CN108546743A - A kind of Vibrio harveyi rapid detection method - Google Patents
A kind of Vibrio harveyi rapid detection method Download PDFInfo
- Publication number
- CN108546743A CN108546743A CN201810439560.5A CN201810439560A CN108546743A CN 108546743 A CN108546743 A CN 108546743A CN 201810439560 A CN201810439560 A CN 201810439560A CN 108546743 A CN108546743 A CN 108546743A
- Authority
- CN
- China
- Prior art keywords
- vibrio
- primer
- seq
- probe
- classified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of Vibrio harveyi rapid detection method, wherein the nucleotides sequence of the forward primer used is classified as SEQ ID NO:1；The nucleotides sequence of reverse primer is classified as SEQ ID NO:2；The nucleotides sequence of probe is classified as SEQ ID NO:3.Detection method provided by the present invention can complete the detection of sample in 20min, and compared to other detection techniques, the reaction time greatly shortens；It is verified through specificity experiments, primer, probe and detection method provided by the present invention are in other vibrio bacterias such as vibrio parahaemolytious, Vibrio vulnificus and vibrio fluvialis etc., and just there is positive amplification in 3 kinds of pseudomonas aeruginosa, Aeromonas hydrophila and Pseudomonas fluorescens equal no cross reactions of common pathogen, only Vibrio harveyi type strain and separation strains.Using the result shows that the detection method high sensitivity, reproducible that the present invention is established, easy to operate, detection speed is fast, at low cost.
Description
Technical field
The invention belongs to disease technical field of microbial detection, and in particular to a kind of quick detection side of Vibrio harveyi
Method.
Background technology
Vibrios (Vibrio) disease is that fish, shrimp, shellfish is caused to endanger more serious one of bacteriosis, aquaculture
Industry is often because it is by huge economic loss.It is to belong to a kind of typical conditioned pathogen, when extraneous water body environmental degradation,
When various factors causes aquatic animal resistance to decline, morbid vibrio can be bred rapidly, and aquatic animal is caused to infect vibriosis.
Vibrio harveyi (Vibrio harvey) is a kind of tool flagellum, is in the Gram-negative bacteria of arcuation, can partly shine.Divide extensively
It is distributed in the higher waters of bank temperature, is attached to body surface and marine sediment of marine organisms etc., is both a kind of normal bacterium
Group, while being also important Marine Pathogenic Bacteria.The continuous development of China's fishery in recent years, aquatic products disease become increasingly conspicuous.Especially exist
It competes under overall situation, the breeding way of large scale and high density is widely used, and aquatic products disease generation frequency further increases, damage
Mistake is particularly acute.Vibrio harveyi as fish, shrimp, shellfishery main pathogens it, search out and a kind of being suitble to cultivation base
Ground can be detected the means of Vibrio harveyi on the spot, be of great importance for filling up this market has openings.
However traditional Vibrio harveyi detection method, such as selective medium and physiological and biochemical test detection, although
Also pathogen can be detected, but so that it can not meet the requirement of disease control the shortcomings of laborious, time-consuming and muting sensitivity.
Invention content
The present invention provides a kind of Vibrio harveyi rapid detection method, can quickly detect Vibrio harveyi, to more
Mend the deficiencies in the prior art.
Present invention firstly provides a kind of method of the detection Vibrio harveyi of non-disease diagnoses and treatment purpose, the sides
Method includes following step：
1) prepare the nucleic acid samples of detected bacterium
The genomic DNA for extracting detected bacterium is spare as amplification sample；
2) Real-time RPA reaction system systems are built
By for expanding Vibrio harveyi target gene forward primer and reverse primer and RPA probes be added to recombination
In enzymatic polymerization enzymatic amplification (RPA) system, the nucleic acid samples of step 1) preparation are added；It is added and enzyme powder is lyophilized, after mixing, transfer
Into PCR pipe, it is added after starting agent MgAc and carries out fluorescent quantitation reaction；Fluorescence signal is acquired, judges whether to form amplification song
Line determines whether that there are Vibrio harveyis with amplification curve presence or absence.
