μ
L, 0.16U/ μ L, 0.24U/ μ L, 0.32U/ μ L, 0.4U/ μ L, label 6 are negative control；
Fig. 8 is the inner primer and outer primer ratio optimization test result figure of reaction system of the present invention, and a figures are that calcium is yellowish green
The lamp figures of element, b figures are electrophoresis lamp figures, mark M to represent 2000bp DNA Marker in figure, label 1 is (0.4 μM：0.2μ
M), label 2 is (0.8 μM：0.2 μM), label 3 is (1.2 μM：0.2 μM), label 4 is (1.6 μM：0.2 μM), label 5 is (2.0
μM：0.2 μM), label 6 is (2.4 μM：0.2 μM), label 7 is negative control；
Fig. 9 is the ring primer and outer primer ratio optimization test result figure of reaction system of the present invention, and a figures are that calcium is yellowish green
The lamp figures of element, b figures are electrophoresis lamp figures, mark M to represent 2000bp DNA Marker in figure, label 1 is (0 μM：0.2 μM),
Label 2 is (0.2 μM：0.2 μM), label 3 is (0.4 μM：0.2 μM), label 4 is (0.6 μM：0.2 μM), label 5 is (0.8 μM：
0.2 μM), label 6 is (1.0 μM：0.2 μM), label 7 is negative control；
Figure 10 is the specific test result figure of reaction system of the present invention, and a figures are the lamp figures of calcein, b figures
Scheme for electrophoresis lamp, label M is 2000bp DNA Marker in figure, and label 1 is positive plasmid sample, and label 2 is kerekou pneumonia
Primary bacterium, label 3 are Aeromonas veronii, and label 4 is Aeromonas sobria, and label 5 is Aeromonas hydrophila, and label 6 is cavy
Aeromonas, label 7 are Fei Shi citric acid bacillus, and label 8 is pseudomonas putida, and label 9 is pseudomonas aeruginosa, label 10
It is Shewanella putrefaciens for Wdwardsiella tarda label 11, label 12 is flavobacterium columnare, and label 13 is vibrio alginolyticus and conduct
Negative control；
Figure 11 is the sensitivity tests result figure of reaction system of the present invention, and a figures are the lamp figures of calcein, b figures
To scheme for electrophoresis lamp, c figures are PCR electrophoretograms, wherein label M is 2000bp DNA Marker, label 1~7 respectively 1.0 ×
106Copy/L~1.0 × 10 μ0Copy/μ L template concentrations, label 8 are negative control.
Specific implementation mode
Below by specific implementation mode combination attached drawing, invention is further described in detail.But those skilled in the art
It will be understood that the following example is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.It is not specified in embodiment
Particular technique or condition person, according to technology described in document in the art or condition (such as with reference to J. Pehanorm Brookers etc.
It writes, what Huang Peitang etc. was translated《Molecular Cloning:A Laboratory guide》, the third edition, Science Press) or carry out according to product description.Institute
Production firm person is not specified with reagent or instrument, being can be with conventional products that are commercially available.
Embodiment 1：The structure of Klebsiella Pneumoniae positive plasmid.
1-1, design of primers and synthesis：
It selects the conservative region of the FimK genes of Klebsiella Pneumoniae to design specific primer, work bioengineering is given birth to by Shanghai
Co., Ltd synthesizes, it is contemplated that amplification target fragment size is 266bp.Primer sequence includes SEQ ID № 2~7, i.e.,：Outer primer
(F3 and B3), inner primer (FIP and BIP) and ring primer (LoopF and LoopB), wherein FIP by Flc (complementary series of Fl) and
F2 sequences form, and BIP is made of Blc and B2 (complementary series of B2c) sequence, as shown in table 2.
The primer of 2 Klebsiella Pneumoniae LAMP reactions of table
1-2, PCR amplification and electrophoresis：
Using Klebsiella Pneumoniae genomic DNA as template, amplifying target genes segment.PCR reaction systems：14μL 2×
Easy Taq Super Mix, each 1 μ L 10mmol/L forward and reverse primers, 2 μ L template DNAs add ddH2O to 50 μ L.PCR
Reaction condition is：94 DEG C of 5min, 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 30 cycles, 72 DEG C of 5min, 16 DEG C of preservations.PCR is tied
Shu Hou takes 4 μ LPCR products to carry out 1% agarose gel electrophoresis：
(1) 0.5g agaroses are weighed, 1 × TAE of 50mL are added, electric heating stove heat makes agarose dissolve.Wait for that temperature is down to 50
5 μ L nucleic acid staining agent are added at DEG C -60 DEG C, gently shake up, glue；
(2) Ago-Gel prepared is put in electrophoresis tank, 1 × TAE buffer solutions is made not have glue surface, loading；
(3) 120V, 400mA, voltage stabilizing electrophoresis 30min；
(4) result is observed in gel imaging system after electrophoresis.
The recovery purifying of 1-3, PCR product：
Well is added in 45 μ L of PCR product, through 1% agarose gel electrophoresis.According to agarose gel purification reclaim reagent
Box purifies and recycles the DNA product in purpose band.It is as follows：
(1) in the UV lamp, the DNA cloning product recycled needed for cutting；
(2) gel cut is put into 1.5mL centrifuge tubes, weighed；
(3) add 3 times of volume sol solutions DD；
10min (or until glue is completely dissolved) is placed in (4) 56 DEG C of water-baths.It is primary per 2-3min vortex oscillations；
(5) previous step acquired solution is added in adsorption column EC (adsorption column is put into collecting pipe), is placed at room temperature for 1min,
12000rpm centrifuges 30-60s, outwells the waste liquid in collecting pipe；
(6) 700 μ L rinsing liquids WB, 12000rpm centrifugation 30s are added, discard waste liquid；
(7) 500 μ L rinsing liquids WB, 12000rpm centrifugation 30s are added, discard waste liquid；
(8) adsorption column EC being put back in sky collecting pipe, 12000rpm centrifuges 2min, removes rinsing liquid as possible, in order to avoid rinsing
Residual ethanol inhibits downstream reaction in liquid；
(9) adsorption column EC is taken out, is put into a clean centrifuge tube, adds 50 μ L elutions slow at the intermediate position of adsorbed film
De- liquid EB (the slow de- liquid of elution heats in 65-70 DEG C of water-bath in advance), is placed at room temperature for 2min, 12000rpm, centrifuges 1min, collect
DNA solution.
1-4, connection reaction：
Coupled reaction system is as follows：2.25 μ L, 2 × Ligase Buffer (Ligase Solution) of PCR purified products
2.5 μ L, pMD19-T Vector, 0.25 μ L, operate on ice chest, and sterile PCR pipe, sample-adding is added in any of the above reaction reagent
After mixing, 16 DEG C of effect 5-6h.
The preparation of 1-5, competent cell：
(1) by DH5 α bacterial strains in the flat lining outs of LB, and it is inverted in overnight incubation in incubator；Picking DH5 α single bacterium colonies
It is inoculated in the LB liquid medium of 5mL, 37 DEG C of shaking baths, 160r/min overnight incubations, carries out level-one culture.
(2) level-one culture is inoculated with by 1~3% amount in new 5mL LB liquid mediums, 37 DEG C of shaking tables, 250r/min
2~3h is cultivated, two level culture is carried out, it is in cloud (OD to make bacterium solution600=0.6 or so).
(3) it will be dispensed into sterile 1.5mL centrifuge tubes after cultured bacterium solution ice bath 30min, often pipe 1mL, 4000r/
Min centrifuges 5min, removes supernatant.
(4) the 400 μ L 100mmol/L CaCl that precipitation is pre-chilled2Gently piping and druming makes thalline suspend, at 4 DEG C,
4000r/min centrifuges 5min, removes supernatant.
(5) cell, 100 μ L mmol/L CaCl of precipitation are recycled2Resuspension, carefully blows even, and ice bath is overnight, and often pipe presses 15
Sterile glycerol is added in~30% volume, and mixing, -70 DEG C save backup.
The conversion of 1-6, recombinant plasmid：
(1) whole connection products are slowly added in competent cell, side edged is gently mixed uniformly, ice bath 30min；
Heat shock 90s in (2) 42 DEG C of water-baths, then quickly moves to 2-3min in ice bath by pipe, should during not shake from
Heart pipe；
(3) LB liquid medium sterile 500 μ L (being free of antibiotic) is added in centrifuge tube, mixing is placed on 37
DEG C, 200rpm shake culture 1h, so that bacterium is recovered；
(4) 100 μ L of the competent cell converted is taken to be spread evenly across under germ-free condition on ammonia benzyl LB tablets, 37
DEG C culture 12h (first 1-2 hour be inverted cultivate).