The forward primer, nucleotide sequence are as follows：
5′-AATCATCGTGTTAGTTGCCCTGCTACTTCCTGTTG-3′(35bp)(SEQ ID NO:1)
Reverse primer, nucleotide sequence are as follows：
5′-TGTTTAATTGAGGGTGGTTGATCGGTGTCAT-3′(31bp)(SEQ ID NO:2)；
The RPA probes, following (the SEQ ID NO of nucleotide sequence:3)：
5′-CCCTGCAGAATCACAATTTCGTCAAATTGGTGAATATCACAACGTG CCAG-3′(50bp)；
Wherein probe sequence Individual base is modified, and the marker of the 31st thymidine T is FAM, the 33rd gland
Purine A is replaced by tetrahydrofuran (THF), and the 35th thymidine T marker is BHQ, and 3 ' ends carry out C3Spacer modifications.
The fluorescent quantitation reaction, reaction condition are as follows：30s is a cycle at a temperature of 37 DEG C of identical temperature, totally 40
A cycle.
Primer and probe used in the present invention can be used for preparing the product of detection Vibrio harveyi.
Detection method provided by the present invention can complete the detection of sample in 20min, compared to other detection skills
Art, reaction time greatly shorten；It is verified through specificity experiments, primer, probe and detection method provided by the present invention are at other
Vibrio bacteria such as vibrio parahaemolytious, Vibrio vulnificus and vibrio fluvialis etc. and pseudomonas aeruginosa, Aeromonas hydrophila and glimmering
Just there is the positive in 3 kinds of equal no cross reactions of common pathogen of light pseudomonad, only Vibrio harveyi type strain and separation strains
Amplification.Using the result shows that detection method high sensitivity, reproducible, easy to operate, the detection speed that the present invention is established
Soon, at low cost, special instrument and equipment and experiment condition are not needed, portable devices are suitable for Vibrio harveyi extensively
POCT。
Description of the drawings
Fig. 1：Primer screening result figure；
Fig. 2：Temperature optimization result figure；
Fig. 3：Concentration and probe concentration optimum results
Fig. 4：Specific detection result figure, wherein：1. 2. Vibrio harveyi NBV269 of Vibrio harveyi CGMCC1.1599
3. 7. vibrio fluvialis of Vibrio harveyi 10-S5 4. Vibrio harveyi 9-S29,5. Listonella anguillarum, 6. Vibrio vulnificus, 8. fluorescence
9. slow type tarda of pseudomonad, 10. vibrio parahaemolytious 11.12. Aeromonas hydrophila NTC. of pseudomonas aeruginosa is cloudy
Property control；
Fig. 5：Sensitivity technique result figure；
Fig. 6：Real-time RPA detection method repeated experiment result figures.
Specific implementation mode
Applicant is using toxR (toxin regulator) gene of Vibrio harveyi as target gene, in the conservative of the gene
Suitable fragments design probe is chosen on region and designs multipair primer on its both sides, is repeatedly optimized, is established a set of quick detection and breathe out
The Real-time RPA methods of Vickers vibrios.
The source-information of sample used in the present invention is as follows：
Vibrio harveyi (Vibrio harveyi CGMCC1.1599), Vibrio vulnificus (V.vulnificus
ATCC27562), vibrio fluvialis (V.fluvialis LMG7894) and pseudomonas aeruginosa (Pseudomonas aeruginosa
CGMCC1.1785) purchase is in Chinese Sea Microbiological Culture Collection administrative center (Marine Culture Collection of
China, MCCC), Aeromonas hydrophila (Aeromonas hydrophila CGMCC1.2017), vibrio parahaemolytious (Vibrio
Parahaemolyticus CGMCC1.1997), Listonella anguillarum (Listonella anguillarum ATCC19264)
It is bought in Chinese microorganism strain preservation pipe with Pseudomonas fluorescens (Pseudomonas fluorescens CGMCC1.6279)
Reason committee common micro-organisms center (China General Microbiological Culture Collection
Center), Vibrio harveyi (Vibrio harveyi NBV269), Vibrio harveyi (Vibrio harveyi 10-S5),
Vibrio harveyi (Vibrio harveyi 9-S29) has the separation identification of this laboratory, healthy Larimichthys crocea (Pseudosciaena
Crocea) purchase fish market near the school district of University Of Ningbo east.