The screening and identification of 1-7, positive transformant：
The single bacterium colony for being grown to water white transparency on the LB solid agar mediums of the benzyl containing ammonia is selected, is seeded to containing 100mg/
The LB liquid medium of mL ammonia benzyls, 37 DEG C, 185rpm shaken cultivations 12h.Bacterium colony PCR identifications are carried out, it is most solidifying through 1% agarose afterwards
Gel electrophoresis is analyzed.
1-8, Sequence analysis：
PCR identifications are carried out to culture bacterium solution, positive bacteria is filtered out, is sent to Shanghai bioengineering Co., Ltd and is sequenced,
Sequencing result is analyzed with DNAStar softwares with other Klebsiella Pneumoniaes FimK nucleotide sequences delivered.Clone sequence
Row are completely the same with standard sequence, successfully construct Klebsiella Pneumoniae positive plasmid.
Embodiment 2：Calcein visualizes the optimization of the detection reaction system of LAMP detection Klebsiella Pneumoniaes.
The optimization of 2-1, reaction temperature：
As shown in Figure 1, when temperature is set as 59 DEG C, amplification efficiency is low, but when temperature is from 61 DEG C to 64 DEG C, rate of amplification
Substantially it is continuously increased, when temperature is 65 DEG C, rate of amplification is begun to decline, therefore it is Klebsiella Pneumoniae LAMP reactions to take 64 DEG C
Optimum temperature.
2-2, the optimization in reaction time：
As shown in Fig. 2, when being set as 10min between when reacted, fail to detect reaction band；It is between when reacted
When 20min, a small amount of purpose amplified band can be detected by agarose gel electrophoresis；When between when reacted to 50min, in reaction
The amplified production optimum reacting time that tends to be saturated, therefore reacted as Klebsiella Pneumoniae LAMP using 50min.
The ratio optimization of 2-3, calcein and manganese ion：
As shown in figure 3, when calcein and manganese ion final concentration ratio are (1:8)25μM：When 0.2mM, calcein is visual
Change LAMP reacting positives and negative findings differentiation is most apparent, therefore the ratio of best calcein and manganese ion is 50 μM：0.5mM.
2-4、Mg2+Concentration optimization：
As shown in figure 4, in the final concentration of 4.0mM of magnesium ion, reaction efficiency tends to be steady, therefore selects 4.0mM as lung
Scorching klebsiella LAMP optimum response magnesium ion concentrations.
2-5, glycine betaine concentration optimization：
Band is most bright when as shown in Figure 5 glycine betaine final concentration of 0.5mM, and reaction efficiency is best, and beet alkali concentration is more than
When 0.5mM instead reaction amplification efficiency can decline.Therefore the best beet for selecting 0.5mM to be reacted as Klebsiella Pneumoniae LAMP
Alkali concentration.
2-6, dNTPs concentration optimization：
As shown in fig. 6, band is most bright when dNTPs final concentration of 1.2mM, reaction efficiency is best, and beet alkali concentration is more than
Amplification efficiency is reacted when 1.2mM to begin to decline.Therefore the best dNTPs for selecting 1.2mM to be reacted as Klebsiella Pneumoniae LAMP is dense
Degree.
2-7, Bst polymerase concentration optimize：
As shown in fig. 7, band is most bright when Bst polymerases final concentration of 0.32U/ μ L, reaction efficiency is best, therefore selects
The best Bst polymerase concentrations that 0.32U/ μ L are reacted as Klebsiella Pneumoniae LAMP.
2-8, interior outer primer ratio optimization：
As shown in figure 8, the best inner primer (FIP+BIP) and outer primer (F3+B3) ratio of optimization LAMP reactions are 1.6
μM：0.2μM.
2-9, ring outer primer ratio optimization：
As shown in figure 9, the best ring primer (LoopF+LoopB) of optimization LAMP reactions and outer primer (F3+B3) ratio are
0.8μM：0.2μM.
Embodiment 3：Calcein visualizes the specific test of LAMP detection Klebsiella Pneumoniaes.
Klebsiella Pneumoniae LAMP reaction products are tested into row agarose gel electrophoresis respectively, the results are shown in Figure 10,
Positive findings are presented in positive plasmid and Klebsiella Pneumoniae sample, and using the gene DNA of other aquatic pathogenic bacterias as mould
Plate carries out LAMP amplifications and is negative, and it is good to illustrate that the Klebsiella Pneumoniae calcein established visualization LAMP method has
Specificity.
Embodiment 4：Calcein visualizes the sensitivity tests of LAMP detection Klebsiella Pneumoniaes.
Sensitivity analysis is carried out to the Klebsiella Pneumoniae calcein visualization LAMP method of foundation, as a result such as Figure 11 institutes
Show, it is respectively 2.0 × 10 that calcein, which visualizes LAMP (figure a) and PCR (figure c) for the Monitoring lower-cut of FimK genes,2Copy/
Reaction and 2.0 × 104Copy/reaction, calcein visualize LAMP (figure a) methods and LAMP agarose gel electrophoresis (figure b)
The sensibility of detection method is consistent, than 100 times of the sensitivity of PCR method.As can be seen that calcein visualization LAMP method
As a result more intuitive accurate.
Embodiment 5：Calcein visualizes the detection application of LAMP detection Klebsiella Pneumoniaes.
Use conventional PCR method, calcein visual respectively the pathological material of disease of 60 parts of Diagnosis of Suspected Pneumonia Klebsiella infections of acquisition
Change LAMP method to be detected.When being detected with PCR method, have 23 parts of samples be positive positive rate be 38.3%；Use calcein
When visualizing LAMP method detection, there are 27 parts of samples to be positive, recall rate rate 45.0%.
SEQUENCE LISTING
<110>Foshan Science ＆. Technology College
<120>A kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes
<130> 2018
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 266
<212> DNA
<213>Artificial sequence
<400> 1
gggagcgtta tctttccggc gcgtcgactg cacttcaatg cgtataaact ggatatgagc 60
atcgtcaacg acgcccagca cgatccaaag gcgcttgcgc taataaaaag cctggcctac 120
tactgccagt taagcgacag tcgctgtgtg gcggaagggg tggattcact ggcgaaattt 180
acgcagttaa aatcgctggg gattgatcgc ttccagggct atctgttttc accaccgatg 240
cggcgtgaac atctcccgga tctgat 266
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<400> 2
gggagcgtta tctttccg 18
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence
<400> 3
atcagatccg ggagatgtt 19
<210> 4
<211> 41
<212> DNA
<213>Artificial sequence
<400> 4
tttattagcg caagcgcctt tgactgcact tcaatgcgta t 41
<210> 5
<211> 40
<212> DNA
<213>Artificial sequence
<400> 5
actgccagtt aagcgacagt ctccccagcg attttaactg 40
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence
<400> 6
ttgacgatgc tcatatccag tt 22
<210> 7
<211> 18
<212> DNA
<213>Artificial sequence
<400> 7
ggtggattca ctggcgaa 18
Claims (4)
1. a kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes, which is characterized in that in 25 μ L
Reaction volume include following reagent：
2. the detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes according to claim 1,
It is characterized in that, the final concentration of each reagent is respectively：
3. the detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes according to claim 2,
It is characterized in that, the optimal reaction temperature of reaction system is 64 DEG C.