The present invention is described in detail with reference to embodiment
Embodiment 1：The design and screening of primer, probe
According to the Vibrio harveyi toxR gene orders (AY247418) announced in GeneBank, 4 couples of PCR are designed
Amplimer (table 1) obtains the coded sequence of Vibrio harveyi CGMCC1.1599toxR genes, warp through PCR amplification, sequencing
Blast, which is compared, finds that this sequence only has higher matching with Vibrio harveyi genome.Pass through conserved structure domain search
(https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) toxR genes highly conserved sequence
Region one probe is designed, in the both sides of probe in the gene conserved regions toxR according to RPA amplification technique design of primers principles
3 upstreams and 3 downstream RPA primers (table 1) are devised for screening.Above-mentioned all primers, probe have by raw work biology work
Journey limited liability company (Shanghai, China) synthesis.The primer of synthesis screened using following step, and will be filtered out
Best primer sets are shared in reaction temperature (37 DEG C, 38 DEG C, 39 DEG C) and concentration and probe concentration (60nM, 90nM, 120nM, 150nM)
Optimization.
1) extraction of bacterial genomes
By five kinds of vibrios streak inoculations mentioned above after 2216E solid mediums, 37 DEG C of culture 18h, picking single bacterium
It falls in 2216E fluid nutrient mediums, is incubated overnight to logarithmic phase growth period in shaking table under the conditions of 37 DEG C；Verdigris is false single
Born of the same parents bacterium, Aeromonas hydrophila and Pseudomonas fluorescens streak inoculation are after LB solid mediums, 30 DEG C of culture 18h, picking single bacterium
It falls in LB liquid medium, is incubated overnight to logarithmic phase growth period in shaking table under the conditions of 30 DEG C.Take 2ml various fresh
Bacterium solution extracts various bacterial genomes DNA according to bacterial genomes extracts kit (Omega, the U.S.) specification step, will
DNA is dissolved in 100 μ lddH2In O, -20 DEG C save backup.
2) structure of Real-time RPA reaction systems and optimization
The reaction system of RPA is 20 μ L, including 0.84 μ L (10 μM) forward and reverse primer, 0.24 μ L (10 μM) exo probes,
11.8 μ L buffer solutions (rehydration buffer), 0.8 μ L Vibrio harveyis genomic templates or 0.8 μ LddH2O does blank
Control group adds ddH2O to 19 μ L.After mixing, freeze-drying enzyme powder, oscillation mixing, centrifugation is added.Finally it is transferred to the special PCR of Roche
Pipe is added 1.0 μ L and starts agent MgAc (280mM), closes the lid, rapid oscillation simultaneously centrifuges, and liquid on tube wall is made to be collected into pipe
Bottom.Reaction tube is transferred quickly to set program96 real-time fluorescence quantitative PCR instrument (Roche, it is beautiful
State).Reaction condition：37 DEG C of 30s of identical temperature are a cycle, acquire first order fluorescence signal, and totally 40 cycles, entirely reacted
The total 20min of journey.
Testing result has 4 pairs to obtain amplification curve, according to Ct values and fluorescence intensity obtain primer combination (RPA-F2 and
RPA-R3) expanding effect is best (Fig. 1), and subsequent experimental is carried out using this group of primer.According toExo kits
The reaction temperature (37~39 DEG C) recommended on specification selects 37,38,39 DEG C 3 different reaction temperatures to carry out Real-
Time RPA isothermal amplification techniques expand, and as a result see Fig. 2.Ct values are minimum under same reaction system, at 37 DEG C, fluorescence is strong
Degree is most strong, therefore determines that Real-time RPA isothermal amplification technique reaction temperatures are 37 DEG C.Under the conditions of 37 DEG C, according toThe concentration and probe concentration range (60~150nM) recommended in exo kit specifications, is respectively set four probes
Concentration gradient (60nM, 90nM, 120nM, 150nM) optimizes.As a result when concentration and probe concentration is 90nM, amplification efficiency is best
(Fig. 3).