4. the detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes according to claim 2,
It is characterized in that, the optimum reacting time of reaction system is 50min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810416127.XA CN108588183A (en) | 2018-05-03 | 2018-05-03 | A kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810416127.XA CN108588183A (en) | 2018-05-03 | 2018-05-03 | A kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108588183A true CN108588183A (en) | 2018-09-28 |
Family
ID=63620649
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810416127.XA Pending CN108588183A (en) | 2018-05-03 | 2018-05-03 | A kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108588183A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750114A (en) * | 2019-01-24 | 2019-05-14 | 中国人民解放军空军特色医学中心 | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production |
| CN114317688A (en) * | 2022-01-27 | 2022-04-12 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | Visual mixed dye and application thereof in LAMP detection |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328175A (en) * | 2014-10-27 | 2015-02-04 | 中国人民解放军第四军医大学 | Loop-mediated isothermal amplification (LAMP) primers, kit and method for detecting mouse Klebsiella pneumoniae |
| CN107475434A (en) * | 2017-10-09 | 2017-12-15 | 佛山科学技术学院 | Loop-mediated isothermal amplification (LAMP) primer group, kit and its detection method of a kind of Klebsiella Pneumoniae |
-
2018
- 2018-05-03 CN CN201810416127.XA patent/CN108588183A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328175A (en) * | 2014-10-27 | 2015-02-04 | 中国人民解放军第四军医大学 | Loop-mediated isothermal amplification (LAMP) primers, kit and method for detecting mouse Klebsiella pneumoniae |
| CN107475434A (en) * | 2017-10-09 | 2017-12-15 | 佛山科学技术学院 | Loop-mediated isothermal amplification (LAMP) primer group, kit and its detection method of a kind of Klebsiella Pneumoniae |
Non-Patent Citations (2)
| Title |
|---|
| B. PADMAVATHY • R. VINOTH KUMAR等: "Rapid and Sensitive Detection of Major Uropathogens in a Single-Pot Multiplex PCR Assay", 《CURR MICROBIOL》 * |
| 李富祥等: "肺炎克雷伯菌TaqMan荧光定量PCR检测方法的建立", 《中国兽医科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750114A (en) * | 2019-01-24 | 2019-05-14 | 中国人民解放军空军特色医学中心 | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production |
| CN114317688A (en) * | 2022-01-27 | 2022-04-12 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | Visual mixed dye and application thereof in LAMP detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102965438B (en) | Duplex polymerase chain reaction (PCR) detection primer group, kit and method for pathogenic channa source aeromonas schubertii | |
| CN113583973B (en) | High-lytic Klebsiella pneumoniae RDP-KP-20007 and application thereof | |
| CN102154472B (en) | Quantitative detection method of salmonella living body in water | |
| CN101532052B (en) | Susceptible/resistant MUC13 molecular marker capable of identifying F4 weaning brash of piglets and application | |
| CN108588183A (en) | A kind of detection reaction system of calcein visualization LAMP detection Klebsiella Pneumoniaes | |
| WO2020136595A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN104342496B (en) | A kind of quick detection, identify that Liszt belongs to the method for bacterium | |
| CN101724692B (en) | Primer and diagnosis method used for diagnosing mulberry bacterial wilt disease | |
| CN102102127B (en) | Quick, simple and convenient detecting method for human alpha-lactalbumin gene transformed cows | |
| CN108103152B (en) | Rapid detection method for Listonella anguillarum | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| CN106939347B (en) | Dual PCR (polymerase chain reaction) rapid detection kit and method for pathogenic vibrio natriegens of portunus trituberculatus | |
| CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus | |
| JP5979657B2 (en) | Primers and detection kits for detection of Escherichia coli causing food poisoning | |
| CN106701994A (en) | Double PCR (Polymerase chain reaction) primer for simultaneous detection of Klebsiella pneumoniae and Aeromonas caviae and detection method of double PCR primer | |
| CN104164514B (en) | Detect Edwardsiella tarda with the fluorescent probe PCR method of Channel-catfish tarda simultaneously | |
| CN102102126B (en) | Quick, simple and convenient detection method for transgenic cows with human lactoferrin gene | |
| CN101153284A (en) | Gene of sheep type brucella M5 mycopremna ribosomal protein L7, its encoding protein and application | |
| CN105112570A (en) | Real-time RT-PCR (reverse transcription-polymerase chain reaction) specific primers, probe and method for detecting PSTVd (potato spindle tuber viroid) | |
| CN106222274B (en) | quick detection method for hollisgilettia | |
| CN110157784A (en) | A kind of detection method of the wide in range detection polymyxin drug resistant gene of applicable elements | |
| CN111534611A (en) | Fluorescent quantitative PCR method for detecting toxigenic streptococcus suis and corresponding kit | |
| CN108546743A (en) | A kind of Vibrio harveyi rapid detection method | |
| CN107177678B (en) | Method for selectively detecting live vibrio parahaemolyticus in seawater | |
| CN104313176A (en) | LAMP (loop-mediated isothermal amplification) detection primer combination for phytophthora palmivora, and LAMP detection kit and LAMP detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180928 |