Table 1：Relevant primer and probe sequence information table
It is final to determine that the primer and probe used is as follows：
Forward primer, nucleotide sequence are as follows：
5′-AATCATCGTGTTAGTTGCCCTGCTACTTCCTGTTG-3′(35bp)(SEQ ID NO:1)
Reverse primer, nucleotide sequence are as follows：
5′-TGTTTAATTGAGGGTGGTTGATCGGTGTCAT-3′(31bp)(SEQ ID NO:2)；
The sequence and fluorescent marker of probe are as follows：
5′-CCCTGCAGAATCACAATTTCGTCAAATTGGTGAATATCACAACGTGCCA G-3′(50bp)(SEQ
ID NO:3)；
Embodiment 2：The specificity of detection method
7 kinds of common aquatic pathogenic bacteria genomic DNAs of selective extraction, including Vibrio vulnificus, vibrio fluvialis, verdigris are false single
Born of the same parents bacterium, Aeromonas hydrophila, vibrio parahaemolytious, Vibrio harveyi and Pseudomonas fluorescens, and Vibrio harveyi genomic DNA,
Various genomic DNAs are diluted to 10ng/ μ L, reaction system and program are shown in embodiment 1, the real-time after optimizing with verification
The specificity of RPA detection methods.The result shows that：In addition to positive amplification curve occurs in Vibrio harveyi, and other seven plants of bacterium do not go out
Also there is (Fig. 4) without amplification curve in existing amplification curve, no template plus water control group, illustrate the Real-time RPA detections of structure
Method specificity is good.
Embodiment 3：The sensitivity of detection method
By the Vibrio harveyi genomic DNA ddH of extraction2O is diluted to a concentration of 10ng/ μ L, 1ng/ μ L, 100pg/ μ
L, six 10pg/ μ L, 1pg/ μ L, 100fg/ μ L concentration gradients.The template DNA and ddH of the 0.8 various concentration of μ L are taken respectively2O into
The comparison of row Real-time RPA and Real-time PCR detection method sensitivity differences.Real-time RPA reaction conditions
See 1.3 and 1.4 with system.In Real-time PCR amplifications primer (Q-F/Q-R, table 1) citation it has been reported that primer sequence
Row, the control of the Real-time RPA methods as structure.Real-time PCR amplification systems are 20 μ L, including 2 ×
Power SYBR Green I premixed liquids (Kang Wei centuries, Beijing) 10 μ L, each 1 μ L of forward and reverse primer filtered out, DNA profiling
Or ddH21 μ L of O, use ddH2O polishings are to 20 μ L.Real-time PCR response procedures are three-step approach：95 DEG C of pre-degeneration 10min；
95 DEG C of denaturation 10s, 50s and 72 DEG C of extension 60s of 52 DEG C of annealing 30 are recycled totally, melting curve analysis (96 is real
When fluorescence quantitative PCR instrument default program):95 DEG C of 10s, 65 DEG C of 60s, 97 DEG C of 1s, this process constantly collect fluorescence signal, are formed
Melting curve.
The result shows that the template concentrations that detect of primed probe most low energy of the present invention be 10pg/ μ L, 1pg/ μ L and
100fg/ μ L and then occurs without amplification curve without Template-negative controls group and negative (Fig. 5) is presented, the detection sides Real-time PCR
Method can detect that minimum template concentrations are 100pg/ μ L
Embodiment 4：The repeatability of detection method
Minimum genomic DNA concentration can be detected with what is determined in embodiment 3, by the reaction system built in embodiment
And condition, three groups of parallel laboratory tests are carried out, the repeatability of the detection method of foundation is verified.The result shows that：In three groups of parallel laboratory tests
In, there is positive amplification curve, and add water negative control group then without amplification curve, illustrate the Real-time RPA inspections of structure
Survey method has good stability (Fig. 6).
Embodiment 5：The detection of artificial contamination's sample
The fresh Vibrio harveyi CGMCC1.1599 bacterium solutions that 1mL is incubated overnight are taken, simultaneously 10 times of concentration gradients are dilute for plate count
It releases to 4.0 × 105、4.0×104、4.0×103、4.0×102、4.0×101And 4.0 × 100cfumL-1Concentration takes above-mentioned
Each 1mL of concentration bacterium solution and isometric healthy muscles of Pseudosciaena crocea tissue homogenate mixing.Each concentration 3 samples of parallel preparation.It takes
The muscles of Pseudosciaena crocea tissue sample 1mL of various concentration germ contaminations, using animal tissue's genome DNA extracting reagent kit
(Omega, the U.S.) extracts the genomic DNA of germ contamination sample, is dissolved in 100 μ LddH2In O, it is used as Real-time RPA
With the template of Real-time PCR detections, the muscle homogenate liquid genomic DNA and Vibrio harveyi of healthy Larimichthys crocea are taken
Genomic DNA (10ng/ μ L) makees negative and positive control.The result shows that method constructed by the present invention can from 4.0 ×
102Stable detection is to cause of disease in the muscles of Pseudosciaena crocea tissue homogenate of cfu/mL Vibrio harveyis pollution；And Real-time
PCR can only be from 4.0 × 103Stable detection is to cause of disease in the muscles of Pseudosciaena crocea tissue homogenate of cfu/mL Vibrio harveyis pollution
(table 2).Positive amplification is presented by the positive controls of template of Vibrio harveyi genomic DNA, with ddH2O is the moon of template
Property control group without amplification curve occur.
The testing result of 2 Vibrio harveyi bacterium artificial contamination's health muscles of Pseudosciaena crocea tissue of table
The above results show the detection sensitivity of the detection method of primer provided by the present invention, probe and structure very
Height can specifically detect the Vibrio harveyi of separate sources, and feminine gender is presented in other 7 plants of aquatic products common pathogens,
Specificity and repeatability are good.Due to being carried out under conditions of identical temperature, pre-degeneration need not be carried out to template strand, therefore
The efficiency of amplification greatly improves, it is only necessary to and amplification can be completed in 20min, and round pcr detection time then needs 1~2h, so this
Inventive method when detecting between it is upper there is huge advantage, be very suitable for the detection of aquatic products disease.
Claims (6)
1. a kind of method of the detection Vibrio harveyi of non-disease diagnoses and treatment purpose, which is characterized in that the method includes
Following step：
1) prepare the nucleic acid samples of detected bacterium
The genomic DNA for extracting detected bacterium is spare as amplification sample；
2) Real-time RPA reaction system systems are built
By for expanding Vibrio harveyi target gene forward primer and reverse primer and RPA probes be added to recombination enzymatic polymerization
In enzymatic amplification system, the nucleic acid samples of step 1) preparation are added；It is added and enzyme powder is lyophilized, after mixing, be transferred in PCR pipe, add
Fluorescent quantitation reaction is carried out after entering to start agent MgAc；Fluorescence signal is acquired, judges whether to form amplification curve, be deposited with amplification curve
Whether determine whether that there are Vibrio harveyis；
The forward primer, nucleotides sequence are classified as SEQ ID NO:1；
Reverse primer, nucleotides sequence are classified as SEQ ID NO:2；
The RPA probes, nucleotides sequence are classified as SEQ ID NO:3：
Wherein the marker of the 31st thymidine T of probe sequence is FAM, and the 33rd adenine A is replaced by tetrahydrofuran THF
It changes, the 35th thymidine T marker is BHQ, and 3 ' ends carry out C3Spacer modifications.
2. the method as described in claim 1, which is characterized in that the fluorescent quantitation reaction, reaction condition are as follows：It is identical
30s is a cycle at a temperature of 37 DEG C of temperature, totally 40 cycles.
3. a kind of primer and probe for detecting Vibrio harveyi, which is characterized in that the sequence of the primer and probe is believed
Breath is as follows：
Forward primer, nucleotides sequence are classified as SEQ ID NO:1；
Reverse primer, nucleotides sequence are classified as SEQ ID NO:2；
RPA probes, nucleotides sequence are classified as SEQ ID NO:3：
Wherein the marker of the 31st thymidine T of probe sequence is FAM, and the 33rd adenine A is replaced by tetrahydrofuran THF
It changes, the 35th thymidine T marker is BHQ, and 3 ' ends carry out C3Spacer modifications.
4. application of the primer and probe in the product for preparing detection Vibrio harveyi described in claim 3.
5. application as claimed in claim 4, which is characterized in that the product is detection kit.
6. a kind of kit being applied to detection Vickers vibrios, which is characterized in that the kit includes for recombinase
Primer and probe described in the reagent and claim 3 of polymeric enzymatic amplification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810439560.5A CN108546743A (en) | 2018-05-09 | 2018-05-09 | A kind of Vibrio harveyi rapid detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810439560.5A CN108546743A (en) | 2018-05-09 | 2018-05-09 | A kind of Vibrio harveyi rapid detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108546743A true CN108546743A (en) | 2018-09-18 |
Family
ID=63494593
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810439560.5A Pending CN108546743A (en) | 2018-05-09 | 2018-05-09 | A kind of Vibrio harveyi rapid detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108546743A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111518928A (en) * | 2019-12-05 | 2020-08-11 | 广东美格基因科技有限公司 | TaqMan probe quantitative detection method for detecting vibrio harveyi and corresponding kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105296617A (en) * | 2015-10-10 | 2016-02-03 | 宁波大学 | Gene chip for detecting vibrio harveyi colony and using method of gene chip |
| CN106191298A (en) * | 2016-09-15 | 2016-12-07 | 宁波海洋研究院 | A kind of method detecting vibrio parahaemolyticus Vibrio parahaemolyticus |
| CN106811541A (en) * | 2017-03-23 | 2017-06-09 | 山东师范大学 | Primer, probe and kit for field quick detection pasteurella multocida |
-
2018
- 2018-05-09 CN CN201810439560.5A patent/CN108546743A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105296617A (en) * | 2015-10-10 | 2016-02-03 | 宁波大学 | Gene chip for detecting vibrio harveyi colony and using method of gene chip |
| CN106191298A (en) * | 2016-09-15 | 2016-12-07 | 宁波海洋研究院 | A kind of method detecting vibrio parahaemolyticus Vibrio parahaemolyticus |
| CN106811541A (en) * | 2017-03-23 | 2017-06-09 | 山东师范大学 | Primer, probe and kit for field quick detection pasteurella multocida |
Non-Patent Citations (1)
| Title |
|---|
| M.J.U. CONEJERO AND C.T. HEDREYDA: "Isolation of partial toxR gene of Vibrio harveyi and design of toxR-targeted PCR primers for species detection", 《JOURNAL OF APPLIED MICROBIOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111518928A (en) * | 2019-12-05 | 2020-08-11 | 广东美格基因科技有限公司 | TaqMan probe quantitative detection method for detecting vibrio harveyi and corresponding kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102443629B (en) | Fluorescence quantitative PCR (polymerase chain reaction) detection kit for salmonella and detection method thereof | |
| CN105176997B (en) | A kind of vibrio parahaemolytious, Mermaid luminous bacillus and Yellowtail nocardial detection primer group, detection kit and detection method | |
| CN102102124B (en) | Multiplex fluorescence PCR (Polymerase Chain Reaction) detection kit for typhoid/paratyphoid saimonella | |
| CN104450940B (en) | A kind of nucleotide sequence and detection method and detection kit for detecting Listeria Monocytogenes | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| Churruca et al. | Detection of Campylobacter jejuni and Campylobacter coli in chicken meat samples by real-time nucleic acid sequence-based amplification with molecular beacons | |
| CN105936935B (en) | PCR detection kit for rapidly identifying specific serotype salmonella | |
| CN104059975A (en) | Providencia O3, O4, O8, O12, O13 and O20 specific nucleotides and application thereof | |
| CN102154497A (en) | M-PCR (Multiplex Polymerase Chain Reaction) primers, probes and detection methods for vibrio cholerae, vibrio parahaemolyticus and salmonella | |
| Fell | Collection and identification of marine yeasts | |
| CN101381767A (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN102181518A (en) | Method for identifying marine water fecal pollution source by using genetic finger-print of Escherichia coli | |
| CN108103152A (en) | A kind of Listonella anguillarum rapid detection method | |
| CN108546743A (en) | A kind of Vibrio harveyi rapid detection method | |
| CN102140515A (en) | Nucleotides used for detecting important pathogenic bacteria in aquatic product and applications thereof | |
| CN103952483B (en) | DPO-PCR method is utilized to detect DPO primer sequence and the detection kit of vibrio alginolyticus | |
| CN105734166A (en) | Multiplex-PCR primer and application thereof in cultivation process of turbots | |
| CN102676678B (en) | PCR (Polymerase Chain Reaction) primer group for distinguishing five types of shellfish bait microalgae | |
| CN105624300A (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting pathogenic leptospira canicola | |
| CN104531860A (en) | Molecular detection method for shigella and application thereof | |
| CN106868198A (en) | It is a kind of at the same detect SILURIFORMES four kinds of pathogenic bacteria of fish multiple PCR primer group and detection method | |
| CN106701994A (en) | Double PCR (Polymerase chain reaction) primer for simultaneous detection of Klebsiella pneumoniae and Aeromonas caviae and detection method of double PCR primer | |
| CN106282392A (en) | A kind of Salmonella enteritidis PCR detection primer, detection kit and detection method | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN103333946A (en) | Rapid detection method for vibrio vulnificus and vibrio harveyi |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |